GGRNA Home | Help | Advanced search

2019-03-20 12:16:54, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001005365            1976 bp    mRNA    linear   PRI 07-JUL-2013
DEFINITION  Homo sapiens POTE ankyrin domain family, member A (POTEA),
            transcript variant 2, mRNA.
ACCESSION   NM_001005365
VERSION     NM_001005365.2  GI:53828702
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1976)
  AUTHORS   Hahn,Y., Bera,T.K., Pastan,I.H. and Lee,B.
  TITLE     Duplication and extensive remodeling shaped POTE family genes
            encoding proteins containing ankyrin repeat and coiled coil domains
  JOURNAL   Gene 366 (2), 238-245 (2006)
   PUBMED   16364570
REFERENCE   2  (bases 1 to 1976)
  AUTHORS   Bera,T.K., Huynh,N., Maeda,H., Sathyanarayana,B.K., Lee,B. and
            Pastan,I.
  TITLE     Five POTE paralogs and their splice variants are expressed in human
            prostate and encode proteins of different lengths
  JOURNAL   Gene 337, 45-53 (2004)
   PUBMED   15276201
REFERENCE   3  (bases 1 to 1976)
  AUTHORS   Bera,T.K., Zimonjic,D.B., Popescu,N.C., Sathyanarayana,B.K.,
            Kumar,V., Lee,B. and Pastan,I.
  TITLE     POTE, a highly homologous gene family located on numerous
            chromosomes and expressed in prostate, ovary, testis, placenta, and
            prostate cancer
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 99 (26), 16975-16980 (2002)
   PUBMED   12475935
  REMARK    Erratum:[Proc Natl Acad Sci U S A. 2003 Feb 4;100(3):1462]
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AY462869.1.
            On Oct 6, 2004 this sequence version replaced gi:53749201.
            
            Transcript Variant: This variant (2) includes an additional
            in-frame exon in the central coding region, compared to variant 1,
            resulting in an isoform (2) that is longer than isoform 1. It
            should be noted that this variant may possibly undergo
            nonsense-mediated mRNA decay (NMD); this RefSeq is currently being
            retained because this gene is considered to be protein-coding in
            the literature, including PMID:15276201.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY462869.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025084, ERS025098 [ECO:0000350]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            NMD candidate :: translation inferred
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1976
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="8"
                     /map="8p11.1"
     gene            1..1976
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /note="POTE ankyrin domain family, member A"
                     /db_xref="GeneID:340441"
                     /db_xref="HGNC:33893"
                     /db_xref="HPRD:12330"
                     /db_xref="MIM:608915"
     exon            1..342
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /inference="alignment:Splign:1.39.8"
     variation       10
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:186414472"
     variation       15
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200539958"
     variation       22
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372667563"
     variation       23
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377199752"
     variation       28
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201155622"
     variation       30
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372309011"
     misc_feature    35..37
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /note="upstream in-frame stop codon"
     CDS             44..1540
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /note="isoform 2 is encoded by transcript variant 2;
                     cancer/testis antigen family 104, member 3; ANKRD26-like
                     family A, member 1; protein expressed in prostate, ovary,
                     testis, and placenta 8; prostate, ovary, testis-expressed
                     protein on chromosome 8"
                     /codon_start=1
                     /product="POTE ankyrin domain family member A isoform 2"
                     /protein_id="NP_001005365.2"
                     /db_xref="GI:53828703"
                     /db_xref="GeneID:340441"
                     /db_xref="HGNC:33893"
                     /db_xref="HPRD:12330"
                     /db_xref="MIM:608915"
                     /translation="
MVAEVSPKLAASPMKKPFGFRGKMGKWCCCCFPCCRGSGKNNMGAWRDHDDSAFTEPRYHVRREDLGKLHRAAWWGEVPRADLIVMLRGPGINKRDKKKRTALHLACANGNSEVVSLLLDRQCQLHVFDSKKRTALIKAVQCQEDECALMLLQHGTDPNLPDMYGNTALHYAVYNEDKLMAKTLLLYGADIESKNKGGLTPLLLAVHGQKQRMVKFLIKKKANLNALDRFGRTALILAVRCGSASIVSLLLQQNIDVFSQDVFGQTAEDYAVSSHHSIICQLLSDYKENQMPNNSSGNSNPEQDLKLTSEEEPQRLKGSENSQHEKVTQEPDINKDCDREVEEEMQKHGSNNVGLSENLTDGAAAGNGDGGLVPQRKSRKHENQQFPNTEIEEYHRPEKKSNEKNKVKSQIHSVDNLDDITWPSEIASEDYDLLFSNYETFTLLIEQLKMDFNDSASLSKIQDAVISEEHLLELKNSHYEQLTVEVEQMENMVHVLQK
"
     misc_feature    248..400
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /note="Ankyrin repeats (many copies); Region: Ank_4;
                     pfam13637"
                     /db_xref="CDD:205814"
     misc_feature    320..697
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    335..424
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q6S8J7.1);
                     Region: ANK 1"
     misc_feature    350..628
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    434..523
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q6S8J7.1);
                     Region: ANK 2"
     misc_feature    518..892
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    533..622
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q6S8J7.1);
                     Region: ANK 3"
     misc_feature    548..826
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    632..721
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q6S8J7.1);
                     Region: ANK 4"
     misc_feature    731..820
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q6S8J7.1);
                     Region: ANK 5"
     variation       145
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375076916"
     variation       170
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368946736"
     variation       190
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373185862"
     variation       191
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377723121"
     variation       214
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199877700"
     variation       226
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200746206"
     variation       233..234
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:34629836"
     variation       250
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369755127"
     variation       253
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368110601"
     variation       258
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374495713"
     variation       282
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371301066"
     variation       304
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376345792"
     variation       309
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201692750"
     exon            343..457
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /inference="alignment:Splign:1.39.8"
     variation       360
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374073241"
     variation       380
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368067417"
     variation       383
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370178191"
     variation       433
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:111986448"
     exon            458..631
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /inference="alignment:Splign:1.39.8"
     variation       460
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73677913"
     variation       461..462
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace=""
                     /replace="ta"
                     /db_xref="dbSNP:376823659"
     variation       461
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370204067"
     variation       468
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374125623"
     variation       471
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202238834"
     variation       497
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201098468"
     variation       499
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181221204"
     variation       507
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76600664"
     variation       540
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372554924"
     variation       544
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376393499"
     variation       550
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201957030"
     variation       551
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374355092"
     variation       566
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377297623"
     variation       574
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200393893"
     variation       604
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369576371"
     variation       605
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373766901"
     variation       623
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140881593"
     exon            632..738
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /inference="alignment:Splign:1.39.8"
     variation       637
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371876378"
     variation       649
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111267981"
     variation       677
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182905752"
     variation       678
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148181653"
     variation       703
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374535578"
     variation       721
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377625180"
     variation       728
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370385566"
     exon            739..876
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /inference="alignment:Splign:1.39.8"
     variation       761
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199788574"
     variation       762
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200589494"
     variation       799
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76712602"
     variation       854
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185823654"
     variation       864
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370092912"
     exon            877..947
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /inference="alignment:Splign:1.39.8"
     variation       883
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201150190"
     variation       915
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371554191"
     variation       933..934
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34307948"
     exon            948..1018
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /inference="alignment:Splign:1.39.8"
     variation       969
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:73575237"
     variation       979
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372920514"
     variation       980
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367956975"
     variation       1006
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199749582"
     variation       1012
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199522198"
     exon            1019..1063
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /inference="alignment:Splign:1.39.8"
     variation       1050
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377072653"
     variation       1054
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:73677934"
     exon            1064..1230
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /inference="alignment:Splign:1.39.8"
     variation       1087
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370646984"
     variation       1103
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373558511"
     variation       1113
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367730216"
     variation       1160
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370923298"
     variation       1166
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201811073"
     variation       1207
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113208106"
     variation       1226
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371774449"
     variation       1230
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368278730"
     exon            1231..1261
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /inference="alignment:Splign:1.39.8"
     variation       1255
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200124943"
     variation       1256
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373438270"
     exon            1262..1403
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /inference="alignment:Splign:1.39.8"
     variation       1264
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372759275"
     variation       1281..1282
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34787451"
     variation       1370
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:73561413"
     variation       1376
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200540894"
     variation       1402
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373140737"
     exon            1404..1617
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /inference="alignment:Splign:1.39.8"
     variation       1419
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370141349"
     variation       1452
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:73677971"
     variation       1460
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200018502"
     variation       1465
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200028382"
     variation       1496
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144652182"
     variation       1524
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372910180"
     variation       1525
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375495688"
     variation       1528
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368605905"
     variation       1575
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372058920"
     variation       1586
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190122559"
     exon            1618..1741
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /inference="alignment:Splign:1.39.8"
     variation       1721
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371361379"
     exon            1742..1976
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /inference="alignment:Splign:1.39.8"
     variation       1773
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:138811410"
     variation       1909..1911
                     /gene="POTEA"
                     /gene_synonym="A26A1; CT104.3; POTE-8; POTE8"
                     /replace=""
                     /replace="tct"
                     /db_xref="dbSNP:372753500"
ORIGIN      
gacagacaccatctgctcgctactaccaggctgttgaaagcagatggtggctgaggtttctccaaagctggctgcctcccctatgaagaagccctttggcttcaggggcaagatgggcaagtggtgctgctgctgcttcccctgctgcaggggaagcggcaagaacaacatgggtgcttggagagaccacgacgacagcgccttcacggagccaaggtatcacgtccgtcgagaagatctgggcaagctccacagagctgcctggtggggtgaagtccccagagcggatctcatcgtcatgctcaggggccctggcattaacaaaagggacaagaagaagaggactgctctacacttggcctgtgccaatggcaattcagaagtagtaagtcttctgctggacagacaatgtcaacttcatgtctttgacagcaaaaagaggacagctctgataaaggccgtacaatgccaggaggatgaatgtgcgttaatgttgctacaacatggcactgatccaaatcttccagatatgtatgggaatactgctctacactatgcagtctacaatgaagataaattaatggccaaaacactgcttttatacggtgctgacattgaatcaaaaaacaagggtggcctcacaccacttttgcttgctgtacatggacaaaaacagcgaatggtgaaatttttaatcaagaaaaaagctaatttaaatgcacttgataggtttggaagaactgccctcatacttgctgtacgttgtggatcagcaagtatagttagtcttctacttcagcaaaatattgatgtattttctcaagatgtatttggacaaactgctgaagattatgcagtttctagtcatcatagtataatttgccaattactttctgactacaaagaaaaccagatgccaaacaactcttctggaaatagcaatccagaacaagacttaaagctgacatcagaggaagagccacaaaggcttaaaggaagtgaaaatagtcagcatgagaaagtgactcaagaaccagacataaataaggattgcgatagagaggttgaagaagaaatgcagaagcatggaagtaataatgtgggattatcagaaaacctgactgatggtgctgctgctggcaatggtgatggtggattagttccacaaagaaagagcagaaagcatgaaaatcagcaatttcctaacacagagattgaagagtatcacaggcctgaaaagaaatctaatgaaaagaacaaggtcaaaagccaaatacattcagtggataaccttgatgacataacatggccatcagaaatagcgtcagaggattatgatttgcttttctctaattatgagacttttacattgctcattgaacaactcaaaatggattttaacgattctgctagcctatcaaaaatccaggatgcagttatttcagaagaacacttactagaactcaaaaatagccactatgagcaacttacagtagaagttgaacaaatggaaaatatggttcatgtactacaaaaatagctatctgaggcaaaagaaacacaattacagttagctcctcagaaaggtgaatgtgagcaagaacgctacagttcgagtgaagaacaaaatgatacccggaagcaactttccaaggaacagaatgctagaatattacaagatgagattctgactactaaacagaagcagatagaagtggccgaaaaaaaaatgaattttgagatttctcttagccataaggaagaaaaagaactcttgcatgaaaatagcatgatgcaggaagaaattgccatgctaagaatagaactagacacaataaaacatcagaaccagctaagggaaaagaaatatctggagtacattaaaagtgtgaaagaaaagaatgataatcttctaaaggctatacaattgaatgaggaagcactaacaaaagcagtagttcagtacagtggacagc
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.