GGRNA Home | Help | Advanced search

2019-03-25 14:33:36, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001005619            5695 bp    mRNA    linear   PRI 19-MAY-2013
DEFINITION  Homo sapiens integrin, beta 4 (ITGB4), transcript variant 2, mRNA.
ACCESSION   NM_001005619
VERSION     NM_001005619.1  GI:54607026
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5695)
  AUTHORS   Yoshioka,T., Otero,J., Chen,Y., Kim,Y.M., Koutcher,J.A.,
            Satagopan,J., Reuter,V., Carver,B., de Stanchina,E., Enomoto,K.,
            Greenberg,N.M., Scardino,P.T., Scher,H.I., Sawyers,C.L. and
            Giancotti,F.G.
  TITLE     beta4 Integrin signaling induces expansion of prostate tumor
            progenitors
  JOURNAL   J. Clin. Invest. 123 (2), 682-699 (2013)
   PUBMED   23348745
  REMARK    GeneRIF: Mechanistic studies indicated that mutant ITGB4 fails to
            promote transactivation of ErbB2 and c-Met in prostate tumor
            progenitor cells and cancer cell lines.
REFERENCE   2  (bases 1 to 5695)
  AUTHORS   Ephstein,Y., Singleton,P.A., Chen,W., Wang,L., Salgia,R.,
            Kanteti,P., Dudek,S.M., Garcia,J.G. and Jacobson,J.R.
  TITLE     Critical role of S1PR1 and integrin beta4 in HGF/c-Met-mediated
            increases in vascular integrity
  JOURNAL   J. Biol. Chem. 288 (4), 2191-2200 (2013)
   PUBMED   23212923
  REMARK    GeneRIF: S1PR1 and ITGB4 transactivation are rate-limiting events
            in the transduction of HGF signals via a dynamic c-Met complex
            resulting in enhanced EC barrier integrity
REFERENCE   3  (bases 1 to 5695)
  AUTHORS   Peixoto da-Silva,J., Lourenco,S., Nico,M., Silva,F.H., Martins,M.T.
            and Costa-Neves,A.
  TITLE     Expression of laminin-5 and integrins in actinic cheilitis and
            superficially invasive squamous cell carcinomas of the lip
  JOURNAL   Pathol. Res. Pract. 208 (10), 598-603 (2012)
   PUBMED   22917688
  REMARK    GeneRIF: Most actinic cheilitis cases showed reduced expression of
            integrin beta4 and superficially invasive squamous cell carcinoma
            lacked intergrin beta4 in the invasive front.
REFERENCE   4  (bases 1 to 5695)
  AUTHORS   Kashyap,T. and Rabinovitz,I.
  TITLE     The calcium/calcineurin pathway promotes hemidesmosome stability
            through inhibition of beta4 integrin phosphorylation
  JOURNAL   J. Biol. Chem. 287 (39), 32440-32449 (2012)
   PUBMED   22865863
  REMARK    GeneRIF: MAPK activation is increased when [Ca(2+)](i) is
            increased, suggesting that calcineurin activates an additional
            mechanism that counteracts MAPK-induced beta4 phosphorylation.
REFERENCE   5  (bases 1 to 5695)
  AUTHORS   Kim,B.G., Gao,M.Q., Choi,Y.P., Kang,S., Park,H.R., Kang,K.S. and
            Cho,N.H.
  TITLE     Invasive breast cancer induces laminin-332 upregulation and
            integrin beta4 neoexpression in myofibroblasts to confer an
            anoikis-resistant phenotype during tissue remodeling
  JOURNAL   Breast Cancer Res. 14 (3), R88 (2012)
   PUBMED   22673183
  REMARK    GeneRIF: invasive breast cancer cells confer an anoikis-resistant
            phenotype on myofibroblasts during tissue remodeling by inducing
            laminin-332 upregulation and integrin beta4 neoexpression
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 5695)
  AUTHORS   Hogervorst,F., Kuikman,I., van Kessel,A.G. and Sonnenberg,A.
  TITLE     Molecular cloning of the human alpha 6 integrin subunit.
            Alternative splicing of alpha 6 mRNA and chromosomal localization
            of the alpha 6 and beta 4 genes
  JOURNAL   Eur. J. Biochem. 199 (2), 425-433 (1991)
   PUBMED   2070796
REFERENCE   7  (bases 1 to 5695)
  AUTHORS   Tamura,R.N., Rozzo,C., Starr,L., Chambers,J., Reichardt,L.F.,
            Cooper,H.M. and Quaranta,V.
  TITLE     Epithelial integrin alpha 6 beta 4: complete primary structure of
            alpha 6 and variant forms of beta 4
  JOURNAL   J. Cell Biol. 111 (4), 1593-1604 (1990)
   PUBMED   1976638
REFERENCE   8  (bases 1 to 5695)
  AUTHORS   Hogervorst,F., Kuikman,I., von dem Borne,A.E. and Sonnenberg,A.
  TITLE     Cloning and sequence analysis of beta-4 cDNA: an integrin subunit
            that contains a unique 118 kd cytoplasmic domain
  JOURNAL   EMBO J. 9 (3), 765-770 (1990)
   PUBMED   2311578
REFERENCE   9  (bases 1 to 5695)
  AUTHORS   Suzuki,S. and Naitoh,Y.
  TITLE     Amino acid sequence of a novel integrin beta 4 subunit and primary
            expression of the mRNA in epithelial cells
  JOURNAL   EMBO J. 9 (3), 757-763 (1990)
   PUBMED   2311577
REFERENCE   10 (bases 1 to 5695)
  AUTHORS   Kajiji,S., Tamura,R.N. and Quaranta,V.
  TITLE     A novel integrin (alpha E beta 4) from human epithelial cells
            suggests a fourth family of integrin adhesion receptors
  JOURNAL   EMBO J. 8 (3), 673-680 (1989)
   PUBMED   2542022
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from X52186.1, X51841.1, X53587.1
            and AI318403.1.
            
            Summary: Integrins are heterodimers comprised of alpha and beta
            subunits, that are noncovalently associated transmembrane
            glycoprotein receptors. Different combinations of alpha and beta
            polypeptides form complexes that vary in their ligand-binding
            specificities. Integrins mediate cell-matrix or cell-cell adhesion,
            and transduced signals that regulate gene expression and cell
            growth. This gene encodes the integrin beta 4 subunit, a receptor
            for the laminins. This subunit tends to associate with alpha 6
            subunit and is likely to play a pivotal role in the biology of
            invasive carcinoma. Mutations in this gene are associated with
            epidermolysis bullosa with pyloric atresia. Multiple alternatively
            spliced transcript variants encoding distinct isoforms have been
            found for this gene. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (2) lacks an in-frame exon in one
            place but has an additional in-frame exon in another place, as
            compared to variant 1. The encoded isoform 2 thus differs in two
            regions, as compared to isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: X52186.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-586               X52186.1           2-587
            587-4318            X51841.1           705-4436
            4319-4356           X53587.1           4708-4745
            4357-5292           X52186.1           4358-5293
            5293-5688           AI318403.1         1-396               c
            5689-5695           X52186.1           5690-5696
FEATURES             Location/Qualifiers
     source          1..5695
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="17"
                     /map="17q25"
     gene            1..5695
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="integrin, beta 4"
                     /db_xref="GeneID:3691"
                     /db_xref="HGNC:6158"
                     /db_xref="HPRD:00946"
                     /db_xref="MIM:147557"
     exon            1..87
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     CDS             9..5426
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="isoform 2 precursor is encoded by transcript
                     variant 2; integrin beta-4 subunit; GP150; CD104 antigen"
                     /codon_start=1
                     /product="integrin beta-4 isoform 2 precursor"
                     /protein_id="NP_001005619.1"
                     /db_xref="GI:54607027"
                     /db_xref="CCDS:CCDS32736.1"
                     /db_xref="GeneID:3691"
                     /db_xref="HGNC:6158"
                     /db_xref="HPRD:00946"
                     /db_xref="MIM:147557"
                     /translation="
MAGPRPSPWARLLLAALISVSLSGTLANRCKKAPVKSCTECVRVDKDCAYCTDEMFRDRRCNTQAELLAAGCQRESIVVMESSFQITEETQIDTTLRRSQMSPQGLRVRLRPGEERHFELEVFEPLESPVDLYILMDFSNSMSDDLDNLKKMGQNLARVLSQLTSDYTIGFGKFVDKVSVPQTDMRPEKLKEPWPNSDPPFSFKNVISLTEDVDEFRNKLQGERISGNLDAPEGGFDAILQTAVCTRDIGWRPDSTHLLVFSTESAFHYEADGANVLAGIMSRNDERCHLDTTGTYTQYRTQDYPSVPTLVRLLAKHNIIPIFAVTNYSYSYYEKLHTYFPVSSLGVLQEDSSNIVELLEEAFNRIRSNLDIRALDSPRGLRTEVTSKMFQKTRTGSFHIRRGEVGIYQVQLRALEHVDGTHVCQLPEDQKGNIHLKPSFSDGLKMDAGIICDVCTCELQKEVRSARCSFNGDFVCGQCVCSEGWSGQTCNCSTGSLSDIQPCLREGEDKPCSGRGECQCGHCVCYGEGRYEGQFCEYDNFQCPRTSGFLCNDRGRCSMGQCVCEPGWTGPSCDCPLSNATCIDSNGGICNGRGHCECGRCHCHQQSLYTDTICEINYSAIHPGLCEDLRSCVQCQAWGTGEKKGRTCEECNFKVKMVDELKRAEEVVVRCSFRDEDDDCTYSYTMEGDGAPGPNSTVLVHKKKDCPPGSFWWLIPLLLLLLPLLALLLLLCWKYCACCKACLALLPCCNRGHMVGFKEDHYMLRENLMASDHLDTPMLRSGNLKGRDVVRWKVTNNMQRPGFATHAASINPTELVPYGLSLRLARLCTENLLKPDTRECAQLRQEVEENLNEVYRQISGVHKLQQTKFRQQPNAGKKQDHTIVDTVLMAPRSAKPALLKLTEKQVEQRAFHDLKVAPGYYTLTADQDARGMVEFQEGVELVDVRVPLFIRPEDDDEKQLLVEAIDVPAGTATLGRRLVNITIIKEQARDVVSFEQPEFSVSRGDQVARIPVIRRVLDGGKSQVSYRTQDGTAQGNRDYIPVEGELLFQPGEAWKELQVKLLELQEVDSLLRGRQVRRFHVQLSNPKFGAHLGQPHSTTIIIRDPDELDRSFTSQMLSSQPPPHGDLGAPQNPNAKAAGSRKIHFNWLPPSGKPMGYRVKYWIQGDSESEAHLLDSKVPSVELTNLYPYCDYEMKVCAYGAQGEGPYSSLVSCRTHQEVPSEPGRLAFNVVSSTVTQLSWAEPAETNGEITAYEVCYGLVNDDNRPIGPMKKVLVDNPKNRMLLIENLRESQPYRYTVKARNGAGWGPEREAIINLATQPKRPMSIPIIPDIPIVDAQSGEDYDSFLMYSDDVLRSPSGSQRPSVSDDTEHLVNGRMDFAFPGSTNSLHRMTTTSAAAYGTHLSPHVPHRVLSTSSTLTRDYNSLTRSEHSHSTTLPRDYSTLTSVSSHGLPPIWEHGRSRLPLSWALGSRSRAQMKGFPPSRGPRDSIILAGRPAAPSWGPDSRLTAGVPDTPTRLVFSALGPTSLRVSWQEPRCERPLQGYSVEYQLLNGGELHRLNIPNPAQTSVVVEDLLPNHSYVFRVRAQSQEGWGREREGVITIESQVHPQSPLCPLPGSAFTLSTPSAPGPLVFTALSPDSLQLSWERPRRPNGDIVGYLVTCEMAQGGGPATAFRVDGDSPESRLTVPGLSENVPYKFKVQARTTEGFGPEREGIITIESQDGGPFPQLGSRAGLFQHPLQSEYSSITTTHTSATEPFLVDGLTLGAQHLEAGGSLTRHVTQEFVSRTLTTSGTLSTHMDQQFFQT
"
     sig_peptide     9..89
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     mat_peptide     90..5423
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /product="integrin beta-4 isoform 2"
     misc_feature    117..1367
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Integrin beta subunits (N-terminal portion of
                     extracellular region); Region: INB; smart00187"
                     /db_xref="CDD:197563"
     misc_feature    1635..1727
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cl09941"
                     /db_xref="CDD:209104"
     misc_feature    1884..2141
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Integrin beta tail domain; Region: Integrin_B_tail;
                     pfam07965"
                     /db_xref="CDD:149183"
     misc_feature    2976..3260
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Calx-beta domain; Region: Calx-beta; pfam03160"
                     /db_xref="CDD:202559"
     misc_feature    3390..3653
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(3570..3572,3615..3617)
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(3618..3623,3627..3632)
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    3627..3629
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    3627..3629
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    3666..3947
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(3666..3668,3876..3878,3921..3923)
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(3924..3929,3933..3938)
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    4203..4205
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    4218..4220
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    4539..4811
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(4539..4541,4731..4733,4776..4778)
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(4779..4784,4788..4793)
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    4878..5159
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(4878..4880,5079..5081,5124..5126)
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(5127..5132,5136..5141)
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     variation       15
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142907560"
     variation       19
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147285287"
     variation       21
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141077392"
     variation       22
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374855840"
     variation       29
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368149213"
     variation       65
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145773550"
     exon            88..170
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       93
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138695324"
     variation       120
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121912465"
     variation       124
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372947104"
     variation       152
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150023264"
     variation       153
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146966502"
     variation       155
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376523967"
     exon            171..272
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       184
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201532846"
     variation       190
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:80338755"
     variation       202
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200966154"
     variation       203
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372797886"
     variation       218
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200500313"
     exon            273..477
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       290
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146609350"
     variation       293
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373041337"
     variation       297
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369326405"
     variation       301
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143114124"
     variation       339
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141385926"
     variation       340
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200008946"
     variation       354
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146269824"
     variation       395
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140040189"
     variation       396
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141930616"
     variation       400
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113072439"
     variation       415
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:146338793"
     variation       453
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202029031"
     variation       464
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200344164"
     variation       475
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121912461"
     exon            478..574
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       503
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75092172"
     variation       510
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139287033"
     variation       521
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148048907"
     variation       545
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201538482"
     variation       551
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370508599"
     exon            575..746
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       587
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1131617"
     variation       607
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148770294"
     variation       623
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371826076"
     variation       658
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144968507"
     variation       679
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147952722"
     variation       710
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61751843"
     variation       716
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146923910"
     variation       735
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375136714"
     exon            747..1010
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       762
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201494421"
     variation       834
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372938338"
     variation       861
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150962076"
     variation       867
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140750952"
     variation       875
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150113215"
     variation       922
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376322445"
     variation       942
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201552574"
     variation       979
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370704124"
     variation       997
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370664880"
     variation       1007
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141725299"
     exon            1011..1100
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       1038
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201570276"
     variation       1040
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145591069"
     variation       1047
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374688114"
     variation       1064
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187527294"
     variation       1077
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138101366"
     variation       1099
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370095218"
     exon            1101..1223
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       1103
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141970956"
     variation       1144
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367872059"
     variation       1152
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141337579"
     variation       1189
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144655991"
     variation       1209
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200122430"
     variation       1220
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374254754"
     exon            1224..1385
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       1253
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199950498"
     variation       1270
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148535298"
     variation       1271
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372707561"
     variation       1274
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141916774"
     variation       1279
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370613824"
     variation       1289
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150638695"
     variation       1301
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371350190"
     variation       1303
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140201409"
     variation       1307
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375768413"
     variation       1328
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370124749"
     variation       1334
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139918000"
     variation       1350
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371466417"
     variation       1351
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144804175"
     variation       1353
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147963396"
     variation       1356
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140155423"
     variation       1382
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369171710"
     exon            1386..1462
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       1399
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145039852"
     variation       1402
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144917456"
     variation       1421
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375790655"
     variation       1436
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149030156"
     variation       1437
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370395920"
     variation       1442
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:8079267"
     variation       1454
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:8080369"
     exon            1463..1665
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       1474
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199770982"
     variation       1490
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374056611"
     variation       1521
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185794989"
     variation       1522
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151163670"
     variation       1529
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368066990"
     variation       1530
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140352471"
     variation       1541
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148312483"
     variation       1552
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61735297"
     variation       1587
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374033160"
     variation       1589
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374868983"
     variation       1594
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200038763"
     variation       1643
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372260270"
     variation       1649
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201078860"
     variation       1658
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1131618"
     variation       1661
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141067474"
     exon            1666..1769
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       1668
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121912462"
     variation       1674
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150166497"
     variation       1675
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142562582"
     variation       1692
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121912463"
     variation       1697
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149558612"
     variation       1757
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144302042"
     variation       1758
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139115559"
     exon            1770..1868
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       1797
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377678641"
     variation       1804..1805
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace=""
                     /replace="gc"
                     /db_xref="dbSNP:138423150"
     variation       1807
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201929789"
     variation       1813
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201103623"
     variation       1814
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371043426"
     variation       1829
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2290460"
     variation       1837
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377003186"
     variation       1838
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150965180"
     variation       1850
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147499356"
     exon            1869..1998
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       1877
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140690205"
     variation       1886
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373343133"
     variation       1892
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140078827"
     variation       1901
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61735295"
     variation       1904
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:8064949"
     variation       1919
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376183156"
     variation       1928
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:8064968"
     variation       1931
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:8064969"
     variation       1932
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200371855"
     variation       1944
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201350965"
     variation       1948
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150688188"
     variation       1976
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377703595"
     variation       1985
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:8065109"
     exon            1999..2121
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       2017
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149659118"
     variation       2033
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202097958"
     variation       2076
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113334156"
     variation       2077
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145520625"
     variation       2078
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140265734"
     variation       2081
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112985528"
     variation       2116
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:56119997"
     exon            2122..2228
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       2123
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:62639300"
     variation       2128
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368764776"
     variation       2131
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146500584"
     variation       2153
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140999738"
     variation       2215
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143203816"
     exon            2229..2262
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       2249
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377428995"
     exon            2263..2454
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       2271
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372308913"
     variation       2276
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201602364"
     variation       2336
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148267210"
     variation       2337
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140949891"
     variation       2367
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150184884"
     variation       2380
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376006066"
     variation       2393
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139153979"
     variation       2407
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369311929"
     variation       2408
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372120901"
     variation       2413
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143063063"
     variation       2430
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147480547"
     variation       2434
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138499170"
     exon            2455..2558
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       2462
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61735294"
     variation       2485
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200694443"
     variation       2511
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:183705877"
     variation       2529
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199531912"
     variation       2538
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149608383"
     variation       2539
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140819116"
     variation       2549
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370045621"
     variation       2558
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372551314"
     exon            2559..2617
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       2565
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144402600"
     variation       2585
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148787870"
     variation       2586
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201523797"
     variation       2611
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142065461"
     exon            2618..2641
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     exon            2642..2790
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       2646
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139092703"
     variation       2669
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144066301"
     variation       2678
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146449374"
     variation       2682
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139933962"
     variation       2683
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367733997"
     variation       2687
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149712551"
     variation       2696
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199539918"
     variation       2709
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145644205"
     variation       2734
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371215122"
     variation       2738
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61735292"
     variation       2744
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375687714"
     variation       2760
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376493221"
     variation       2762
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368406305"
     variation       2763
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372890193"
     exon            2791..2970
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       2792
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201900480"
     variation       2793
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143240391"
     variation       2797
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147887144"
     variation       2798
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62088211"
     variation       2800
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:121912466"
     variation       2810
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375239525"
     variation       2823
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199768958"
     variation       2833
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141526663"
     variation       2837
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147068910"
     variation       2841
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150668075"
     variation       2842
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141953294"
     variation       2860
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375270404"
     variation       2871
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369811701"
     variation       2903
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373517123"
     variation       2904
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150234651"
     variation       2906
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138945206"
     variation       2907
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375792088"
     variation       2912
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149443215"
     variation       2913
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55748088"
     variation       2916
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368913979"
     variation       2926
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:146391318"
     variation       2930
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139130590"
     variation       2931
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142329494"
     variation       2937
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145976111"
     variation       2969
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377676266"
     exon            2971..3119
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       2992
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374504143"
     variation       3004
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148629796"
     variation       3008
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142172735"
     variation       3025
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371525263"
     variation       3034
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377527264"
     variation       3049
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370080195"
     variation       3052
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151183954"
     variation       3065
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139146525"
     variation       3103
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200013889"
     variation       3107
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145314226"
     variation       3113
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147635062"
     exon            3120..3324
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       3125
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373859028"
     variation       3132
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141564265"
     variation       3199
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199739109"
     variation       3222
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368025166"
     variation       3229
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147026529"
     variation       3238
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201487753"
     variation       3241
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374238776"
     variation       3248
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368408505"
     variation       3249
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201802102"
     variation       3282
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200950497"
     exon            3325..3482
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       3325
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370112615"
     variation       3367
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200945563"
     variation       3381
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147695826"
     variation       3384
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199672740"
     variation       3392
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111568842"
     variation       3393
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201321412"
     variation       3398
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200774405"
     variation       3399
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371248151"
     variation       3419
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374304884"
     variation       3420
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143287482"
     variation       3435
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149481974"
     exon            3483..3663
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       3503
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1131626"
     variation       3509
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141513851"
     variation       3515
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113185087"
     variation       3527
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145910839"
     variation       3578
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138462843"
     variation       3606
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75129664"
     variation       3616
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369151880"
     variation       3632
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145928221"
     variation       3649
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139518734"
     variation       3656
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149284152"
     exon            3664..3801
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       3682
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:121912468"
     variation       3699
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368177827"
     variation       3737
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61735289"
     variation       3767
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376494263"
     variation       3783
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61735290"
     variation       3785
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148462413"
     variation       3801
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145202579"
     exon            3802..3984
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       3818
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373133055"
     variation       3835
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:11657833"
     variation       3848
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140567957"
     variation       3849
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121912467"
     variation       3857
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368037184"
     variation       3866
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372222796"
     variation       3869
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145351926"
     variation       3873..3874
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34092482"
     variation       3873
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200409597"
     variation       3892
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200586694"
     variation       3893
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375483568"
     variation       3918
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146489216"
     variation       3936
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369683446"
     variation       3945
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373174042"
     exon            3985..4116
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       4010
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372507006"
     variation       4016
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61735288"
     variation       4017
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187296783"
     variation       4026
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140930313"
     variation       4034
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377075513"
     variation       4062
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11759"
     variation       4065
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370453421"
     variation       4072
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373278372"
     variation       4075
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376560109"
     variation       4081
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368526254"
     variation       4100
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149807848"
     variation       4101
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145750695"
     variation       4107
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150008568"
     exon            4117..4356
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       4119
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368089324"
     variation       4140
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148986758"
     variation       4144
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200989039"
     variation       4157
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145760507"
     variation       4186
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372323678"
     variation       4193
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:138486001"
     variation       4200
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374857648"
     variation       4215
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138478973"
     variation       4228
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374564280"
     variation       4234
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375629632"
     variation       4236
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61735299"
     variation       4258
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145161839"
     variation       4279
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372644057"
     variation       4287
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148205043"
     variation       4306
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141137562"
     variation       4307
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3191773"
     variation       4319
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:8669"
     variation       4330
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374562982"
     variation       4355
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143636541"
     variation       4356
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149237647"
     exon            4357..4515
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       4381
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375588839"
     variation       4390
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139368129"
     variation       4391
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201097664"
     variation       4396
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140501692"
     variation       4397
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192046710"
     variation       4402
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376700124"
     variation       4420
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144558385"
     variation       4425
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369402815"
     variation       4449
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199859829"
     variation       4457
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144594707"
     variation       4462
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376640670"
     variation       4465
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374123780"
     variation       4492
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148725082"
     variation       4498
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142258384"
     variation       4499
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62088214"
     variation       4504
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113971947"
     exon            4516..4665
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       4546
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140575355"
     variation       4547
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144407069"
     variation       4600
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:121912464"
     variation       4610
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146620810"
     variation       4611
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141346422"
     variation       4620
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150277911"
     STS             4627..4690
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /standard_name="ksks329"
                     /db_xref="UniSTS:514374"
     variation       4662
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201832426"
     variation       4664
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138928712"
     exon            4666..4854
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       4677
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200760979"
     variation       4678
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146044025"
     variation       4682
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148827335"
     variation       4688
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143423379"
     variation       4708
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375075647"
     variation       4727
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201630581"
     variation       4745
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369145421"
     variation       4752
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373902577"
     variation       4814
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369462022"
     variation       4828
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148008349"
     variation       4843
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143575686"
     exon            4855..5010
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       4859
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:57812564"
     variation       4889
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368991974"
     variation       4914
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374293847"
     variation       4920
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12600339"
     variation       4922
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375771696"
     variation       4924
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370378040"
     variation       4951
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200991558"
     variation       4960
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373930132"
     variation       4970
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372195997"
     variation       4986
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200142052"
     exon            5011..5175
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       5012
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148658410"
     variation       5022
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372938774"
     variation       5029
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376139144"
     variation       5034
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142794337"
     variation       5046
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201023107"
     variation       5048
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150804109"
     variation       5062
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139181455"
     variation       5064
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149353166"
     variation       5078
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201439404"
     variation       5079
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144654848"
     variation       5084
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376733146"
     variation       5103
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139516338"
     variation       5105
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369204890"
     variation       5129
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144339436"
     variation       5150
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146573290"
     variation       5169
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200441318"
     exon            5176..5286
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       5181
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375857348"
     variation       5185
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368445689"
     variation       5186
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140140182"
     variation       5198
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11465"
     variation       5200
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151053969"
     variation       5205
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151327791"
     variation       5221
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140577812"
     variation       5224
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369596996"
     variation       5225
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:13623"
     variation       5230
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147573071"
     variation       5232
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141944501"
     variation       5247
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1051486"
     variation       5254
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373281667"
     variation       5264
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145897252"
     variation       5270
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138707718"
     variation       5271
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375975797"
     exon            5287..5689
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /inference="alignment:Splign:1.39.8"
     variation       5293
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:871443"
     variation       5294
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200798799"
     variation       5304
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201253100"
     variation       5310
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375287185"
     variation       5324
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200199740"
     variation       5325
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202129173"
     variation       5326
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372505125"
     variation       5338
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375778262"
     variation       5349
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371616348"
     variation       5365
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:80224547"
     variation       5374
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148061895"
     variation       5381
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141814228"
     variation       5382
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370673042"
     STS             5387..5577
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /standard_name="RH18101"
                     /db_xref="UniSTS:33806"
     variation       5392
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35234235"
     variation       5429
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375665623"
     variation       5430
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189610725"
     STS             5444..5695
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /standard_name="D17S2049"
                     /db_xref="UniSTS:31843"
     variation       5446
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371393052"
     variation       5447
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374796446"
     variation       5451
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:9367"
     variation       5463
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051554"
     variation       5464
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371860241"
     variation       5471
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200901360"
     STS             5485..5623
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /standard_name="RH47571"
                     /db_xref="UniSTS:80458"
     variation       5596
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377058449"
     variation       5599
                     /gene="ITGB4"
                     /gene_synonym="CD104"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181093059"
     polyA_signal    5667..5672
                     /gene="ITGB4"
                     /gene_synonym="CD104"
     polyA_site      5689
                     /gene="ITGB4"
                     /gene_synonym="CD104"
ORIGIN      
ggaagaggatggcagggccacgccccagcccatgggccaggctgctcctggcagccttgatcagcgtcagcctctctgggaccttggcaaaccgctgcaagaaggccccagtgaagagctgcacggagtgtgtccgtgtggataaggactgcgcctactgcacagacgagatgttcagggaccggcgctgcaacacccaggcggagctgctggccgcgggctgccagcgggagagcatcgtggtcatggagagcagcttccaaatcacagaggagacccagattgacaccaccctgcggcgcagccagatgtccccccaaggcctgcgggtccgtctgcggcccggtgaggagcggcattttgagctggaggtgtttgagccactggagagccccgtggacctgtacatcctcatggacttctccaactccatgtccgatgatctggacaacctcaagaagatggggcagaacctggctcgggtcctgagccagctcaccagcgactacactattggatttggcaagtttgtggacaaagtcagcgtcccgcagacggacatgaggcctgagaagctgaaggagccctggcccaacagtgacccccccttctccttcaagaacgtcatcagcctgacagaagatgtggatgagttccggaataaactgcagggagagcggatctcaggcaacctggatgctcctgagggcggcttcgatgccatcctgcagacagctgtgtgcacgagggacattggctggcgcccggacagcacccacctgctggtcttctccaccgagtcagccttccactatgaggctgatggcgccaacgtgctggctggcatcatgagccgcaacgatgaacggtgccacctggacaccacgggcacctacacccagtacaggacacaggactacccgtcggtgcccaccctggtgcgcctgctcgccaagcacaacatcatccccatctttgctgtcaccaactactcctatagctactacgagaagcttcacacctatttccctgtctcctcactgggggtgctgcaggaggactcgtccaacatcgtggagctgctggaggaggccttcaatcggatccgctccaacctggacatccgggccctagacagcccccgaggccttcggacagaggtcacctccaagatgttccagaagacgaggactgggtcctttcacatccggcggggggaagtgggtatataccaggtgcagctgcgggcccttgagcacgtggatgggacgcacgtgtgccagctgccggaggaccagaagggcaacatccatctgaaaccttccttctccgacggcctcaagatggacgcgggcatcatctgtgatgtgtgcacctgcgagctgcaaaaagaggtgcggtcagctcgctgcagcttcaacggagacttcgtgtgcggacagtgtgtgtgcagcgagggctggagtggccagacctgcaactgctccaccggctctctgagtgacattcagccctgcctgcgggagggcgaggacaagccgtgctccggccgtggggagtgccagtgcgggcactgtgtgtgctacggcgaaggccgctacgagggtcagttctgcgagtatgacaacttccagtgtccccgcacttccgggttcctctgcaatgaccgaggacgctgctccatgggccagtgtgtgtgtgagcctggttggacaggcccaagctgtgactgtcccctcagcaatgccacctgcatcgacagcaatgggggcatctgtaatggacgtggccactgtgagtgtggccgctgccactgccaccagcagtcgctctacacggacaccatctgcgagatcaactactcggcgatccacccgggcctctgcgaggacctacgctcctgcgtgcagtgccaggcgtggggcaccggcgagaagaaggggcgcacgtgtgaggaatgcaacttcaaggtcaagatggtggacgagcttaagagagccgaggaggtggtggtgcgctgctccttccgggacgaggatgacgactgcacctacagctacaccatggaaggtgacggcgcccctgggcccaacagcactgtcctggtgcacaagaagaaggactgccctccgggctccttctggtggctcatccccctgctcctcctcctcctgccgctcctggccctgctactgctgctatgctggaagtactgtgcctgctgcaaggcctgcctggcacttctcccgtgctgcaaccgaggtcacatggtgggctttaaggaagaccactacatgctgcgggagaacctgatggcctctgaccacttggacacgcccatgctgcgcagcgggaacctcaagggccgtgacgtggtccgctggaaggtcaccaacaacatgcagcggcctggctttgccactcatgccgccagcatcaaccccacagagctggtgccctacgggctgtccttgcgcctggcccgcctttgcaccgagaacctgctgaagcctgacactcgggagtgcgcccagctgcgccaggaggtggaggagaacctgaacgaggtctacaggcagatctccggtgtacacaagctccagcagaccaagttccggcagcagcccaatgccgggaaaaagcaagaccacaccattgtggacacagtgctgatggcgccccgctcggccaagccggccctgctgaagcttacagagaagcaggtggaacagagggccttccacgacctcaaggtggcccccggctactacaccctcactgcagaccaggacgcccggggcatggtggagttccaggagggcgtggagctggtggacgtacgggtgcccctctttatccggcctgaggatgacgacgagaagcagctgctggtggaggccatcgacgtgcccgcaggcactgccaccctcggccgccgcctggtaaacatcaccatcatcaaggagcaagccagagacgtggtgtcctttgagcagcctgagttctcggtcagccgcggggaccaggtggcccgcatccctgtcatccggcgtgtcctggacggcgggaagtcccaggtctcctaccgcacacaggatggcaccgcgcagggcaaccgggactacatccccgtggagggtgagctgctgttccagcctggggaggcctggaaagagctgcaggtgaagctcctggagctgcaagaagttgactccctcctgcggggccgccaggtccgccgtttccacgtccagctcagcaaccctaagtttggggcccacctgggccagccccactccaccaccatcatcatcagggacccagatgaactggaccggagcttcacgagtcagatgttgtcatcacagccaccccctcacggcgacctgggcgccccgcagaaccccaatgctaaggccgctgggtccaggaagatccatttcaactggctgcccccttctggcaagccaatggggtacagggtaaagtactggattcagggtgactccgaatccgaagcccacctgctcgacagcaaggtgccctcagtggagctcaccaacctgtacccgtattgcgactatgagatgaaggtgtgcgcctacggggctcagggcgagggaccctacagctccctggtgtcctgccgcacccaccaggaagtgcccagcgagccagggcgtctggccttcaatgtcgtctcctccacggtgacccagctgagctgggctgagccggctgagaccaacggtgagatcacagcctacgaggtctgctatggcctggtcaacgatgacaaccgacctattgggcccatgaagaaagtgctggttgacaaccctaagaaccggatgctgcttattgagaaccttcgggagtcccagccctaccgctacacggtgaaggcgcgcaacggggccggctgggggcctgagcgggaggccatcatcaacctggccacccagcccaagaggcccatgtccatccccatcatccctgacatccctatcgtggacgcccagagcggggaggactacgacagcttccttatgtacagcgatgacgttctacgctctccatcgggcagccagaggcccagcgtctccgatgacactgagcacctggtgaatggccggatggactttgccttcccgggcagcaccaactccctgcacaggatgaccacgaccagtgctgctgcctatggcacccacctgagcccacacgtgccccaccgcgtgctaagcacatcctccaccctcacacgggactacaactcactgacccgctcagaacactcacactcgaccacactgcccagggactactccaccctcacctccgtctcctcccacggcctccctcccatctgggaacacgggaggagcaggcttccgctgtcctgggccctggggtcccggagtcgggctcagatgaaagggttccccccttccaggggcccacgagactctataatcctggctgggaggccagcagcgccctcctggggcccagactctcgcctgactgctggtgtgcccgacacgcccacccgcctggtgttctctgccctggggcccacatctctcagagtgagctggcaggagccgcggtgcgagcggccgctgcagggctacagtgtggagtaccagctgctgaacggcggtgagctgcatcggctcaacatccccaaccctgcccagacctcggtggtggtggaagacctcctgcccaaccactcctacgtgttccgcgtgcgggcccagagccaggaaggctggggccgagagcgtgagggtgtcatcaccattgaatcccaggtgcacccgcagagcccactgtgtcccctgccaggctccgccttcactttgagcactcccagtgccccaggcccgctggtgttcactgccctgagcccagactcgctgcagctgagctgggagcggccacggaggcccaatggggatatcgtcggctacctggtgacctgtgagatggcccaaggaggagggccagccaccgcattccgggtggatggagacagccccgagagccggctgaccgtgccgggcctcagcgagaacgtgccctacaagttcaaggtgcaggccaggaccactgagggcttcgggccagagcgcgagggcatcatcaccatagagtcccaggatggaggacccttcccgcagctgggcagccgtgccgggctcttccagcacccgctgcaaagcgagtacagcagcatcaccaccacccacaccagcgccaccgagcccttcctagtggatgggctgaccctgggggcccagcacctggaggcaggcggctccctcacccggcatgtgacccaggagtttgtgagccggacactgaccaccagcggaacccttagcacccacatggaccaacagttcttccaaacttgaccgcaccctgccccacccccgccacgtcccactaggcgtcctcccgactcctctcccggagcctcctcagctactccatccttgcacccctgggggcccagcccacccgcatgcacagagcaggggctaggtgtctcctgggaggcatgaagggggcaaggtccgtcctctgtgggcccaaacctatttgtaaccaaagagctgggagcagcacaaggacccagcctttgttctgcacttaataaatggttttgctactgctaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:3691 -> Molecular function: GO:0004872 [receptor activity] evidence: IEA
            GeneID:3691 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:3691 -> Biological process: GO:0007155 [cell adhesion] evidence: NAS
            GeneID:3691 -> Biological process: GO:0007160 [cell-matrix adhesion] evidence: IEA
            GeneID:3691 -> Biological process: GO:0007229 [integrin-mediated signaling pathway] evidence: IEA
            GeneID:3691 -> Biological process: GO:0007275 [multicellular organismal development] evidence: IEA
            GeneID:3691 -> Biological process: GO:0009611 [response to wounding] evidence: IDA
            GeneID:3691 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS
            GeneID:3691 -> Biological process: GO:0031581 [hemidesmosome assembly] evidence: IDA
            GeneID:3691 -> Biological process: GO:0031581 [hemidesmosome assembly] evidence: TAS
            GeneID:3691 -> Biological process: GO:0034329 [cell junction assembly] evidence: TAS
            GeneID:3691 -> Biological process: GO:0046847 [filopodium assembly] evidence: IEA
            GeneID:3691 -> Biological process: GO:0048870 [cell motility] evidence: IMP
            GeneID:3691 -> Cellular component: GO:0005604 [basement membrane] evidence: IEA
            GeneID:3691 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
            GeneID:3691 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
            GeneID:3691 -> Cellular component: GO:0008305 [integrin complex] evidence: IEA
            GeneID:3691 -> Cellular component: GO:0009925 [basal plasma membrane] evidence: IEA
            GeneID:3691 -> Cellular component: GO:0009986 [cell surface] evidence: IDA
            GeneID:3691 -> Cellular component: GO:0030056 [hemidesmosome] evidence: IDA
            GeneID:3691 -> Cellular component: GO:0031252 [cell leading edge] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.