Home |
Help |
Advanced search
2024-04-26 02:04:09, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001005243 1008 bp mRNA linear PRI 17-FEB-2013
DEFINITION Homo sapiens olfactory receptor, family 9, subfamily K, member 2
(OR9K2), mRNA.
ACCESSION NM_001005243 XM_497345
VERSION NM_001005243.1 GI:52546736
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1008)
AUTHORS Malnic,B., Godfrey,P.A. and Buck,L.B.
TITLE The human olfactory receptor gene family
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 101 (8), 2584-2589 (2004)
PUBMED 14983052
REMARK Erratum:[Proc Natl Acad Sci U S A. 2004 May 4;101(18):7205]
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from BK004326.1.
On Sep 24, 2004 this sequence version replaced gi:51471112.
Summary: Olfactory receptors interact with odorant molecules in the
nose, to initiate a neuronal response that triggers the perception
of a smell. The olfactory receptor proteins are members of a large
family of G-protein-coupled receptors (GPCR) arising from single
coding-exon genes. Olfactory receptors share a 7-transmembrane
domain structure with many neurotransmitter and hormone receptors
and are responsible for the recognition and G protein-mediated
transduction of odorant signals. The olfactory receptor gene family
is the largest in the genome. The nomenclature assigned to the
olfactory receptor genes and proteins for this organism is
independent of other organisms. [provided by RefSeq, Jul 2008].
FEATURES Location/Qualifiers
source 1..1008
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="12"
/map="12q13.2"
gene 1..1008
/gene="OR9K2"
/gene_synonym="OR12-2"
/note="olfactory receptor, family 9, subfamily K, member
2"
/db_xref="GeneID:441639"
/db_xref="HGNC:15339"
/db_xref="HPRD:15090"
CDS 1..1008
/gene="OR9K2"
/gene_synonym="OR12-2"
/note="olfactory receptor OR12-2"
/codon_start=1
/product="olfactory receptor 9K2"
/protein_id="NP_001005243.1"
/db_xref="GI:52546737"
/db_xref="CCDS:CCDS31814.1"
/db_xref="GeneID:441639"
/db_xref="HGNC:15339"
/db_xref="HPRD:15090"
/translation="
MLGSKPRVHLYILPCASQQVSTMGDRGTSNHSEMTDFILAGFRVRPELHILLFLLFLFVYAMILLGNVGMMTIIMTDPRLNTPMYFFLGNLSFIDLFYSSVIEPKAMINFWSENKSISFAGCVAQLFLFALLIVTEGFLLAAMAYDRFIAICNPLLYSVQMSTRLCTQLVAGSYFCGCISSVIQTSMTFTLSFCASRAVDHFYCDSRPLQRLSCSDLFIHRMISFSLSCIIILPTIIVIIVSYMYIVSTVLKIHSTEGHKKAFSTCSSHLGVVSVLYGAVFFMYLTPDRFPELSKVASLCYSLVTPMLNPLIYSLRNKDVQEALKKFLEKKNIIL
"
misc_feature 151..213
/gene="OR9K2"
/gene_synonym="OR12-2"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8NGE7.2);
transmembrane region"
misc_feature 217..939
/gene="OR9K2"
/gene_synonym="OR12-2"
/note="7 transmembrane receptor (rhodopsin family);
Region: 7tm_1; pfam00001"
/db_xref="CDD:200918"
misc_feature 238..300
/gene="OR9K2"
/gene_synonym="OR12-2"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8NGE7.2);
transmembrane region"
misc_feature 373..435
/gene="OR9K2"
/gene_synonym="OR12-2"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8NGE7.2);
transmembrane region"
misc_feature 490..918
/gene="OR9K2"
/gene_synonym="OR12-2"
/note="Olfactory receptor; Region: 7tm_4; pfam13853"
/db_xref="CDD:206024"
misc_feature 493..555
/gene="OR9K2"
/gene_synonym="OR12-2"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8NGE7.2);
transmembrane region"
misc_feature 667..726
/gene="OR9K2"
/gene_synonym="OR12-2"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8NGE7.2);
transmembrane region"
misc_feature 787..849
/gene="OR9K2"
/gene_synonym="OR12-2"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8NGE7.2);
transmembrane region"
exon 1..1008
/gene="OR9K2"
/gene_synonym="OR12-2"
/inference="alignment:Splign:1.39.8"
variation 35
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="t"
/db_xref="dbSNP:200050297"
variation 35
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace=""
/replace="t"
/db_xref="dbSNP:58036029"
variation 63
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:141858060"
variation 65
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="c"
/db_xref="dbSNP:150635361"
variation 80
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="g"
/db_xref="dbSNP:139798501"
variation 93
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:57538856"
variation 123
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:183433320"
variation 133
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:12303066"
variation 134
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="g"
/db_xref="dbSNP:370254104"
variation 167
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="g"
/replace="t"
/db_xref="dbSNP:187969067"
variation 170
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="g"
/replace="t"
/db_xref="dbSNP:147932475"
variation 178
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:140138852"
variation 182
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="c"
/db_xref="dbSNP:369351596"
variation 190
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:201903556"
variation 236
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="g"
/db_xref="dbSNP:145656923"
variation 243
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:118155337"
variation 251
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:150710144"
variation 254
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="g"
/db_xref="dbSNP:142523671"
variation 278
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:201529743"
variation 308
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="c"
/db_xref="dbSNP:7305779"
variation 333
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="g"
/db_xref="dbSNP:202096303"
variation 336
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="g"
/replace="t"
/db_xref="dbSNP:140917387"
variation 343
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="g"
/db_xref="dbSNP:138666847"
variation 345
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="g"
/replace="t"
/db_xref="dbSNP:191296102"
variation 359
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:201700954"
variation 401
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:371739151"
variation 402
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="g"
/db_xref="dbSNP:139105553"
variation 419
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:150372291"
variation 422
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:138102893"
variation 423
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="g"
/db_xref="dbSNP:149555130"
variation 427
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374268402"
variation 439
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:149479525"
variation 445
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="g"
/db_xref="dbSNP:200714875"
variation 451
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="g"
/db_xref="dbSNP:200046785"
variation 456
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:139097998"
variation 490
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:143111490"
variation 500
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:147495129"
variation 582
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:140070869"
variation 583
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="g"
/db_xref="dbSNP:77545847"
variation 620
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="g"
/db_xref="dbSNP:7306491"
variation 631
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:112782622"
variation 644
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="g"
/db_xref="dbSNP:200849521"
variation 683
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:368474784"
variation 725
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="c"
/db_xref="dbSNP:371938368"
variation 727
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:376633847"
variation 756
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="g"
/replace="t"
/db_xref="dbSNP:140850337"
variation 762
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:7137261"
variation 773
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="g"
/replace="t"
/db_xref="dbSNP:147309652"
variation 795
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:369944089"
variation 821
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="g"
/db_xref="dbSNP:371717806"
variation 854
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="g"
/replace="t"
/db_xref="dbSNP:201774903"
variation 860
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="c"
/db_xref="dbSNP:140329988"
variation 862
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="g"
/db_xref="dbSNP:143562624"
variation 871
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="t"
/db_xref="dbSNP:148051420"
variation 889
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="g"
/replace="t"
/db_xref="dbSNP:140887553"
variation 899
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="g"
/db_xref="dbSNP:375038831"
variation 982
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="g"
/db_xref="dbSNP:200967865"
variation 1003
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="a"
/replace="c"
/db_xref="dbSNP:373940747"
variation 1007
/gene="OR9K2"
/gene_synonym="OR12-2"
/replace="c"
/replace="g"
/db_xref="dbSNP:192393134"
ORIGIN
atgctaggatccaaaccaagagttcatttgtatattttgccctgtgcctctcaacaggtttctaccatgggtgacaggggaacaagcaatcactcagaaatgactgacttcattcttgcaggcttcagggtacgcccagagctccacattctcctcttcctgctatttttgtttgtttatgccatgatccttctagggaatgttgggatgatgaccattattatgactgatcctcggctgaacacaccaatgtattttttcctaggcaatctctccttcattgatcttttctattcatctgttattgaacccaaggctatgatcaacttctggtctgaaaacaagtctatctcctttgcaggctgtgtggcccagctctttctctttgccctcctcattgtgactgagggatttctcctggcggccatggcttatgaccgctttattgccatctgcaaccctctgctctactctgttcaaatgtccacacgtctgtgtactcagttggtggctggttcctatttttgtggctgcattagctcagttattcagactagcatgacatttactttatctttttgcgcttctcgggctgttgaccacttttactgtgattctcgcccacttcagagactgtcttgttctgatctctttatccatagaatgatatctttttccttatcatgtattattatcttgcctactatcatagtcattatagtatcttacatgtatattgtgtccacagttctaaagatacattctactgagggacataagaaggccttctccacctgcagctctcacctgggagttgtgagtgtgctgtatggtgctgtcttttttatgtatctcactcctgacagatttcctgagctgagtaaagtggcatccttatgttactccctagtcactcccatgttgaatcctttgatttactctctgaggaacaaagatgtccaagaggctctaaaaaaatttctagagaagaaaaatattattctttga
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:441639 -> Molecular function: GO:0004930 [G-protein coupled receptor activity] evidence: IEA
GeneID:441639 -> Molecular function: GO:0004984 [olfactory receptor activity] evidence: IEA
GeneID:441639 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
GeneID:441639 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.