GGRNA Home | Help | Advanced search

2024-04-19 16:37:17, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001005487             924 bp    mRNA    linear   PRI 17-FEB-2013
DEFINITION  Homo sapiens olfactory receptor, family 13, subfamily G, member 1
            (OR13G1), mRNA.
ACCESSION   NM_001005487 XM_497748
VERSION     NM_001005487.1  GI:53828697
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 924)
  AUTHORS   Koch,W., Hoppmann,P., Schomig,A. and Kastrati,A.
  TITLE     Variations of specific non-candidate genes and risk of myocardial
            infarction: a replication study
  JOURNAL   Int. J. Cardiol. 147 (1), 38-41 (2011)
   PUBMED   19709766
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   2  (bases 1 to 924)
  AUTHORS   Yoshida,T., Kato,K., Fujimaki,T., Yokoi,K., Oguri,M., Watanabe,S.,
            Metoki,N., Yoshida,H., Satoh,K., Aoyagi,Y., Nishigaki,Y.,
            Tanaka,M., Nozawa,Y. and Yamada,Y.
  TITLE     Association of a polymorphism of the apolipoprotein E gene with
            chronic kidney disease in Japanese individuals with metabolic
            syndrome
  JOURNAL   Genomics 93 (3), 221-226 (2009)
   PUBMED   19056482
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   3  (bases 1 to 924)
  AUTHORS   van der Net,J.B., Janssens,A.C., Defesche,J.C., Kastelein,J.J.,
            Sijbrands,E.J. and Steyerberg,E.W.
  TITLE     Usefulness of genetic polymorphisms and conventional risk factors
            to predict coronary heart disease in patients with familial
            hypercholesterolemia
  JOURNAL   Am. J. Cardiol. 103 (3), 375-380 (2009)
   PUBMED   19166692
  REMARK    GeneRIF: Observational study of gene-disease association, gene-gene
            interaction, and gene-environment interaction. (HuGE Navigator)
REFERENCE   4  (bases 1 to 924)
  AUTHORS   Luke,M.M., O'Meara,E.S., Rowland,C.M., Shiffman,D., Bare,L.A.,
            Arellano,A.R., Longstreth,W.T. Jr., Lumley,T., Rice,K., Tracy,R.P.,
            Devlin,J.J. and Psaty,B.M.
  TITLE     Gene variants associated with ischemic stroke: the cardiovascular
            health study
  JOURNAL   Stroke 40 (2), 363-368 (2009)
   PUBMED   19023099
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   5  (bases 1 to 924)
  AUTHORS   van der Net,J.B., Oosterveer,D.M., Versmissen,J., Defesche,J.C.,
            Yazdanpanah,M., Aouizerat,B.E., Steyerberg,E.W., Malloy,M.J.,
            Pullinger,C.R., Kastelein,J.J., Kane,J.P. and Sijbrands,E.J.
  TITLE     Replication study of 10 genetic polymorphisms associated with
            coronary heart disease in a specific high-risk population with
            familial hypercholesterolemia
  JOURNAL   Eur. Heart J. 29 (18), 2195-2201 (2008)
   PUBMED   18599554
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   6  (bases 1 to 924)
  AUTHORS   Shiffman,D., O'Meara,E.S., Bare,L.A., Rowland,C.M., Louie,J.Z.,
            Arellano,A.R., Lumley,T., Rice,K., Iakoubova,O., Luke,M.M.,
            Young,B.A., Malloy,M.J., Kane,J.P., Ellis,S.G., Tracy,R.P.,
            Devlin,J.J. and Psaty,B.M.
  TITLE     Association of gene variants with incident myocardial infarction in
            the Cardiovascular Health Study
  JOURNAL   Arterioscler. Thromb. Vasc. Biol. 28 (1), 173-179 (2008)
   PUBMED   17975119
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   7  (bases 1 to 924)
  AUTHORS   Shiffman,D., Ellis,S.G., Rowland,C.M., Malloy,M.J., Luke,M.M.,
            Iakoubova,O.A., Pullinger,C.R., Cassano,J., Aouizerat,B.E.,
            Fenwick,R.G., Reitz,R.E., Catanese,J.J., Leong,D.U., Zellner,C.,
            Sninsky,J.J., Topol,E.J., Devlin,J.J. and Kane,J.P.
  TITLE     Identification of four gene variants associated with myocardial
            infarction
  JOURNAL   Am. J. Hum. Genet. 77 (4), 596-605 (2005)
   PUBMED   16175505
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   8  (bases 1 to 924)
  AUTHORS   Malnic,B., Godfrey,P.A. and Buck,L.B.
  TITLE     The human olfactory receptor gene family
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 101 (8), 2584-2589 (2004)
   PUBMED   14983052
  REMARK    Erratum:[Proc Natl Acad Sci U S A. 2004 May 4;101(18):7205]
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AB065623.1.
            On Oct 7, 2004 this sequence version replaced gi:51459178.
            
            Summary: Olfactory receptors interact with odorant molecules in the
            nose, to initiate a neuronal response that triggers the perception
            of a smell. The olfactory receptor proteins are members of a large
            family of G-protein-coupled receptors (GPCR) arising from single
            coding-exon genes. Olfactory receptors share a 7-transmembrane
            domain structure with many neurotransmitter and hormone receptors
            and are responsible for the recognition and G protein-mediated
            transduction of odorant signals. The olfactory receptor gene family
            is the largest in the genome. The nomenclature assigned to the
            olfactory receptor genes and proteins for this organism is
            independent of other organisms. [provided by RefSeq, Jul 2008].
FEATURES             Location/Qualifiers
     source          1..924
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q44"
     gene            1..924
                     /gene="OR13G1"
                     /gene_synonym="OR1-37"
                     /note="olfactory receptor, family 13, subfamily G, member
                     1"
                     /db_xref="GeneID:441933"
                     /db_xref="HGNC:14999"
                     /db_xref="HPRD:17680"
                     /db_xref="MIM:611677"
     CDS             1..924
                     /gene="OR13G1"
                     /gene_synonym="OR1-37"
                     /note="olfactory receptor OR1-37"
                     /codon_start=1
                     /product="olfactory receptor 13G1"
                     /protein_id="NP_001005487.1"
                     /db_xref="GI:53828698"
                     /db_xref="CCDS:CCDS31094.1"
                     /db_xref="GeneID:441933"
                     /db_xref="HGNC:14999"
                     /db_xref="HPRD:17680"
                     /db_xref="MIM:611677"
                     /translation="
MNHSVVTEFIILGLTKKPELQGIIFLFFLIVYLVAFLGNMLIIIAKIYNNTLHTPMYVFLLTLAVVDIICTTSIIPKMLGTMLTSENTISYAGCMSQLFLFTWSLGAEMVLFTTMAYDRYVAICFPLHYSTIMNHHMCVALLSMVMAIAVTNSWVHTALIMRLTFCGPNTIDHFFCEIPPLLALSCSPVRINEVMVYVADITLAIGDFILTCISYGFIIVAILRIRTVEGKRKAFSTCSSHLTVVTLYYSPVIYTYIRPASSYTFERDKVVAALYTLVTPTLNPMVYSFQNREMQAGIRKVFAFLKH
"
     misc_feature    67..129
                     /gene="OR13G1"
                     /gene_synonym="OR1-37"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8NGZ3.1);
                     transmembrane region"
     misc_feature    97..>402
                     /gene="OR13G1"
                     /gene_synonym="OR1-37"
                     /note="Olfactory receptor; Region: 7tm_4; cl10458"
                     /db_xref="CDD:209142"
     misc_feature    139..861
                     /gene="OR13G1"
                     /gene_synonym="OR1-37"
                     /note="7 transmembrane receptor (rhodopsin family);
                     Region: 7tm_1; pfam00001"
                     /db_xref="CDD:200918"
     misc_feature    154..216
                     /gene="OR13G1"
                     /gene_synonym="OR1-37"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8NGZ3.1);
                     transmembrane region"
     misc_feature    289..351
                     /gene="OR13G1"
                     /gene_synonym="OR1-37"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8NGZ3.1);
                     transmembrane region"
     misc_feature    409..471
                     /gene="OR13G1"
                     /gene_synonym="OR1-37"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8NGZ3.1);
                     transmembrane region"
     misc_feature    412..840
                     /gene="OR13G1"
                     /gene_synonym="OR1-37"
                     /note="Olfactory receptor; Region: 7tm_4; pfam13853"
                     /db_xref="CDD:206024"
     misc_feature    583..642
                     /gene="OR13G1"
                     /gene_synonym="OR1-37"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8NGZ3.1);
                     transmembrane region"
     misc_feature    703..765
                     /gene="OR13G1"
                     /gene_synonym="OR1-37"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8NGZ3.1);
                     transmembrane region"
     misc_feature    805..867
                     /gene="OR13G1"
                     /gene_synonym="OR1-37"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8NGZ3.1);
                     transmembrane region"
     exon            1..924
                     /gene="OR13G1"
                     /gene_synonym="OR1-37"
                     /inference="alignment:Splign:1.39.8"
     variation       394
                     /gene="OR13G1"
                     /gene_synonym="OR1-37"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1151640"
ORIGIN      
atgaatcacagcgttgtaactgagttcattattctgggcctcaccaaaaagcctgaactccagggaattatcttcctcttttttctcattgtctatcttgtggcttttctcggcaacatgctcatcatcattgccaaaatctataacaacaccttgcatacgcccatgtatgttttccttctgacactggctgttgtggacatcatctgcacaacaagcatcataccgaagatgctggggaccatgctaacatcagaaaataccatttcatatgcaggctgcatgtcccagctcttcttgttcacatggtctctgggagctgagatggttctcttcaccaccatggcctatgaccgctatgtggccatttgtttccctcttcattacagtactattatgaaccaccatatgtgtgtagccttgctcagcatggtcatggctattgcagtcaccaattcctgggtgcacacagctcttatcatgaggttgactttctgtgggccaaacaccattgaccacttcttctgtgagatacccccattgctggctttgtcctgtagccctgtaagaatcaatgaggtgatggtgtatgttgctgatattaccctggccataggggactttattcttacctgcatctcctatggttttatcattgttgctattctccgtatccgcacagtagaaggcaagaggaaggccttctcaacatgctcatctcatctcacagtggtgaccctttactattctcctgtaatctacacctatatccgccctgcttccagctatacatttgaaagagacaaggtggtagctgcactctatactcttgtgactcccacattaaacccgatggtgtacagcttccagaatagggagatgcaggcaggaattaggaaggtgtttgcatttctgaaacactag
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:441933 -> Molecular function: GO:0004930 [G-protein coupled receptor activity] evidence: IEA
            GeneID:441933 -> Molecular function: GO:0004984 [olfactory receptor activity] evidence: IEA
            GeneID:441933 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
            GeneID:441933 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.