GGRNA Home | Help | Advanced search

2019-03-25 15:01:54, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001005731            5715 bp    mRNA    linear   PRI 19-MAY-2013
DEFINITION  Homo sapiens integrin, beta 4 (ITGB4), transcript variant 3, mRNA.
ACCESSION   NM_001005731
VERSION     NM_001005731.1  GI:54607032
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5715)
  AUTHORS   Yoshioka,T., Otero,J., Chen,Y., Kim,Y.M., Koutcher,J.A.,
            Satagopan,J., Reuter,V., Carver,B., de Stanchina,E., Enomoto,K.,
            Greenberg,N.M., Scardino,P.T., Scher,H.I., Sawyers,C.L. and
            Giancotti,F.G.
  TITLE     beta4 Integrin signaling induces expansion of prostate tumor
            progenitors
  JOURNAL   J. Clin. Invest. 123 (2), 682-699 (2013)
   PUBMED   23348745
  REMARK    GeneRIF: Mechanistic studies indicated that mutant ITGB4 fails to
            promote transactivation of ErbB2 and c-Met in prostate tumor
            progenitor cells and cancer cell lines.
REFERENCE   2  (bases 1 to 5715)
  AUTHORS   Ephstein,Y., Singleton,P.A., Chen,W., Wang,L., Salgia,R.,
            Kanteti,P., Dudek,S.M., Garcia,J.G. and Jacobson,J.R.
  TITLE     Critical role of S1PR1 and integrin beta4 in HGF/c-Met-mediated
            increases in vascular integrity
  JOURNAL   J. Biol. Chem. 288 (4), 2191-2200 (2013)
   PUBMED   23212923
  REMARK    GeneRIF: S1PR1 and ITGB4 transactivation are rate-limiting events
            in the transduction of HGF signals via a dynamic c-Met complex
            resulting in enhanced EC barrier integrity
REFERENCE   3  (bases 1 to 5715)
  AUTHORS   Peixoto da-Silva,J., Lourenco,S., Nico,M., Silva,F.H., Martins,M.T.
            and Costa-Neves,A.
  TITLE     Expression of laminin-5 and integrins in actinic cheilitis and
            superficially invasive squamous cell carcinomas of the lip
  JOURNAL   Pathol. Res. Pract. 208 (10), 598-603 (2012)
   PUBMED   22917688
  REMARK    GeneRIF: Most actinic cheilitis cases showed reduced expression of
            integrin beta4 and superficially invasive squamous cell carcinoma
            lacked intergrin beta4 in the invasive front.
REFERENCE   4  (bases 1 to 5715)
  AUTHORS   Kashyap,T. and Rabinovitz,I.
  TITLE     The calcium/calcineurin pathway promotes hemidesmosome stability
            through inhibition of beta4 integrin phosphorylation
  JOURNAL   J. Biol. Chem. 287 (39), 32440-32449 (2012)
   PUBMED   22865863
  REMARK    GeneRIF: MAPK activation is increased when [Ca(2+)](i) is
            increased, suggesting that calcineurin activates an additional
            mechanism that counteracts MAPK-induced beta4 phosphorylation.
REFERENCE   5  (bases 1 to 5715)
  AUTHORS   Kim,B.G., Gao,M.Q., Choi,Y.P., Kang,S., Park,H.R., Kang,K.S. and
            Cho,N.H.
  TITLE     Invasive breast cancer induces laminin-332 upregulation and
            integrin beta4 neoexpression in myofibroblasts to confer an
            anoikis-resistant phenotype during tissue remodeling
  JOURNAL   Breast Cancer Res. 14 (3), R88 (2012)
   PUBMED   22673183
  REMARK    GeneRIF: invasive breast cancer cells confer an anoikis-resistant
            phenotype on myofibroblasts during tissue remodeling by inducing
            laminin-332 upregulation and integrin beta4 neoexpression
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 5715)
  AUTHORS   Hogervorst,F., Kuikman,I., van Kessel,A.G. and Sonnenberg,A.
  TITLE     Molecular cloning of the human alpha 6 integrin subunit.
            Alternative splicing of alpha 6 mRNA and chromosomal localization
            of the alpha 6 and beta 4 genes
  JOURNAL   Eur. J. Biochem. 199 (2), 425-433 (1991)
   PUBMED   2070796
REFERENCE   7  (bases 1 to 5715)
  AUTHORS   Tamura,R.N., Rozzo,C., Starr,L., Chambers,J., Reichardt,L.F.,
            Cooper,H.M. and Quaranta,V.
  TITLE     Epithelial integrin alpha 6 beta 4: complete primary structure of
            alpha 6 and variant forms of beta 4
  JOURNAL   J. Cell Biol. 111 (4), 1593-1604 (1990)
   PUBMED   1976638
REFERENCE   8  (bases 1 to 5715)
  AUTHORS   Hogervorst,F., Kuikman,I., von dem Borne,A.E. and Sonnenberg,A.
  TITLE     Cloning and sequence analysis of beta-4 cDNA: an integrin subunit
            that contains a unique 118 kd cytoplasmic domain
  JOURNAL   EMBO J. 9 (3), 765-770 (1990)
   PUBMED   2311578
REFERENCE   9  (bases 1 to 5715)
  AUTHORS   Suzuki,S. and Naitoh,Y.
  TITLE     Amino acid sequence of a novel integrin beta 4 subunit and primary
            expression of the mRNA in epithelial cells
  JOURNAL   EMBO J. 9 (3), 757-763 (1990)
   PUBMED   2311577
REFERENCE   10 (bases 1 to 5715)
  AUTHORS   Kajiji,S., Tamura,R.N. and Quaranta,V.
  TITLE     A novel integrin (alpha E beta 4) from human epithelial cells
            suggests a fourth family of integrin adhesion receptors
  JOURNAL   EMBO J. 8 (3), 673-680 (1989)
   PUBMED   2542022
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from CA391583.1, X51841.1, X53587.1,
            AI318403.1 and X52186.1.
            
            Summary: Integrins are heterodimers comprised of alpha and beta
            subunits, that are noncovalently associated transmembrane
            glycoprotein receptors. Different combinations of alpha and beta
            polypeptides form complexes that vary in their ligand-binding
            specificities. Integrins mediate cell-matrix or cell-cell adhesion,
            and transduced signals that regulate gene expression and cell
            growth. This gene encodes the integrin beta 4 subunit, a receptor
            for the laminins. This subunit tends to associate with alpha 6
            subunit and is likely to play a pivotal role in the biology of
            invasive carcinoma. Mutations in this gene are associated with
            epidermolysis bullosa with pyloric atresia. Multiple alternatively
            spliced transcript variants encoding distinct isoforms have been
            found for this gene. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (3) lacks an in-frame exon in the
            coding region, as compared to variant 1. The encoded isoform 3 thus
            lacks an internal segment, as compared to isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: X51841.1, BC126411.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025086, ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-61                CA391583.1         109-169
            62-4497             X51841.1           1-4436
            4498-5470           X53587.1           4708-5680
            5471-5708           AI318403.1         1-238               c
            5709-5715           X52186.1           5690-5696
FEATURES             Location/Qualifiers
     source          1..5715
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="17"
                     /map="17q25"
     gene            1..5715
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="integrin, beta 4"
                     /db_xref="GeneID:3691"
                     /db_xref="HGNC:6158"
                     /db_xref="HPRD:00946"
                     /db_xref="MIM:147557"
     exon            1..177
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     exon            178..266
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     CDS             188..5446
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="isoform 3 precursor is encoded by transcript
                     variant 3; integrin beta-4 subunit; GP150; CD104 antigen"
                     /codon_start=1
                     /product="integrin beta-4 isoform 3 precursor"
                     /protein_id="NP_001005731.1"
                     /db_xref="GI:54607033"
                     /db_xref="CCDS:CCDS58599.1"
                     /db_xref="GeneID:3691"
                     /db_xref="HGNC:6158"
                     /db_xref="HPRD:00946"
                     /db_xref="MIM:147557"
                     /translation="
MAGPRPSPWARLLLAALISVSLSGTLANRCKKAPVKSCTECVRVDKDCAYCTDEMFRDRRCNTQAELLAAGCQRESIVVMESSFQITEETQIDTTLRRSQMSPQGLRVRLRPGEERHFELEVFEPLESPVDLYILMDFSNSMSDDLDNLKKMGQNLARVLSQLTSDYTIGFGKFVDKVSVPQTDMRPEKLKEPWPNSDPPFSFKNVISLTEDVDEFRNKLQGERISGNLDAPEGGFDAILQTAVCTRDIGWRPDSTHLLVFSTESAFHYEADGANVLAGIMSRNDERCHLDTTGTYTQYRTQDYPSVPTLVRLLAKHNIIPIFAVTNYSYSYYEKLHTYFPVSSLGVLQEDSSNIVELLEEAFNRIRSNLDIRALDSPRGLRTEVTSKMFQKTRTGSFHIRRGEVGIYQVQLRALEHVDGTHVCQLPEDQKGNIHLKPSFSDGLKMDAGIICDVCTCELQKEVRSARCSFNGDFVCGQCVCSEGWSGQTCNCSTGSLSDIQPCLREGEDKPCSGRGECQCGHCVCYGEGRYEGQFCEYDNFQCPRTSGFLCNDRGRCSMGQCVCEPGWTGPSCDCPLSNATCIDSNGGICNGRGHCECGRCHCHQQSLYTDTICEINYSAIHPGLCEDLRSCVQCQAWGTGEKKGRTCEECNFKVKMVDELKRAEEVVVRCSFRDEDDDCTYSYTMEGDGAPGPNSTVLVHKKKDCPPGSFWWLIPLLLLLLPLLALLLLLCWKYCACCKACLALLPCCNRGHMVGFKEDHYMLRENLMASDHLDTPMLRSGNLKGRDVVRWKVTNNMQRPGFATHAASINPTELVPYGLSLRLARLCTENLLKPDTRECAQLRQEVEENLNEVYRQISGVHKLQQTKFRQQPNAGKKQDHTIVDTVLMAPRSAKPALLKLTEKQVEQRAFHDLKVAPGYYTLTADQDARGMVEFQEGVELVDVRVPLFIRPEDDDEKQLLVEAIDVPAGTATLGRRLVNITIIKEQARDVVSFEQPEFSVSRGDQVARIPVIRRVLDGGKSQVSYRTQDGTAQGNRDYIPVEGELLFQPGEAWKELQVKLLELQEVDSLLRGRQVRRFHVQLSNPKFGAHLGQPHSTTIIIRDPDELDRSFTSQMLSSQPPPHGDLGAPQNPNAKAAGSRKIHFNWLPPSGKPMGYRVKYWIQGDSESEAHLLDSKVPSVELTNLYPYCDYEMKVCAYGAQGEGPYSSLVSCRTHQEVPSEPGRLAFNVVSSTVTQLSWAEPAETNGEITAYEVCYGLVNDDNRPIGPMKKVLVDNPKNRMLLIENLRESQPYRYTVKARNGAGWGPEREAIINLATQPKRPMSIPIIPDIPIVDAQSGEDYDSFLMYSDDVLRSPSGSQRPSVSDDTEHLVNGRMDFAFPGSTNSLHRMTTTSAAAYGTHLSPHVPHRVLSTSSTLTRDYNSLTRSEHSHSTTLPRDYSTLTSVSSHDSRLTAGVPDTPTRLVFSALGPTSLRVSWQEPRCERPLQGYSVEYQLLNGGELHRLNIPNPAQTSVVVEDLLPNHSYVFRVRAQSQEGWGREREGVITIESQVHPQSPLCPLPGSAFTLSTPSAPGPLVFTALSPDSLQLSWERPRRPNGDIVGYLVTCEMAQGGGPATAFRVDGDSPESRLTVPGLSENVPYKFKVQARTTEGFGPEREGIITIESQDGGPFPQLGSRAGLFQHPLQSEYSSITTTHTSATEPFLVDGLTLGAQHLEAGGSLTRHVTQEFVSRTLTTSGTLSTHMDQQFFQT
"
     sig_peptide     188..268
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     mat_peptide     269..5443
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /product="integrin beta-4 isoform 3"
     misc_feature    296..1546
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Integrin beta subunits (N-terminal portion of
                     extracellular region); Region: INB; smart00187"
                     /db_xref="CDD:197563"
     misc_feature    1814..1906
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cl09941"
                     /db_xref="CDD:209104"
     misc_feature    2063..2320
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Integrin beta tail domain; Region: Integrin_B_tail;
                     pfam07965"
                     /db_xref="CDD:149183"
     misc_feature    3155..3439
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Calx-beta domain; Region: Calx-beta; pfam03160"
                     /db_xref="CDD:202559"
     misc_feature    3569..3832
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(3749..3751,3794..3796)
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(3797..3802,3806..3811)
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    3806..3808
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    3806..3808
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    3845..4126
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(3845..3847,4055..4057,4100..4102)
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(4103..4108,4112..4117)
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    4382..4384
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    4397..4399
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    4559..4831
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(4559..4561,4751..4753,4796..4798)
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(4799..4804,4808..4813)
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    4898..5179
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(4898..4900,5099..5101,5144..5146)
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(5147..5152,5156..5161)
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     variation       194
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142907560"
     variation       198
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147285287"
     variation       200
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141077392"
     variation       201
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374855840"
     variation       208
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368149213"
     variation       244
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145773550"
     exon            267..349
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       272
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138695324"
     variation       299
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121912465"
     variation       303
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372947104"
     variation       331
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150023264"
     variation       332
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146966502"
     variation       334
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376523967"
     exon            350..451
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       363
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201532846"
     variation       369
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:80338755"
     variation       381
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200966154"
     variation       382
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372797886"
     variation       397
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200500313"
     exon            452..656
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       469
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146609350"
     variation       472
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373041337"
     variation       476
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369326405"
     variation       480
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143114124"
     variation       518
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141385926"
     variation       519
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200008946"
     variation       533
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146269824"
     variation       574
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140040189"
     variation       575
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141930616"
     variation       579
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113072439"
     variation       594
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:146338793"
     variation       632
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202029031"
     variation       643
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200344164"
     variation       654
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121912461"
     exon            657..753
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       682
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75092172"
     variation       689
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139287033"
     variation       700
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148048907"
     variation       724
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201538482"
     variation       730
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370508599"
     exon            754..925
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       766
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1131617"
     variation       786
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148770294"
     variation       802
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371826076"
     variation       837
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144968507"
     variation       858
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147952722"
     variation       889
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61751843"
     variation       895
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146923910"
     variation       914
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375136714"
     exon            926..1189
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       941
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201494421"
     variation       1013
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372938338"
     variation       1040
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150962076"
     variation       1046
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140750952"
     variation       1054
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150113215"
     variation       1101
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376322445"
     variation       1121
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201552574"
     variation       1158
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370704124"
     variation       1176
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370664880"
     variation       1186
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141725299"
     exon            1190..1279
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       1217
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201570276"
     variation       1219
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145591069"
     variation       1226
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374688114"
     variation       1243
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187527294"
     variation       1256
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138101366"
     variation       1278
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370095218"
     exon            1280..1402
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       1282
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141970956"
     variation       1323
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367872059"
     variation       1331
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141337579"
     variation       1368
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144655991"
     variation       1388
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200122430"
     variation       1399
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374254754"
     exon            1403..1564
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       1432
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199950498"
     variation       1449
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148535298"
     variation       1450
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372707561"
     variation       1453
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141916774"
     variation       1458
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370613824"
     variation       1468
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150638695"
     variation       1480
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371350190"
     variation       1482
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140201409"
     variation       1486
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375768413"
     variation       1507
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370124749"
     variation       1513
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139918000"
     variation       1529
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371466417"
     variation       1530
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144804175"
     variation       1532
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147963396"
     variation       1535
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140155423"
     variation       1561
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369171710"
     exon            1565..1641
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       1578
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145039852"
     variation       1581
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144917456"
     variation       1600
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375790655"
     variation       1615
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149030156"
     variation       1616
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370395920"
     variation       1621
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:8079267"
     variation       1633
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:8080369"
     exon            1642..1844
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       1653
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199770982"
     variation       1669
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374056611"
     variation       1700
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185794989"
     variation       1701
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151163670"
     variation       1708
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368066990"
     variation       1709
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140352471"
     variation       1720
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148312483"
     variation       1731
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61735297"
     variation       1766
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374033160"
     variation       1768
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374868983"
     variation       1773
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200038763"
     variation       1822
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372260270"
     variation       1828
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201078860"
     variation       1837
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1131618"
     variation       1840
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141067474"
     exon            1845..1948
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       1847
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121912462"
     variation       1853
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150166497"
     variation       1854
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142562582"
     variation       1871
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121912463"
     variation       1876
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149558612"
     variation       1936
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144302042"
     variation       1937
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139115559"
     exon            1949..2047
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       1976
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377678641"
     variation       1983..1984
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace=""
                     /replace="gc"
                     /db_xref="dbSNP:138423150"
     variation       1986
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201929789"
     variation       1992
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201103623"
     variation       1993
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371043426"
     variation       2008
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2290460"
     variation       2016
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377003186"
     variation       2017
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150965180"
     variation       2029
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147499356"
     exon            2048..2177
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       2056
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140690205"
     variation       2065
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373343133"
     variation       2071
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140078827"
     variation       2080
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61735295"
     variation       2083
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:8064949"
     variation       2098
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376183156"
     variation       2107
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:8064968"
     variation       2110
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:8064969"
     variation       2111
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200371855"
     variation       2123
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201350965"
     variation       2127
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150688188"
     variation       2155
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377703595"
     variation       2164
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:8065109"
     exon            2178..2300
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       2196
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149659118"
     variation       2212
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202097958"
     variation       2255
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113334156"
     variation       2256
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145520625"
     variation       2257
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140265734"
     variation       2260
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112985528"
     variation       2295
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:56119997"
     exon            2301..2407
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       2302
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:62639300"
     variation       2307
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368764776"
     variation       2310
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146500584"
     variation       2332
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140999738"
     variation       2394
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143203816"
     exon            2408..2441
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       2428
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377428995"
     exon            2442..2633
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       2450
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372308913"
     variation       2455
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201602364"
     variation       2515
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148267210"
     variation       2516
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140949891"
     variation       2546
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150184884"
     variation       2559
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376006066"
     variation       2572
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139153979"
     variation       2586
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369311929"
     variation       2587
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372120901"
     variation       2592
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143063063"
     variation       2609
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147480547"
     variation       2613
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138499170"
     exon            2634..2737
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       2641
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61735294"
     variation       2664
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200694443"
     variation       2690
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:183705877"
     variation       2708
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199531912"
     variation       2717
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149608383"
     variation       2718
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140819116"
     variation       2728
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370045621"
     variation       2737
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372551314"
     exon            2738..2796
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       2744
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144402600"
     variation       2764
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148787870"
     variation       2765
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201523797"
     variation       2790
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142065461"
     exon            2797..2820
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     exon            2821..2969
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       2825
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139092703"
     variation       2848
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144066301"
     variation       2857
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146449374"
     variation       2861
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139933962"
     variation       2862
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367733997"
     variation       2866
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149712551"
     variation       2875
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199539918"
     variation       2888
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145644205"
     variation       2913
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371215122"
     variation       2917
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61735292"
     variation       2923
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375687714"
     variation       2939
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376493221"
     variation       2941
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368406305"
     variation       2942
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372890193"
     exon            2970..3149
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       2971
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201900480"
     variation       2972
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143240391"
     variation       2976
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147887144"
     variation       2977
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62088211"
     variation       2979
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:121912466"
     variation       2989
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375239525"
     variation       3002
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199768958"
     variation       3012
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141526663"
     variation       3016
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147068910"
     variation       3020
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150668075"
     variation       3021
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141953294"
     variation       3039
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375270404"
     variation       3050
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369811701"
     variation       3082
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373517123"
     variation       3083
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150234651"
     variation       3085
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138945206"
     variation       3086
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375792088"
     variation       3091
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149443215"
     variation       3092
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55748088"
     variation       3095
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368913979"
     variation       3105
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:146391318"
     variation       3109
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139130590"
     variation       3110
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142329494"
     variation       3116
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145976111"
     variation       3148
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377676266"
     exon            3150..3298
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       3171
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374504143"
     variation       3183
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148629796"
     variation       3187
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142172735"
     variation       3204
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371525263"
     variation       3213
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377527264"
     variation       3228
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370080195"
     variation       3231
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151183954"
     variation       3244
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139146525"
     variation       3282
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200013889"
     variation       3286
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145314226"
     variation       3292
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147635062"
     exon            3299..3503
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       3304
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373859028"
     variation       3311
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141564265"
     variation       3378
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199739109"
     variation       3401
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368025166"
     variation       3408
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147026529"
     variation       3417
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201487753"
     variation       3420
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374238776"
     variation       3427
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368408505"
     variation       3428
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201802102"
     variation       3461
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200950497"
     exon            3504..3661
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       3504
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370112615"
     variation       3546
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200945563"
     variation       3560
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147695826"
     variation       3563
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199672740"
     variation       3571
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111568842"
     variation       3572
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201321412"
     variation       3577
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200774405"
     variation       3578
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371248151"
     variation       3598
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374304884"
     variation       3599
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143287482"
     variation       3614
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149481974"
     exon            3662..3842
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       3682
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1131626"
     variation       3688
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141513851"
     variation       3694
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113185087"
     variation       3706
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145910839"
     variation       3757
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138462843"
     variation       3785
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75129664"
     variation       3795
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369151880"
     variation       3811
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145928221"
     variation       3828
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139518734"
     variation       3835
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149284152"
     exon            3843..3980
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       3861
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:121912468"
     variation       3878
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368177827"
     variation       3916
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61735289"
     variation       3946
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376494263"
     variation       3962
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61735290"
     variation       3964
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148462413"
     variation       3980
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145202579"
     exon            3981..4163
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       3997
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373133055"
     variation       4014
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:11657833"
     variation       4027
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140567957"
     variation       4028
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121912467"
     variation       4036
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368037184"
     variation       4045
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372222796"
     variation       4048
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145351926"
     variation       4052..4053
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34092482"
     variation       4052
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200409597"
     variation       4071
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200586694"
     variation       4072
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375483568"
     variation       4097
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146489216"
     variation       4115
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369683446"
     variation       4124
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373174042"
     exon            4164..4295
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       4189
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372507006"
     variation       4195
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61735288"
     variation       4196
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187296783"
     variation       4205
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140930313"
     variation       4213
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377075513"
     variation       4241
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11759"
     variation       4244
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370453421"
     variation       4251
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373278372"
     variation       4254
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376560109"
     variation       4260
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368526254"
     variation       4279
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149807848"
     variation       4280
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145750695"
     variation       4286
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150008568"
     exon            4296..4535
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       4298
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368089324"
     variation       4319
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148986758"
     variation       4323
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200989039"
     variation       4336
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145760507"
     variation       4365
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372323678"
     variation       4372
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:138486001"
     variation       4379
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374857648"
     variation       4394
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138478973"
     variation       4407
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374564280"
     variation       4413
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375629632"
     variation       4415
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61735299"
     variation       4437
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145161839"
     variation       4458
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372644057"
     variation       4466
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148205043"
     variation       4485
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141137562"
     variation       4486
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3191773"
     variation       4498
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:8669"
     variation       4509
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374562982"
     variation       4534
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143636541"
     variation       4535
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149237647"
     exon            4536..4685
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       4566
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140575355"
     variation       4567
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144407069"
     variation       4620
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:121912464"
     variation       4630
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146620810"
     variation       4631
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141346422"
     variation       4640
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150277911"
     STS             4647..4710
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /standard_name="ksks329"
                     /db_xref="UniSTS:514374"
     variation       4682
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201832426"
     variation       4684
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138928712"
     exon            4686..4874
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       4697
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200760979"
     variation       4698
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146044025"
     variation       4702
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148827335"
     variation       4708
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143423379"
     variation       4728
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375075647"
     variation       4747
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201630581"
     variation       4765
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369145421"
     variation       4772
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373902577"
     variation       4834
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369462022"
     variation       4848
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148008349"
     variation       4863
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143575686"
     exon            4875..5030
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       4879
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:57812564"
     variation       4909
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368991974"
     variation       4934
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374293847"
     variation       4940
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12600339"
     variation       4942
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375771696"
     variation       4944
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370378040"
     variation       4971
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200991558"
     variation       4980
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373930132"
     variation       4990
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372195997"
     variation       5006
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200142052"
     exon            5031..5195
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       5032
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148658410"
     variation       5042
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372938774"
     variation       5049
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376139144"
     variation       5054
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142794337"
     variation       5066
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201023107"
     variation       5068
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150804109"
     variation       5082
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139181455"
     variation       5084
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149353166"
     variation       5098
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201439404"
     variation       5099
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144654848"
     variation       5104
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376733146"
     variation       5123
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139516338"
     variation       5125
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369204890"
     variation       5149
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144339436"
     variation       5170
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146573290"
     variation       5189
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200441318"
     exon            5196..5306
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       5201
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375857348"
     variation       5205
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368445689"
     variation       5206
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140140182"
     variation       5218
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11465"
     variation       5220
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151053969"
     variation       5225
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151327791"
     variation       5241
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140577812"
     variation       5244
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369596996"
     variation       5245
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:13623"
     variation       5250
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147573071"
     variation       5252
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141944501"
     variation       5267
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1051486"
     variation       5274
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373281667"
     variation       5284
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145897252"
     variation       5290
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138707718"
     variation       5291
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375975797"
     exon            5307..5709
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       5313
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:871443"
     variation       5314
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200798799"
     variation       5324
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201253100"
     variation       5330
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375287185"
     variation       5344
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200199740"
     variation       5345
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202129173"
     variation       5346
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372505125"
     variation       5358
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375778262"
     variation       5369
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371616348"
     variation       5385
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:80224547"
     variation       5394
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148061895"
     variation       5401
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141814228"
     variation       5402
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370673042"
     STS             5407..5597
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /standard_name="RH18101"
                     /db_xref="UniSTS:33806"
     variation       5412
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35234235"
     variation       5449
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375665623"
     variation       5450
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189610725"
     STS             5464..5715
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /standard_name="D17S2049"
                     /db_xref="UniSTS:31843"
     variation       5466
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371393052"
     variation       5467
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374796446"
     variation       5471
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:9367"
     variation       5483
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051554"
     variation       5484
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371860241"
     variation       5491
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200901360"
     STS             5505..5643
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /standard_name="RH47571"
                     /db_xref="UniSTS:80458"
     variation       5616
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377058449"
     variation       5619
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181093059"
     polyA_signal    5687..5692
                     /gene="ITGB4"
                     /gene_synonym="CD104"
     polyA_site      5709
                     /gene="ITGB4"
                     /gene_synonym="CD104"
ORIGIN      
gcgctgcccgcctcgtccccacccccccaacccccgcgcccgccctcggacagtccctgctcgcccgcgcgctgcagccccatctcctagcggcagcccaggcgcggagggagcgagtccgccccgaggtaggtccaggacgggcgcacagcagcagccgaggctggccgggagagggaggaagaggatggcagggccacgccccagcccatgggccaggctgctcctggcagccttgatcagcgtcagcctctctgggaccttggcaaaccgctgcaagaaggccccagtgaagagctgcacggagtgtgtccgtgtggataaggactgcgcctactgcacagacgagatgttcagggaccggcgctgcaacacccaggcggagctgctggccgcgggctgccagcgggagagcatcgtggtcatggagagcagcttccaaatcacagaggagacccagattgacaccaccctgcggcgcagccagatgtccccccaaggcctgcgggtccgtctgcggcccggtgaggagcggcattttgagctggaggtgtttgagccactggagagccccgtggacctgtacatcctcatggacttctccaactccatgtccgatgatctggacaacctcaagaagatggggcagaacctggctcgggtcctgagccagctcaccagcgactacactattggatttggcaagtttgtggacaaagtcagcgtcccgcagacggacatgaggcctgagaagctgaaggagccctggcccaacagtgacccccccttctccttcaagaacgtcatcagcctgacagaagatgtggatgagttccggaataaactgcagggagagcggatctcaggcaacctggatgctcctgagggcggcttcgatgccatcctgcagacagctgtgtgcacgagggacattggctggcgcccggacagcacccacctgctggtcttctccaccgagtcagccttccactatgaggctgatggcgccaacgtgctggctggcatcatgagccgcaacgatgaacggtgccacctggacaccacgggcacctacacccagtacaggacacaggactacccgtcggtgcccaccctggtgcgcctgctcgccaagcacaacatcatccccatctttgctgtcaccaactactcctatagctactacgagaagcttcacacctatttccctgtctcctcactgggggtgctgcaggaggactcgtccaacatcgtggagctgctggaggaggccttcaatcggatccgctccaacctggacatccgggccctagacagcccccgaggccttcggacagaggtcacctccaagatgttccagaagacgaggactgggtcctttcacatccggcggggggaagtgggtatataccaggtgcagctgcgggcccttgagcacgtggatgggacgcacgtgtgccagctgccggaggaccagaagggcaacatccatctgaaaccttccttctccgacggcctcaagatggacgcgggcatcatctgtgatgtgtgcacctgcgagctgcaaaaagaggtgcggtcagctcgctgcagcttcaacggagacttcgtgtgcggacagtgtgtgtgcagcgagggctggagtggccagacctgcaactgctccaccggctctctgagtgacattcagccctgcctgcgggagggcgaggacaagccgtgctccggccgtggggagtgccagtgcgggcactgtgtgtgctacggcgaaggccgctacgagggtcagttctgcgagtatgacaacttccagtgtccccgcacttccgggttcctctgcaatgaccgaggacgctgctccatgggccagtgtgtgtgtgagcctggttggacaggcccaagctgtgactgtcccctcagcaatgccacctgcatcgacagcaatgggggcatctgtaatggacgtggccactgtgagtgtggccgctgccactgccaccagcagtcgctctacacggacaccatctgcgagatcaactactcggcgatccacccgggcctctgcgaggacctacgctcctgcgtgcagtgccaggcgtggggcaccggcgagaagaaggggcgcacgtgtgaggaatgcaacttcaaggtcaagatggtggacgagcttaagagagccgaggaggtggtggtgcgctgctccttccgggacgaggatgacgactgcacctacagctacaccatggaaggtgacggcgcccctgggcccaacagcactgtcctggtgcacaagaagaaggactgccctccgggctccttctggtggctcatccccctgctcctcctcctcctgccgctcctggccctgctactgctgctatgctggaagtactgtgcctgctgcaaggcctgcctggcacttctcccgtgctgcaaccgaggtcacatggtgggctttaaggaagaccactacatgctgcgggagaacctgatggcctctgaccacttggacacgcccatgctgcgcagcgggaacctcaagggccgtgacgtggtccgctggaaggtcaccaacaacatgcagcggcctggctttgccactcatgccgccagcatcaaccccacagagctggtgccctacgggctgtccttgcgcctggcccgcctttgcaccgagaacctgctgaagcctgacactcgggagtgcgcccagctgcgccaggaggtggaggagaacctgaacgaggtctacaggcagatctccggtgtacacaagctccagcagaccaagttccggcagcagcccaatgccgggaaaaagcaagaccacaccattgtggacacagtgctgatggcgccccgctcggccaagccggccctgctgaagcttacagagaagcaggtggaacagagggccttccacgacctcaaggtggcccccggctactacaccctcactgcagaccaggacgcccggggcatggtggagttccaggagggcgtggagctggtggacgtacgggtgcccctctttatccggcctgaggatgacgacgagaagcagctgctggtggaggccatcgacgtgcccgcaggcactgccaccctcggccgccgcctggtaaacatcaccatcatcaaggagcaagccagagacgtggtgtcctttgagcagcctgagttctcggtcagccgcggggaccaggtggcccgcatccctgtcatccggcgtgtcctggacggcgggaagtcccaggtctcctaccgcacacaggatggcaccgcgcagggcaaccgggactacatccccgtggagggtgagctgctgttccagcctggggaggcctggaaagagctgcaggtgaagctcctggagctgcaagaagttgactccctcctgcggggccgccaggtccgccgtttccacgtccagctcagcaaccctaagtttggggcccacctgggccagccccactccaccaccatcatcatcagggacccagatgaactggaccggagcttcacgagtcagatgttgtcatcacagccaccccctcacggcgacctgggcgccccgcagaaccccaatgctaaggccgctgggtccaggaagatccatttcaactggctgcccccttctggcaagccaatggggtacagggtaaagtactggattcagggtgactccgaatccgaagcccacctgctcgacagcaaggtgccctcagtggagctcaccaacctgtacccgtattgcgactatgagatgaaggtgtgcgcctacggggctcagggcgagggaccctacagctccctggtgtcctgccgcacccaccaggaagtgcccagcgagccagggcgtctggccttcaatgtcgtctcctccacggtgacccagctgagctgggctgagccggctgagaccaacggtgagatcacagcctacgaggtctgctatggcctggtcaacgatgacaaccgacctattgggcccatgaagaaagtgctggttgacaaccctaagaaccggatgctgcttattgagaaccttcgggagtcccagccctaccgctacacggtgaaggcgcgcaacggggccggctgggggcctgagcgggaggccatcatcaacctggccacccagcccaagaggcccatgtccatccccatcatccctgacatccctatcgtggacgcccagagcggggaggactacgacagcttccttatgtacagcgatgacgttctacgctctccatcgggcagccagaggcccagcgtctccgatgacactgagcacctggtgaatggccggatggactttgccttcccgggcagcaccaactccctgcacaggatgaccacgaccagtgctgctgcctatggcacccacctgagcccacacgtgccccaccgcgtgctaagcacatcctccaccctcacacgggactacaactcactgacccgctcagaacactcacactcgaccacactgcccagggactactccaccctcacctccgtctcctcccacgactctcgcctgactgctggtgtgcccgacacgcccacccgcctggtgttctctgccctggggcccacatctctcagagtgagctggcaggagccgcggtgcgagcggccgctgcagggctacagtgtggagtaccagctgctgaacggcggtgagctgcatcggctcaacatccccaaccctgcccagacctcggtggtggtggaagacctcctgcccaaccactcctacgtgttccgcgtgcgggcccagagccaggaaggctggggccgagagcgtgagggtgtcatcaccattgaatcccaggtgcacccgcagagcccactgtgtcccctgccaggctccgccttcactttgagcactcccagtgccccaggcccgctggtgttcactgccctgagcccagactcgctgcagctgagctgggagcggccacggaggcccaatggggatatcgtcggctacctggtgacctgtgagatggcccaaggaggagggccagccaccgcattccgggtggatggagacagccccgagagccggctgaccgtgccgggcctcagcgagaacgtgccctacaagttcaaggtgcaggccaggaccactgagggcttcgggccagagcgcgagggcatcatcaccatagagtcccaggatggaggacccttcccgcagctgggcagccgtgccgggctcttccagcacccgctgcaaagcgagtacagcagcatcaccaccacccacaccagcgccaccgagcccttcctagtggatgggctgaccctgggggcccagcacctggaggcaggcggctccctcacccggcatgtgacccaggagtttgtgagccggacactgaccaccagcggaacccttagcacccacatggaccaacagttcttccaaacttgaccgcaccctgccccacccccgccacgtcccactaggcgtcctcccgactcctctcccggagcctcctcagctactccatccttgcacccctgggggcccagcccacccgcatgcacagagcaggggctaggtgtctcctgggaggcatgaagggggcaaggtccgtcctctgtgggcccaaacctatttgtaaccaaagagctgggagcagcacaaggacccagcctttgttctgcacttaataaatggttttgctactgctaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:3691 -> Molecular function: GO:0004872 [receptor activity] evidence: IEA
            GeneID:3691 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:3691 -> Biological process: GO:0007155 [cell adhesion] evidence: NAS
            GeneID:3691 -> Biological process: GO:0007160 [cell-matrix adhesion] evidence: IEA
            GeneID:3691 -> Biological process: GO:0007229 [integrin-mediated signaling pathway] evidence: IEA
            GeneID:3691 -> Biological process: GO:0007275 [multicellular organismal development] evidence: IEA
            GeneID:3691 -> Biological process: GO:0009611 [response to wounding] evidence: IDA
            GeneID:3691 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS
            GeneID:3691 -> Biological process: GO:0031581 [hemidesmosome assembly] evidence: IDA
            GeneID:3691 -> Biological process: GO:0031581 [hemidesmosome assembly] evidence: TAS
            GeneID:3691 -> Biological process: GO:0034329 [cell junction assembly] evidence: TAS
            GeneID:3691 -> Biological process: GO:0046847 [filopodium assembly] evidence: IEA
            GeneID:3691 -> Biological process: GO:0048870 [cell motility] evidence: IMP
            GeneID:3691 -> Cellular component: GO:0005604 [basement membrane] evidence: IEA
            GeneID:3691 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
            GeneID:3691 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
            GeneID:3691 -> Cellular component: GO:0008305 [integrin complex] evidence: IEA
            GeneID:3691 -> Cellular component: GO:0009925 [basal plasma membrane] evidence: IEA
            GeneID:3691 -> Cellular component: GO:0009986 [cell surface] evidence: IDA
            GeneID:3691 -> Cellular component: GO:0030056 [hemidesmosome] evidence: IDA
            GeneID:3691 -> Cellular component: GO:0031252 [cell leading edge] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.