GGRNA Home | Help | Advanced search

2025-07-09 14:28:54, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_000888               2397 bp    mRNA    linear   PRI 14-MAY-2013
DEFINITION  Homo sapiens integrin, beta 6 (ITGB6), mRNA.
ACCESSION   NM_000888
VERSION     NM_000888.3  GI:9966771
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2397)
  AUTHORS   Hezel,A.F., Deshpande,V., Zimmerman,S.M., Contino,G., Alagesan,B.,
            O'Dell,M.R., Rivera,L.B., Harper,J., Lonning,S., Brekken,R.A. and
            Bardeesy,N.
  TITLE     TGF-beta and alphavbeta6 integrin act in a common pathway to
            suppress pancreatic cancer progression
  JOURNAL   Cancer Res. 72 (18), 4840-4845 (2012)
   PUBMED   22787119
  REMARK    GeneRIF: our findings indicate that alphavbeta6 and TGF-beta act in
            a common tumor suppressor pathway
REFERENCE   2  (bases 1 to 2397)
  AUTHORS   Yang,S.B., Du,Y., Wu,B.Y., Xu,S.P., Wen,J.B., Zhu,M., Cai,C.H. and
            Yang,P.C.
  TITLE     Integrin alphavbeta6 promotes tumor tolerance in colorectal cancer
  JOURNAL   Cancer Immunol. Immunother. 61 (3), 335-342 (2012)
   PUBMED   21913024
  REMARK    GeneRIF: Data suggest that colorectal cancer (CRC)-derived integrin
            alphavbeta6 is involved in the establishment of tumor immune
            tolerance in local tissues.
REFERENCE   3  (bases 1 to 2397)
  AUTHORS   Lee,C.N., Heidbrink,J.L., McKinnon,K., Bushman,V., Olsen,H.,
            FitzHugh,W., Li,A., Van Orden,K., He,T., Ruben,S.M. and Moore,P.A.
  TITLE     RNA interference characterization of proteins discovered by
            proteomic analysis of pancreatic cancer reveals function in cell
            growth and survival
  JOURNAL   Pancreas 41 (1), 84-94 (2012)
   PUBMED   21934552
  REMARK    GeneRIF: Data indicate that integrin beta6, CD46, tissue factor,
            and chromosome 14 open reading frame 1 (C14ORF1), were identified
            as overexpressed on pancreatic cancer cell lines.
REFERENCE   4  (bases 1 to 2397)
  AUTHORS   Defilles,C., Montero,M.P., Lissitzky,J.C., Rome,S., Siret,C.,
            Luis,J., Andre,F. and Rigot,V.
  TITLE     alphav integrin processing interferes with the cross-talk between
            alphavbeta5/beta6 and alpha2beta1 integrins
  JOURNAL   Biol. Cell 103 (11), 519-529 (2011)
   PUBMED   21787362
  REMARK    GeneRIF: The endoproteolytic cleavage of alphav subunits is
            necessary for alphavbeta5/beta6 integrin to control alpha2beta1
            function and could thus play an essential role in colon cancer cell
            migration.
REFERENCE   5  (bases 1 to 2397)
  AUTHORS   Stanescu,H.C., Arcos-Burgos,M., Medlar,A., Bockenhauer,D.,
            Kottgen,A., Dragomirescu,L., Voinescu,C., Patel,N., Pearce,K.,
            Hubank,M., Stephens,H.A., Laundy,V., Padmanabhan,S., Zawadzka,A.,
            Hofstra,J.M., Coenen,M.J., den Heijer,M., Kiemeney,L.A.,
            Bacq-Daian,D., Stengel,B., Powis,S.H., Brenchley,P., Feehally,J.,
            Rees,A.J., Debiec,H., Wetzels,J.F., Ronco,P., Mathieson,P.W. and
            Kleta,R.
  TITLE     Risk HLA-DQA1 and PLA(2)R1 alleles in idiopathic membranous
            nephropathy
  JOURNAL   N. Engl. J. Med. 364 (7), 616-626 (2011)
   PUBMED   21323541
REFERENCE   6  (bases 1 to 2397)
  AUTHORS   Weinacker,A., Ferrando,R., Elliott,M., Hogg,J., Balmes,J. and
            Sheppard,D.
  TITLE     Distribution of integrins alpha v beta 6 and alpha 9 beta 1 and
            their known ligands, fibronectin and tenascin, in human airways
  JOURNAL   Am. J. Respir. Cell Mol. Biol. 12 (5), 547-556 (1995)
   PUBMED   7537970
REFERENCE   7  (bases 1 to 2397)
  AUTHORS   Jiang,W.M., Jenkins,D., Yuan,Q., Leung,E., Choo,K.H., Watson,J.D.
            and Krissansen,G.W.
  TITLE     The gene organization of the human beta 7 subunit, the common beta
            subunit of the leukocyte integrins HML-1 and LPAM-1
  JOURNAL   Int. Immunol. 4 (9), 1031-1040 (1992)
   PUBMED   1382574
REFERENCE   8  (bases 1 to 2397)
  AUTHORS   Busk,M., Pytela,R. and Sheppard,D.
  TITLE     Characterization of the integrin alpha v beta 6 as a
            fibronectin-binding protein
  JOURNAL   J. Biol. Chem. 267 (9), 5790-5796 (1992)
   PUBMED   1532572
REFERENCE   9  (bases 1 to 2397)
  AUTHORS   Krissansen,G.W., Yuan,Q., Jenkins,D., Jiang,W.M., Rooke,L.,
            Spurr,N.K., Eccles,M., Leung,E. and Watson,J.D.
  TITLE     Chromosomal locations of the genes coding for the integrin beta 6
            and beta 7 subunits
  JOURNAL   Immunogenetics 35 (1), 58-61 (1992)
   PUBMED   1729173
REFERENCE   10 (bases 1 to 2397)
  AUTHORS   Sheppard,D., Rozzo,C., Starr,L., Quaranta,V., Erle,D.J. and
            Pytela,R.
  TITLE     Complete amino acid sequence of a novel integrin beta subunit (beta
            6) identified in epithelial cells using the polymerase chain
            reaction
  JOURNAL   J. Biol. Chem. 265 (20), 11502-11507 (1990)
   PUBMED   2365683
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from M35198.3.
            On Sep 5, 2000 this sequence version replaced gi:9625001.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: M35198.3, BC121178.2 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025083, ERS025084 [ECO:0000350]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..2397
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q24.2"
     gene            1..2397
                     /gene="ITGB6"
                     /note="integrin, beta 6"
                     /db_xref="GeneID:3694"
                     /db_xref="HGNC:6161"
                     /db_xref="HPRD:00947"
                     /db_xref="MIM:147558"
     exon            1..77
                     /gene="ITGB6"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(7)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199606196"
     CDS             17..2383
                     /gene="ITGB6"
                     /note="integrin beta-6"
                     /codon_start=1
                     /product="integrin beta-6 precursor"
                     /protein_id="NP_000879.2"
                     /db_xref="GI:9625002"
                     /db_xref="CCDS:CCDS2212.1"
                     /db_xref="GeneID:3694"
                     /db_xref="HGNC:6161"
                     /db_xref="HPRD:00947"
                     /db_xref="MIM:147558"
                     /translation="
MGIELLCLFFLFLGRNDHVQGGCALGGAETCEDCLLIGPQCAWCAQENFTHPSGVGERCDTPANLLAKGCQLNFIENPVSQVEILKNKPLSVGRQKNSSDIVQIAPQSLILKLRPGGAQTLQVHVRQTEDYPVDLYYLMDLSASMDDDLNTIKELGSRLSKEMSKLTSNFRLGFGSFVEKPVSPFVKTTPEEIANPCSSIPYFCLPTFGFKHILPLTNDAERFNEIVKNQKISANIDTPEGGFDAIMQAAVCKEKIGWRNDSLHLLVFVSDADSHFGMDSKLAGIVIPNDGLCHLDSKNEYSMSTVLEYPTIGQLIDKLVQNNVLLIFAVTQEQVHLYENYAKLIPGATVGLLQKDSGNILQLIISAYEELRSEVELEVLGDTEGLNLSFTAICNNGTLFQHQKKCSHMKVGDTASFSVTVNIPHCERRSRHIIIKPVGLGDALELLVSPECNCDCQKEVEVNSSKCHHGNGSFQCGVCACHPGHMGPRCECGEDMLSTDSCKEAPDHPSCSGRGDCYCGQCICHLSPYGNIYGPYCQCDNFSCVRHKGLLCGGNGDCDCGECVCRSGWTGEYCNCTTSTDSCVSEDGVLCSGRGDCVCGKCVCTNPGASGPTCERCPTCGDPCNSKRSCIECHLSAAGQAREECVDKCKLAGATISEEEDFSKDGSVSCSLQGENECLITFLITTDNEGKTIIHSINEKDCPKPPNIPMIMLGVSLAILLIGVVLLCIWKLLVSFHDRKEVAKFEAERSKAKWQTGTNPLYRGSTSTFKNVTYKHREKQKVDLSTDC
"
     sig_peptide     17..79
                     /gene="ITGB6"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     mat_peptide     80..2380
                     /gene="ITGB6"
                     /product="Integrin beta-6"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P18564.2)"
     misc_feature    104..1378
                     /gene="ITGB6"
                     /note="Integrin, beta chain; Region: Integrin_beta;
                     pfam00362"
                     /db_xref="CDD:201181"
     misc_feature    1382..1873
                     /gene="ITGB6"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P18564.2);
                     Region: Cysteine-rich tandem repeats"
     misc_feature    1886..2137
                     /gene="ITGB6"
                     /note="Integrin beta tail domain; Region: Integrin_B_tail;
                     pfam07965"
                     /db_xref="CDD:149183"
     misc_feature    2144..2206
                     /gene="ITGB6"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P18564.2);
                     transmembrane region"
     misc_feature    2207..2344
                     /gene="ITGB6"
                     /note="Integrin beta cytoplasmic domain; Region:
                     Integrin_b_cyt; pfam08725"
                     /db_xref="CDD:149701"
     misc_feature    2207..2290
                     /gene="ITGB6"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P18564.2);
                     Region: Interaction with HAX1"
     variation       complement(23)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:142866134"
     variation       complement(25)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139568469"
     variation       complement(49)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373761580"
     variation       complement(56)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370341448"
     variation       complement(60)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188990572"
     variation       complement(62)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:144155990"
     variation       complement(70)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149306240"
     exon            78..157
                     /gene="ITGB6"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(141)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150547491"
     exon            158..362
                     /gene="ITGB6"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(166)
                     /gene="ITGB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201087444"
     variation       complement(172)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202016962"
     variation       complement(183)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143336326"
     variation       complement(184)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199924562"
     variation       complement(208)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139380804"
     variation       complement(209)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369726068"
     variation       complement(241)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370588403"
     variation       complement(286)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367963732"
     variation       complement(287)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374377727"
     variation       complement(290)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200784593"
     variation       complement(306)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375627531"
     variation       complement(330)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61758143"
     variation       complement(331)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140575384"
     variation       complement(345)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371257499"
     exon            363..609
                     /gene="ITGB6"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(397)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143559183"
     variation       complement(404)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373385870"
     variation       complement(411)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369275471"
     variation       complement(412)
                     /gene="ITGB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201700153"
     STS             433..1342
                     /gene="ITGB6"
                     /standard_name="Itgb6"
                     /db_xref="UniSTS:507377"
     variation       complement(443)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140015315"
     variation       complement(457)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61758144"
     variation       complement(484)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143995509"
     variation       complement(502)
                     /gene="ITGB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147372514"
     variation       complement(529)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377415826"
     variation       complement(533)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373088517"
     variation       complement(543)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369951064"
     variation       complement(560)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142717768"
     variation       complement(572)
                     /gene="ITGB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375472275"
     variation       complement(608)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372144143"
     exon            610..775
                     /gene="ITGB6"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(620)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374721403"
     variation       complement(625)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372264340"
     variation       complement(646)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367990097"
     variation       complement(661)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141975569"
     variation       complement(687)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373488084"
     variation       complement(733)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61737769"
     variation       complement(734)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140624114"
     variation       complement(751)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140101986"
     variation       complement(758)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369609347"
     exon            776..937
                     /gene="ITGB6"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(791)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149747755"
     variation       complement(799)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2305818"
     variation       complement(815)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139649173"
     variation       complement(835)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:61737770"
     variation       complement(860)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143852527"
     variation       complement(887)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144253582"
     variation       complement(903)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188645370"
     variation       complement(932)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371374688"
     exon            938..1033
                     /gene="ITGB6"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(958)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376927196"
     variation       complement(985)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138313490"
     variation       complement(1000)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376000676"
     variation       complement(1006)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188012212"
     variation       complement(1014)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142185271"
     exon            1034..1123
                     /gene="ITGB6"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1035)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:113506485"
     variation       complement(1040)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140967203"
     variation       complement(1046)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148922939"
     variation       complement(1087)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377379137"
     variation       complement(1120)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373093213"
     exon            1124..1258
                     /gene="ITGB6"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1136)
                     /gene="ITGB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:181269473"
     variation       complement(1162)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372093084"
     variation       complement(1183)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201712748"
     variation       complement(1191)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374723421"
     variation       complement(1204)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147650138"
     variation       complement(1236)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147811874"
     exon            1259..1676
                     /gene="ITGB6"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1270)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144315908"
     variation       complement(1273)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1156821"
     variation       complement(1280)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201585236"
     variation       complement(1315)
                     /gene="ITGB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61748239"
     variation       complement(1325)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2305820"
     variation       complement(1328)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61737764"
     variation       complement(1365)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368470620"
     variation       complement(1378)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371228674"
     variation       complement(1379)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201552904"
     variation       complement(1385)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200295975"
     variation       complement(1405)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41264219"
     variation       complement(1421)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:142197545"
     variation       complement(1423)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376134860"
     variation       complement(1424)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55841905"
     variation       complement(1425)
                     /gene="ITGB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148881693"
     variation       complement(1429)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146684598"
     variation       complement(1440)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373568907"
     variation       complement(1472)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147011033"
     variation       1476
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193920975"
     variation       complement(1478)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147828856"
     variation       complement(1482)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369831997"
     variation       complement(1496)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374801905"
     variation       complement(1507)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201873845"
     variation       complement(1509)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372571486"
     variation       complement(1553)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199564092"
     variation       complement(1561)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201630297"
     variation       complement(1593)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184765465"
     variation       complement(1611)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376026402"
     variation       complement(1648)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61737765"
     variation       complement(1649)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144967638"
     variation       complement(1663)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192649370"
     variation       complement(1667)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144680666"
     variation       complement(1672)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139038668"
     variation       complement(1673)
                     /gene="ITGB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188076755"
     exon            1677..1899
                     /gene="ITGB6"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1685)
                     /gene="ITGB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143914557"
     variation       complement(1690)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199737317"
     variation       complement(1729)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2305819"
     variation       complement(1730)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144758639"
     variation       complement(1744)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368487211"
     variation       complement(1756)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201047218"
     variation       complement(1793)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200492977"
     variation       complement(1863)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144493660"
     variation       complement(1898)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202195621"
     exon            1900..1997
                     /gene="ITGB6"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1908)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370714170"
     variation       complement(1916)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142919023"
     variation       complement(1917)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150163379"
     variation       complement(1926)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376329044"
     variation       complement(1937)
                     /gene="ITGB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200972517"
     variation       complement(1940)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61737767"
     variation       complement(1941)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200145370"
     variation       complement(1977)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150971153"
     variation       complement(1978)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201818641"
     exon            1998..2117
                     /gene="ITGB6"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(2018)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376470109"
     variation       complement(2036)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200660753"
     variation       complement(2074)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199673949"
     variation       complement(2080)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:16844790"
     variation       complement(2096)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139804091"
     variation       complement(2098)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373773195"
     exon            2118..2284
                     /gene="ITGB6"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(2124)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369122182"
     variation       complement(2135)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377135299"
     variation       complement(2147)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372646338"
     variation       complement(2151)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367865998"
     variation       complement(2186)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146397669"
     variation       complement(2216)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374327754"
     variation       complement(2251)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370595727"
     variation       complement(2261)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199651918"
     variation       complement(2283)
                     /gene="ITGB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150867142"
     exon            2285..2397
                     /gene="ITGB6"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(2287)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202190549"
     variation       complement(2339)
                     /gene="ITGB6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201494177"
ORIGIN      
gcaagaactgaaacgaatggggattgaactgctttgcctgttctttctatttctaggaaggaatgatcacgtacaaggtggctgtgccctgggaggtgcagaaacctgtgaagactgcctgcttattggacctcagtgtgcctggtgtgctcaggagaattttactcatccatctggagttggcgaaaggtgtgataccccagcaaaccttttagctaaaggatgtcaattaaacttcatcgaaaaccctgtctcccaagtagaaatacttaaaaataagcctctcagtgtaggcagacagaaaaatagttctgacattgttcagattgcgcctcaaagcttgatccttaagttgagaccaggtggtgcgcagactctgcaggtgcatgtccgccagactgaggactacccggtggatttgtattacctcatggacctctccgcctccatggatgacgacctcaacacaataaaggagctgggctcccggctttccaaagagatgtctaaattaaccagcaactttagactgggcttcggatcttttgtggaaaaacctgtatcccctttcgtgaaaacaacaccagaagaaattgccaacccttgcagtagtattccatacttctgtttacctacatttggattcaagcacattttgccattgacaaatgatgctgaaagattcaatgaaattgtgaagaatcagaaaatttctgctaatattgacacacccgaaggtggatttgatgcaattatgcaagctgctgtgtgtaaggaaaaaattggctggcggaatgactccctccacctcctggtctttgtgagtgatgctgattctcattttggaatggacagcaaactagcaggcatcgtcattcctaatgacgggctctgtcacttggacagcaagaatgaatactccatgtcaactgtcttggaatatccaacaattggacaactcattgataaactggtacaaaacaacgtgttattgatcttcgctgtaacccaagaacaagttcatttatatgagaattacgcaaaacttattcctggagctacagtaggtctacttcagaaggactccggaaacattctccagctgatcatctcagcttatgaagaactgcggtctgaggtggaactggaagtattaggagacactgaaggactcaacttgtcatttacagccatctgtaacaacggtaccctcttccaacaccaaaagaaatgctctcacatgaaagtgggagacacagcttccttcagcgtgactgtgaatatcccacactgcgagagaagaagcaggcacattatcataaagcctgtggggctgggggatgccctggaattacttgtcagcccagaatgcaactgcgactgtcagaaagaagtggaagtgaacagctccaaatgtcaccacgggaacggctctttccagtgtggggtgtgtgcctgccaccctggccacatggggcctcgctgtgagtgtggcgaggacatgctgagcacagattcctgcaaggaggccccagatcatccctcctgcagcggaaggggtgactgctactgtgggcagtgtatctgccacttgtctccctatggaaacatttatgggccttattgccagtgtgacaatttctcctgcgtgagacacaaagggctgctctgcggaggtaacggcgactgtgactgtggtgaatgtgtgtgcaggagcggctggactggcgagtactgcaactgcaccaccagcacggactcctgcgtctctgaagatggagtgctctgcagcgggcgcggggactgtgtttgtggcaagtgtgtttgcacaaaccctggagcctcaggaccaacctgtgaacgatgtcctacctgtggtgacccctgtaactctaaacggagctgcattgagtgccacctgtcagcagctggccaagcccgagaagaatgtgtggacaagtgcaaactagctggtgcgaccatcagtgaagaagaagatttctcaaaggatggttctgtttcctgctctctgcaaggagaaaatgaatgtcttattacattcctaataactacagataatgaggggaaaaccatcattcacagcatcaatgaaaaagattgtccgaagcctccaaacattcccatgatcatgttaggggtttccctggctattcttctcatcggggttgtcctactgtgcatctggaagctactggtgtcatttcatgatcgtaaagaagttgccaaatttgaagcagaacgatcaaaagccaagtggcaaacgggaaccaatccactctacagaggatccacaagtacttttaaaaatgtaacttataaacacagggaaaaacaaaaggtagacctttccacagattgctagaactactttatgca
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:3694 -> Molecular function: GO:0004872 [receptor activity] evidence: IEA
            GeneID:3694 -> Molecular function: GO:0005178 [integrin binding] evidence: IEA
            GeneID:3694 -> Biological process: GO:0006954 [inflammatory response] evidence: IEA
            GeneID:3694 -> Biological process: GO:0007155 [cell adhesion] evidence: TAS
            GeneID:3694 -> Biological process: GO:0007160 [cell-matrix adhesion] evidence: IEA
            GeneID:3694 -> Biological process: GO:0007229 [integrin-mediated signaling pathway] evidence: IEA
            GeneID:3694 -> Biological process: GO:0007275 [multicellular organismal development] evidence: IEA
            GeneID:3694 -> Biological process: GO:0019048 [modulation by virus of host morphology or physiology] evidence: IEA
            GeneID:3694 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS
            GeneID:3694 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
            GeneID:3694 -> Cellular component: GO:0008305 [integrin complex] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.