2024-04-20 22:34:54, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_000927 4718 bp mRNA linear PRI 07-JUL-2013 DEFINITION Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 1 (ABCB1), mRNA. ACCESSION NM_000927 VERSION NM_000927.4 GI:318037598 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 4718) AUTHORS Hirooka-Masui,K., Lesmana,R., Iwasaki,T., Xu,M., Hayasaka,K., Haraguchi,M., Takeshita,A., Shimokawa,N., Yamamoto,K. and Koibuchi,N. TITLE Interaction of silencing mediator for retinoid and thyroid receptors with steroid and xenobiotic receptor on multidrug resistance 1 promoter JOURNAL Life Sci. 92 (17-19), 911-915 (2013) PUBMED 23562850 REMARK GeneRIF: silencing mediator for retinoid and thyroid receptors (SMRT) may affect steroid and xenobiotic receptor(SXR)-mediated transcription on xenobiotic-response enhancer module (XREM) of MDR1 promoter even in the presence of rifampicin REFERENCE 2 (bases 1 to 4718) AUTHORS Kim,K.M., Kim,H.S., Lim,S.H., Cheong,S.H., Choi,E.J., Kang,H., Choi,H.R., Jeon,J.W., Yon,J.H., Oh,M. and Shin,J.G. TITLE Effects of genetic polymorphisms of OPRM1, ABCB1, CYP3A4/5 on postoperative fentanyl consumption in Korean gynecologic patients JOURNAL Int J Clin Pharmacol Ther 51 (5), 383-392 (2013) PUBMED 23557865 REMARK GeneRIF: In Korean gynecologic patients, no association was found between ABCB1 genetic polymorphisms and postoperative fentanyl consumption. REFERENCE 3 (bases 1 to 4718) AUTHORS Oros,M.M. TITLE [Pharmacogenetic criteria of drug-resistant epilepsy] JOURNAL Lik. Sprava 8, 71-74 (2012) PUBMED 23786015 REMARK GeneRIF: Single nucleotide polymorphisms in ABCB1 and SCN1A genes significantly correlate with drug resistance to antiepileptic agents in patients with epilepsy. REFERENCE 4 (bases 1 to 4718) AUTHORS Kitada,K. and Yamasaki,T. TITLE The MDR1/ABCB1 regional amplification in large inverted repeats with asymmetric sequences and microhomologies at the junction sites JOURNAL Cancer Genet. Cytogenet. 178 (2), 120-127 (2007) PUBMED 17954267 REMARK GeneRIF: Treatment with the anti-cancer drug paclitaxel have an increased copy number in the 7q21.12 region including the MDR1/ABCB1 gene. REFERENCE 5 (bases 1 to 4718) AUTHORS Kioka,N., Yamano,Y., Komano,T. and Ueda,K. TITLE Heat-shock responsive elements in the induction of the multidrug resistance gene (MDR1) JOURNAL FEBS Lett. 301 (1), 37-40 (1992) PUBMED 1360409 REFERENCE 6 (bases 1 to 4718) AUTHORS Safa,A.R., Stern,R.K., Choi,K., Agresti,M., Tamai,I., Mehta,N.D. and Roninson,I.B. TITLE Molecular basis of preferential resistance to colchicine in multidrug-resistant human cells conferred by Gly-185----Val-185 substitution in P-glycoprotein JOURNAL Proc. Natl. Acad. Sci. U.S.A. 87 (18), 7225-7229 (1990) PUBMED 1976255 REFERENCE 7 (bases 1 to 4718) AUTHORS Gekeler,V., Weger,S. and Probst,H. TITLE mdr1/P-glycoprotein gene segments analyzed from various human leukemic cell lines exhibiting different multidrug resistance profiles JOURNAL Biochem. Biophys. Res. Commun. 169 (2), 796-802 (1990) PUBMED 1972623 REFERENCE 8 (bases 1 to 4718) AUTHORS Chen,C.J., Clark,D., Ueda,K., Pastan,I., Gottesman,M.M. and Roninson,I.B. TITLE Genomic organization of the human multidrug resistance (MDR1) gene and origin of P-glycoproteins JOURNAL J. Biol. Chem. 265 (1), 506-514 (1990) PUBMED 1967175 REFERENCE 9 (bases 1 to 4718) AUTHORS Kioka,N., Tsubota,J., Kakehi,Y., Komano,T., Gottesman,M.M., Pastan,I. and Ueda,K. TITLE P-glycoprotein gene (MDR1) cDNA from human adrenal: normal P-glycoprotein carries Gly185 with an altered pattern of multidrug resistance JOURNAL Biochem. Biophys. Res. Commun. 162 (1), 224-231 (1989) PUBMED 2568832 REFERENCE 10 (bases 1 to 4718) AUTHORS Chen,C.J., Chin,J.E., Ueda,K., Clark,D.P., Pastan,I., Gottesman,M.M. and Roninson,I.B. TITLE Internal duplication and homology with bacterial transport proteins in the mdr1 (P-glycoprotein) gene from multidrug-resistant human cells JOURNAL Cell 47 (3), 381-389 (1986) PUBMED 2876781 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK290159.1, AC002457.2 and AA776371.1. This sequence is a reference standard in the RefSeqGene project. On Jan 13, 2011 this sequence version replaced gi:42741658. Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is an ATP-dependent drug efflux pump for xenobiotic compounds with broad substrate specificity. It is responsible for decreased drug accumulation in multidrug-resistant cells and often mediates the development of resistance to anticancer drugs. This protein also functions as a transporter in the blood-brain barrier. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK290159.1, M14758.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-492 AK290159.1 2-493 493-493 AC002457.2 35852-35852 c 494-553 AK290159.1 495-554 554-554 AC002457.2 35791-35791 c 555-4338 AK290159.1 556-4339 4339-4718 AA776371.1 1-380 c FEATURES Location/Qualifiers source 1..4718 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="7" /map="7q21.12" gene 1..4718 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="ATP-binding cassette, sub-family B (MDR/TAP), member 1" /db_xref="GeneID:5243" /db_xref="HGNC:40" /db_xref="HPRD:01370" /db_xref="MIM:171050" exon 1..163 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" variation 54 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:3747802" exon 164..487 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" STS 172..351 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /standard_name="PGY1" /db_xref="UniSTS:3185" variation 253 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:35265821" variation 349 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="g" /db_xref="dbSNP:34976462" misc_feature 365..367 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="upstream in-frame stop codon" variation 365 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:3213619" variation 450 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:59318075" variation 451 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:28381801" exon 488..561 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" variation 490 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:34834348" variation 492 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:57237390" variation 493 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:2214102" CDS 494..4336 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /EC_number="3.6.3.44" /note="colchicin sensitivity; doxorubicin resistance; P-glycoprotein 1" /codon_start=1 /product="multidrug resistance protein 1" /protein_id="NP_000918.2" /db_xref="GI:42741659" /db_xref="CCDS:CCDS5608.1" /db_xref="GeneID:5243" /db_xref="HGNC:40" /db_xref="HPRD:01370" /db_xref="MIM:171050" /translation="
MDLEGDRNGGAKKKNFFKLNNKSEKDKKEKKPTVSVFSMFRYSNWLDKLYMVVGTLAAIIHGAGLPLMMLVFGEMTDIFANAGNLEDLMSNITNRSDINDTGFFMNLEEDMTRYAYYYSGIGAGVLVAAYIQVSFWCLAAGRQIHKIRKQFFHAIMRQEIGWFDVHDVGELNTRLTDDVSKINEGIGDKIGMFFQSMATFFTGFIVGFTRGWKLTLVILAISPVLGLSAAVWAKILSSFTDKELLAYAKAGAVAEEVLAAIRTVIAFGGQKKELERYNKNLEEAKRIGIKKAITANISIGAAFLLIYASYALAFWYGTTLVLSGEYSIGQVLTVFFSVLIGAFSVGQASPSIEAFANARGAAYEIFKIIDNKPSIDSYSKSGHKPDNIKGNLEFRNVHFSYPSRKEVKILKGLNLKVQSGQTVALVGNSGCGKSTTVQLMQRLYDPTEGMVSVDGQDIRTINVRFLREIIGVVSQEPVLFATTIAENIRYGRENVTMDEIEKAVKEANAYDFIMKLPHKFDTLVGERGAQLSGGQKQRIAIARALVRNPKILLLDEATSALDTESEAVVQVALDKARKGRTTIVIAHRLSTVRNADVIAGFDDGVIVEKGNHDELMKEKGIYFKLVTMQTAGNEVELENAADESKSEIDALEMSSNDSRSSLIRKRSTRRSVRGSQAQDRKLSTKEALDESIPPVSFWRIMKLNLTEWPYFVVGVFCAIINGGLQPAFAIIFSKIIGVFTRIDDPETKRQNSNLFSLLFLALGIISFITFFLQGFTFGKAGEILTKRLRYMVFRSMLRQDVSWFDDPKNTTGALTTRLANDAAQVKGAIGSRLAVITQNIANLGTGIIISFIYGWQLTLLLLAIVPIIAIAGVVEMKMLSGQALKDKKELEGSGKIATEAIENFRTVVSLTQEQKFEHMYAQSLQVPYRNSLRKAHIFGITFSFTQAMMYFSYAGCFRFGAYLVAHKLMSFEDVLLVFSAVVFGAMAVGQVSSFAPDYAKAKISAAHIIMIIEKTPLIDSYSTEGLMPNTLEGNVTFGEVVFNYPTRPDIPVLQGLSLEVKKGQTLALVGSSGCGKSTVVQLLERFYDPLAGKVLLDGKEIKRLNVQWLRAHLGIVSQEPILFDCSIAENIAYGDNSRVVSQEEIVRAAKEANIHAFIESLPNKYSTKVGDKGTQLSGGQKQRIAIARALVRQPHILLLDEATSALDTESEKVVQEALDKAREGRTCIVIAHRLSTIQNADLIVVFQNGRVKEHGTHQQLLAQKGIYFSMVSVQAGTKRQ
" misc_feature 626..694 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P08183.3); transmembrane region" misc_feature 650..4294 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="multidrug resistance protein (mdr1); Provisional; Region: PTZ00265" /db_xref="CDD:173501" misc_feature 701..1528 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="ABC transporter transmembrane region; Region: ABC_membrane; pfam00664" /db_xref="CDD:201380" misc_feature 842..904 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P08183.3); transmembrane region" misc_feature 1052..1117 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P08183.3); transmembrane region" misc_feature 1139..1201 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P08183.3); transmembrane region" misc_feature 1370..1441 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P08183.3); transmembrane region" misc_feature 1484..1549 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P08183.3); transmembrane region" misc_feature 1667..2380 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="MTABC3 (also known as ABCB6) is a mitochondrial ATP-binding cassette protein involved in iron homeostasis and one of four ABC transporters expressed in the mitochondrial inner membrane, the other three being MDL1(ABC7), MDL2, and ATM1. In fact, the...; Region: ABC_MTABC3_MDL1_MDL2; cd03249" /db_xref="CDD:73008" misc_feature 1772..1795 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="Walker A/P-loop; other site" /db_xref="CDD:73008" misc_feature order(1781..1786,1790..1798,1916..1918,2156..2161, 2252..2254) /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:73008" misc_feature 1907..1918 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="Q-loop/lid; other site" /db_xref="CDD:73008" misc_feature 2084..2113 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="ABC transporter signature motif; other site" /db_xref="CDD:73008" misc_feature 2144..2161 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="Walker B; other site" /db_xref="CDD:73008" misc_feature 2168..2179 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="D-loop; other site" /db_xref="CDD:73008" misc_feature 2240..2260 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="H-loop/switch region; other site" /db_xref="CDD:73008" misc_feature 2474..2476 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 2492..2494 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 2504..2506 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 2540..2542 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 2627..2689 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P08183.3); transmembrane region" misc_feature 2636..3466 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="ABC transporter transmembrane region; Region: ABC_membrane; pfam00664" /db_xref="CDD:201380" misc_feature 2762..2824 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P08183.3); transmembrane region" misc_feature 2990..3052 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P08183.3); transmembrane region" misc_feature 3056..3115 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P08183.3); transmembrane region" misc_feature 3296..3364 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P08183.3); transmembrane region" misc_feature 3413..3478 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P08183.3); transmembrane region" misc_feature 3596..4315 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="MTABC3 (also known as ABCB6) is a mitochondrial ATP-binding cassette protein involved in iron homeostasis and one of four ABC transporters expressed in the mitochondrial inner membrane, the other three being MDL1(ABC7), MDL2, and ATM1. In fact, the...; Region: ABC_MTABC3_MDL1_MDL2; cd03249" /db_xref="CDD:73008" misc_feature 3701..3724 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="Walker A/P-loop; other site" /db_xref="CDD:73008" misc_feature order(3710..3715,3719..3727,3845..3847,4091..4096, 4187..4189) /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:73008" misc_feature 3836..3847 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="Q-loop/lid; other site" /db_xref="CDD:73008" misc_feature 4019..4048 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="ABC transporter signature motif; other site" /db_xref="CDD:73008" misc_feature 4079..4096 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="Walker B; other site" /db_xref="CDD:73008" misc_feature 4103..4114 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="D-loop; other site" /db_xref="CDD:73008" misc_feature 4175..4195 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /note="H-loop/switch region; other site" /db_xref="CDD:73008" variation 542 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:28381804" variation 550..554 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:9332385" variation 550 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:76199854" variation 554 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:9282564" exon 562..610 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" exon 611..779 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" variation 624 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:1202183" variation 731..732 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="c" /db_xref="dbSNP:76812075" variation 732 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="c" /db_xref="dbSNP:9282565" variation 759 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:35810889" exon 780..831 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" exon 832..1023 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" variation 924 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:61607171" variation 995 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:61122623" exon 1024..1195 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" variation 1033 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:1128500" variation 1041 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:60419673" variation 1047..1048 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="t" /db_xref="dbSNP:1128502" exon 1196..1320 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" variation 1222 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:2235022" variation 1231 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:28381867" variation 1274 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:36008564" exon 1321..1492 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" exon 1493..1606 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" exon 1607..1717 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" variation 1692 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:2229109" exon 1718..1843 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" variation 1729 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:1128503" variation 1801 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:35068177" exon 1844..2047 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" exon 2048..2218 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" variation 2110 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:35633772" variation 2125 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:60247941" variation 2155 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="g" /db_xref="dbSNP:2235012" variation 2167 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:56871767" variation 2188 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:59697741" variation 2189 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:28381902" exon 2219..2380 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" variation 2270 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:28381914" variation 2287 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:28381915" variation 2288 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:2235036" variation 2330 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="g" /replace="t" /db_xref="dbSNP:57001392" exon 2381..2557 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" variation 2478 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="g" /replace="t" /db_xref="dbSNP:35657960" variation 2498 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:35023033" variation 2530 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:59340265" exon 2558..2704 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" exon 2705..2812 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" exon 2813..2890 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" exon 2891..2974 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" variation 2894 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:2235039" exon 2975..3178 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" variation 2978 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:2032581" variation 2998 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:28381966" variation 2999 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:28381967" variation 3040 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:36105130" variation 3143 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:9282563" variation 3170 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:2032582" exon 3179..3279 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" exon 3280..3420 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" exon 3421..3577 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" variation 3468 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:56849127" variation 3577 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:2235044" exon 3578..3775 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" variation 3644 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="g" /db_xref="dbSNP:28401798" variation 3755 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:57521326" exon 3776..3982 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" variation 3815 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:35730308" variation 3889 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:34748655" variation 3914 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="t" /db_xref="dbSNP:2229107" variation 3928 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:1045642" exon 3983..4129 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" variation 3995 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:59241388" STS 4127..4308 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /standard_name="RH17678" /db_xref="UniSTS:4896" exon 4130..4716 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /inference="alignment:Splign:1.39.8" variation 4240 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="g" /db_xref="dbSNP:2235051" variation 4244 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:28364274" variation 4260 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="c" /db_xref="dbSNP:35721439" variation 4357 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:28364275" STS 4385..4692 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /standard_name="D7S2326" /db_xref="UniSTS:69986" STS 4395..4646 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /standard_name="SHGC-56130" /db_xref="UniSTS:63985" variation 4413 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="" /replace="a" /db_xref="dbSNP:61473597" variation 4414 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="" /replace="c" /db_xref="dbSNP:61565026" variation 4415..4418 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="" /replace="ttac" /db_xref="dbSNP:2235052" variation 4415 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="" /replace="t" /db_xref="dbSNP:57792825" variation 4425 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="t" /db_xref="dbSNP:17064" STS 4449..4641 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /standard_name="G60182" /db_xref="UniSTS:137441" variation 4482 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:28364277" variation 4505..4506 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="" /replace="acagagag" /db_xref="dbSNP:56794014" variation 4508..4509 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="" /replace="gagagaca" /db_xref="dbSNP:28364278" variation 4529 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:3842" variation 4538 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:41297363" variation 4555 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:41296639" polyA_signal 4563..4568 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" polyA_site 4588 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" variation 4588 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="c" /db_xref="dbSNP:28364279" variation 4652 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="a" /replace="g" /db_xref="dbSNP:28364280" variation 4691 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" /replace="c" /replace="t" /db_xref="dbSNP:57126620" polyA_signal 4694..4699 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" polyA_site 4716 /gene="ABCB1" /gene_synonym="ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1" ORIGIN
aaacacttgtattaccattttaaaggctatcattactctttacctgtgaagagtagaacatgaagaaatctactttattcagatattctccagattcctaaagattagagatcatttctcattctcctaggagtactcacttcaggaagcaaccagataaaagagaggtgcaacggaagccagaacattcctcctggaaattcaacctgtttcgcagtttctcgaggaatcagcattcagtcaatccgggccgggagcagtcatctgtggtgaggctgattggctgggcaggaacagcgccggggcgtgggctgagcacagccgcttcgctctctttgccacaggaagcctgagctcattcgagtagcggctcttccaagctcaaagaagcagaggccgctgttcgtttcctttaggtctttccactaaagtcggagtatcttcttccaaaatttcacgtcttggtggccgttccaaggagcgcgaggtcggaatggatcttgaaggggaccgcaatggaggagcaaagaagaagaacttttttaaactgaacaataaaagtgaaaaagataagaaggaaaagaaaccaactgtcagtgtattttcaatgtttcgctattcaaattggcttgacaagttgtatatggtggtgggaactttggctgccatcatccatggggctggacttcctctcatgatgctggtgtttggagaaatgacagatatctttgcaaatgcaggaaatttagaagatctgatgtcaaacatcactaatagaagtgatatcaatgatacagggttcttcatgaatctggaggaagacatgaccaggtatgcctattattacagtggaattggtgctggggtgctggttgctgcttacattcaggtttcattttggtgcctggcagctggaagacaaatacacaaaattagaaaacagttttttcatgctataatgcgacaggagataggctggtttgatgtgcacgatgttggggagcttaacacccgacttacagatgatgtctccaagattaatgaaggaattggtgacaaaattggaatgttctttcagtcaatggcaacatttttcactgggtttatagtaggatttacacgtggttggaagctaacccttgtgattttggccatcagtcctgttcttggactgtcagctgctgtctgggcaaagatactatcttcatttactgataaagaactcttagcgtatgcaaaagctggagcagtagctgaagaggtcttggcagcaattagaactgtgattgcatttggaggacaaaagaaagaacttgaaaggtacaacaaaaatttagaagaagctaaaagaattgggataaagaaagctattacagccaatatttctataggtgctgctttcctgctgatctatgcatcttatgctctggccttctggtatgggaccaccttggtcctctcaggggaatattctattggacaagtactcactgtattcttttctgtattaattggggcttttagtgttggacaggcatctccaagcattgaagcatttgcaaatgcaagaggagcagcttatgaaatcttcaagataattgataataagccaagtattgacagctattcgaagagtgggcacaaaccagataatattaagggaaatttggaattcagaaatgttcacttcagttacccatctcgaaaagaagttaagatcttgaagggtctgaacctgaaggtgcagagtgggcagacggtggccctggttggaaacagtggctgtgggaagagcacaacagtccagctgatgcagaggctctatgaccccacagaggggatggtcagtgttgatggacaggatattaggaccataaatgtaaggtttctacgggaaatcattggtgtggtgagtcaggaacctgtattgtttgccaccacgatagctgaaaacattcgctatggccgtgaaaatgtcaccatggatgagattgagaaagctgtcaaggaagccaatgcctatgactttatcatgaaactgcctcataaatttgacaccctggttggagagagaggggcccagttgagtggtgggcagaagcagaggatcgccattgcacgtgccctggttcgcaaccccaagatcctcctgctggatgaggccacgtcagccttggacacagaaagcgaagcagtggttcaggtggctctggataaggccagaaaaggtcggaccaccattgtgatagctcatcgtttgtctacagttcgtaatgctgacgtcatcgctggtttcgatgatggagtcattgtggagaaaggaaatcatgatgaactcatgaaagagaaaggcatttacttcaaacttgtcacaatgcagacagcaggaaatgaagttgaattagaaaatgcagctgatgaatccaaaagtgaaattgatgccttggaaatgtcttcaaatgattcaagatccagtctaataagaaaaagatcaactcgtaggagtgtccgtggatcacaagcccaagacagaaagcttagtaccaaagaggctctggatgaaagtatacctccagtttccttttggaggattatgaagctaaatttaactgaatggccttattttgttgttggtgtattttgtgccattataaatggaggcctgcaaccagcatttgcaataatattttcaaagattataggggtttttacaagaattgatgatcctgaaacaaaacgacagaatagtaacttgttttcactattgtttctagcccttggaattatttcttttattacatttttccttcagggtttcacatttggcaaagctggagagatcctcaccaagcggctccgatacatggttttccgatccatgctcagacaggatgtgagttggtttgatgaccctaaaaacaccactggagcattgactaccaggctcgccaatgatgctgctcaagttaaaggggctataggttccaggcttgctgtaattacccagaatatagcaaatcttgggacaggaataattatatccttcatctatggttggcaactaacactgttactcttagcaattgtacccatcattgcaatagcaggagttgttgaaatgaaaatgttgtctggacaagcactgaaagataagaaagaactagaaggttctgggaagatcgctactgaagcaatagaaaacttccgaaccgttgtttctttgactcaggagcagaagtttgaacatatgtatgctcagagtttgcaggtaccatacagaaactctttgaggaaagcacacatctttggaattacattttccttcacccaggcaatgatgtatttttcctatgctggatgtttccggtttggagcctacttggtggcacataaactcatgagctttgaggatgttctgttagtattttcagctgttgtctttggtgccatggccgtggggcaagtcagttcatttgctcctgactatgccaaagccaaaatatcagcagcccacatcatcatgatcattgaaaaaacccctttgattgacagctacagcacggaaggcctaatgccgaacacattggaaggaaatgtcacatttggtgaagttgtattcaactatcccacccgaccggacatcccagtgcttcagggactgagcctggaggtgaagaagggccagacgctggctctggtgggcagcagtggctgtgggaagagcacagtggtccagctcctggagcggttctacgaccccttggcagggaaagtgctgcttgatggcaaagaaataaagcgactgaatgttcagtggctccgagcacacctgggcatcgtgtcccaggagcccatcctgtttgactgcagcattgctgagaacattgcctatggagacaacagccgggtggtgtcacaggaagagattgtgagggcagcaaaggaggccaacatacatgccttcatcgagtcactgcctaataaatatagcactaaagtaggagacaaaggaactcagctctctggtggccagaaacaacgcattgccatagctcgtgcccttgttagacagcctcatattttgcttttggatgaagccacgtcagctctggatacagaaagtgaaaaggttgtccaagaagccctggacaaagccagagaaggccgcacctgcattgtgattgctcaccgcctgtccaccatccagaatgcagacttaatagtggtgtttcagaatggcagagtcaaggagcatggcacgcatcagcagctgctggcacagaaaggcatctatttttcaatggtcagtgtccaggctggaacaaagcgccagtgaactctgactgtatgagatgttaaatactttttaatatttgtttagatatgacatttattcaaagttaaaagcaaacacttacagaattatgaagaggtatctgtttaacatttcctcagtcaagttcagagtcttcagagacttcgtaattaaaggaacagagtgagagacatcatcaagtggagagaaatcatagtttaaactgcattataaattttataacagaattaaagtagattttaaaagataaaatgtgtaattttgtttatattttcccatttggactgtaactgactgccttgctaaaagattatagaagtagcaaaaagtattgaaatgtttgcataaagtgtctataataaaactaaactttcatgtgaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:5243 -> Molecular function: GO:0005215 [transporter activity] evidence: TAS GeneID:5243 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:5243 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA GeneID:5243 -> Molecular function: GO:0008559 [xenobiotic-transporting ATPase activity] evidence: IEA GeneID:5243 -> Molecular function: GO:0042626 [ATPase activity, coupled to transmembrane movement of substances] evidence: IBA GeneID:5243 -> Biological process: GO:0000086 [G2/M transition of mitotic cell cycle] evidence: IDA GeneID:5243 -> Biological process: GO:0006810 [transport] evidence: TAS GeneID:5243 -> Biological process: GO:0006855 [drug transmembrane transport] evidence: TAS GeneID:5243 -> Biological process: GO:0042493 [response to drug] evidence: TAS GeneID:5243 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS GeneID:5243 -> Biological process: GO:0055085 [transmembrane transport] evidence: IBA GeneID:5243 -> Biological process: GO:0055085 [transmembrane transport] evidence: TAS GeneID:5243 -> Biological process: GO:0072089 [stem cell proliferation] evidence: IMP GeneID:5243 -> Cellular component: GO:0000139 [Golgi membrane] evidence: IBA GeneID:5243 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS GeneID:5243 -> Cellular component: GO:0009986 [cell surface] evidence: IDA GeneID:5243 -> Cellular component: GO:0016020 [membrane] evidence: TAS GeneID:5243 -> Cellular component: GO:0016021 [integral to membrane] evidence: IBA GeneID:5243 -> Cellular component: GO:0016324 [apical plasma membrane] evidence: IBA GeneID:5243 -> Cellular component: GO:0046581 [intercellular canaliculus] evidence: IBA ANNOTATIONS from NCBI Entrez Gene (20130726): NP_000918 -> EC 3.6.3.44
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.