2024-04-19 16:37:17, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001005487 924 bp mRNA linear PRI 17-FEB-2013 DEFINITION Homo sapiens olfactory receptor, family 13, subfamily G, member 1 (OR13G1), mRNA. ACCESSION NM_001005487 XM_497748 VERSION NM_001005487.1 GI:53828697 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 924) AUTHORS Koch,W., Hoppmann,P., Schomig,A. and Kastrati,A. TITLE Variations of specific non-candidate genes and risk of myocardial infarction: a replication study JOURNAL Int. J. Cardiol. 147 (1), 38-41 (2011) PUBMED 19709766 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 2 (bases 1 to 924) AUTHORS Yoshida,T., Kato,K., Fujimaki,T., Yokoi,K., Oguri,M., Watanabe,S., Metoki,N., Yoshida,H., Satoh,K., Aoyagi,Y., Nishigaki,Y., Tanaka,M., Nozawa,Y. and Yamada,Y. TITLE Association of a polymorphism of the apolipoprotein E gene with chronic kidney disease in Japanese individuals with metabolic syndrome JOURNAL Genomics 93 (3), 221-226 (2009) PUBMED 19056482 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 3 (bases 1 to 924) AUTHORS van der Net,J.B., Janssens,A.C., Defesche,J.C., Kastelein,J.J., Sijbrands,E.J. and Steyerberg,E.W. TITLE Usefulness of genetic polymorphisms and conventional risk factors to predict coronary heart disease in patients with familial hypercholesterolemia JOURNAL Am. J. Cardiol. 103 (3), 375-380 (2009) PUBMED 19166692 REMARK GeneRIF: Observational study of gene-disease association, gene-gene interaction, and gene-environment interaction. (HuGE Navigator) REFERENCE 4 (bases 1 to 924) AUTHORS Luke,M.M., O'Meara,E.S., Rowland,C.M., Shiffman,D., Bare,L.A., Arellano,A.R., Longstreth,W.T. Jr., Lumley,T., Rice,K., Tracy,R.P., Devlin,J.J. and Psaty,B.M. TITLE Gene variants associated with ischemic stroke: the cardiovascular health study JOURNAL Stroke 40 (2), 363-368 (2009) PUBMED 19023099 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 5 (bases 1 to 924) AUTHORS van der Net,J.B., Oosterveer,D.M., Versmissen,J., Defesche,J.C., Yazdanpanah,M., Aouizerat,B.E., Steyerberg,E.W., Malloy,M.J., Pullinger,C.R., Kastelein,J.J., Kane,J.P. and Sijbrands,E.J. TITLE Replication study of 10 genetic polymorphisms associated with coronary heart disease in a specific high-risk population with familial hypercholesterolemia JOURNAL Eur. Heart J. 29 (18), 2195-2201 (2008) PUBMED 18599554 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 6 (bases 1 to 924) AUTHORS Shiffman,D., O'Meara,E.S., Bare,L.A., Rowland,C.M., Louie,J.Z., Arellano,A.R., Lumley,T., Rice,K., Iakoubova,O., Luke,M.M., Young,B.A., Malloy,M.J., Kane,J.P., Ellis,S.G., Tracy,R.P., Devlin,J.J. and Psaty,B.M. TITLE Association of gene variants with incident myocardial infarction in the Cardiovascular Health Study JOURNAL Arterioscler. Thromb. Vasc. Biol. 28 (1), 173-179 (2008) PUBMED 17975119 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 7 (bases 1 to 924) AUTHORS Shiffman,D., Ellis,S.G., Rowland,C.M., Malloy,M.J., Luke,M.M., Iakoubova,O.A., Pullinger,C.R., Cassano,J., Aouizerat,B.E., Fenwick,R.G., Reitz,R.E., Catanese,J.J., Leong,D.U., Zellner,C., Sninsky,J.J., Topol,E.J., Devlin,J.J. and Kane,J.P. TITLE Identification of four gene variants associated with myocardial infarction JOURNAL Am. J. Hum. Genet. 77 (4), 596-605 (2005) PUBMED 16175505 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 8 (bases 1 to 924) AUTHORS Malnic,B., Godfrey,P.A. and Buck,L.B. TITLE The human olfactory receptor gene family JOURNAL Proc. Natl. Acad. Sci. U.S.A. 101 (8), 2584-2589 (2004) PUBMED 14983052 REMARK Erratum:[Proc Natl Acad Sci U S A. 2004 May 4;101(18):7205] COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AB065623.1. On Oct 7, 2004 this sequence version replaced gi:51459178. Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]. FEATURES Location/Qualifiers source 1..924 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="1" /map="1q44" gene 1..924 /gene="OR13G1" /gene_synonym="OR1-37" /note="olfactory receptor, family 13, subfamily G, member 1" /db_xref="GeneID:441933" /db_xref="HGNC:14999" /db_xref="HPRD:17680" /db_xref="MIM:611677" CDS 1..924 /gene="OR13G1" /gene_synonym="OR1-37" /note="olfactory receptor OR1-37" /codon_start=1 /product="olfactory receptor 13G1" /protein_id="NP_001005487.1" /db_xref="GI:53828698" /db_xref="CCDS:CCDS31094.1" /db_xref="GeneID:441933" /db_xref="HGNC:14999" /db_xref="HPRD:17680" /db_xref="MIM:611677" /translation="
MNHSVVTEFIILGLTKKPELQGIIFLFFLIVYLVAFLGNMLIIIAKIYNNTLHTPMYVFLLTLAVVDIICTTSIIPKMLGTMLTSENTISYAGCMSQLFLFTWSLGAEMVLFTTMAYDRYVAICFPLHYSTIMNHHMCVALLSMVMAIAVTNSWVHTALIMRLTFCGPNTIDHFFCEIPPLLALSCSPVRINEVMVYVADITLAIGDFILTCISYGFIIVAILRIRTVEGKRKAFSTCSSHLTVVTLYYSPVIYTYIRPASSYTFERDKVVAALYTLVTPTLNPMVYSFQNREMQAGIRKVFAFLKH
" misc_feature 67..129 /gene="OR13G1" /gene_synonym="OR1-37" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q8NGZ3.1); transmembrane region" misc_feature 97..>402 /gene="OR13G1" /gene_synonym="OR1-37" /note="Olfactory receptor; Region: 7tm_4; cl10458" /db_xref="CDD:209142" misc_feature 139..861 /gene="OR13G1" /gene_synonym="OR1-37" /note="7 transmembrane receptor (rhodopsin family); Region: 7tm_1; pfam00001" /db_xref="CDD:200918" misc_feature 154..216 /gene="OR13G1" /gene_synonym="OR1-37" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q8NGZ3.1); transmembrane region" misc_feature 289..351 /gene="OR13G1" /gene_synonym="OR1-37" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q8NGZ3.1); transmembrane region" misc_feature 409..471 /gene="OR13G1" /gene_synonym="OR1-37" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q8NGZ3.1); transmembrane region" misc_feature 412..840 /gene="OR13G1" /gene_synonym="OR1-37" /note="Olfactory receptor; Region: 7tm_4; pfam13853" /db_xref="CDD:206024" misc_feature 583..642 /gene="OR13G1" /gene_synonym="OR1-37" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q8NGZ3.1); transmembrane region" misc_feature 703..765 /gene="OR13G1" /gene_synonym="OR1-37" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q8NGZ3.1); transmembrane region" misc_feature 805..867 /gene="OR13G1" /gene_synonym="OR1-37" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q8NGZ3.1); transmembrane region" exon 1..924 /gene="OR13G1" /gene_synonym="OR1-37" /inference="alignment:Splign:1.39.8" variation 394 /gene="OR13G1" /gene_synonym="OR1-37" /replace="a" /replace="g" /db_xref="dbSNP:1151640" ORIGIN
atgaatcacagcgttgtaactgagttcattattctgggcctcaccaaaaagcctgaactccagggaattatcttcctcttttttctcattgtctatcttgtggcttttctcggcaacatgctcatcatcattgccaaaatctataacaacaccttgcatacgcccatgtatgttttccttctgacactggctgttgtggacatcatctgcacaacaagcatcataccgaagatgctggggaccatgctaacatcagaaaataccatttcatatgcaggctgcatgtcccagctcttcttgttcacatggtctctgggagctgagatggttctcttcaccaccatggcctatgaccgctatgtggccatttgtttccctcttcattacagtactattatgaaccaccatatgtgtgtagccttgctcagcatggtcatggctattgcagtcaccaattcctgggtgcacacagctcttatcatgaggttgactttctgtgggccaaacaccattgaccacttcttctgtgagatacccccattgctggctttgtcctgtagccctgtaagaatcaatgaggtgatggtgtatgttgctgatattaccctggccataggggactttattcttacctgcatctcctatggttttatcattgttgctattctccgtatccgcacagtagaaggcaagaggaaggccttctcaacatgctcatctcatctcacagtggtgaccctttactattctcctgtaatctacacctatatccgccctgcttccagctatacatttgaaagagacaaggtggtagctgcactctatactcttgtgactcccacattaaacccgatggtgtacagcttccagaatagggagatgcaggcaggaattaggaaggtgtttgcatttctgaaacactag
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:441933 -> Molecular function: GO:0004930 [G-protein coupled receptor activity] evidence: IEA GeneID:441933 -> Molecular function: GO:0004984 [olfactory receptor activity] evidence: IEA GeneID:441933 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS GeneID:441933 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.