2024-04-20 07:47:06, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_000783 2119 bp mRNA linear PRI 15-JUN-2013 DEFINITION Homo sapiens cytochrome P450, family 26, subfamily A, polypeptide 1 (CYP26A1), transcript variant 1, mRNA. ACCESSION NM_000783 VERSION NM_000783.3 GI:189339189 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2119) AUTHORS Verhoeven,V.J., Hysi,P.G., Wojciechowski,R., Fan,Q., Guggenheim,J.A., Hohn,R., MacGregor,S., Hewitt,A.W., Nag,A., Cheng,C.Y., Yonova-Doing,E., Zhou,X., Ikram,M.K., Buitendijk,G.H., McMahon,G., Kemp,J.P., Pourcain,B.S., Simpson,C.L., Makela,K.M., Lehtimaki,T., Kahonen,M., Paterson,A.D., Hosseini,S.M., Wong,H.S., Xu,L., Jonas,J.B., Parssinen,O., Wedenoja,J., Yip,S.P., Ho,D.W., Pang,C.P., Chen,L.J., Burdon,K.P., Craig,J.E., Klein,B.E., Klein,R., Haller,T., Metspalu,A., Khor,C.C., Tai,E.S., Aung,T., Vithana,E., Tay,W.T., Barathi,V.A., Chen,P., Li,R., Liao,J., Zheng,Y., Ong,R.T., Doring,A., Evans,D.M., Timpson,N.J., Verkerk,A.J., Meitinger,T., Raitakari,O., Hawthorne,F., Spector,T.D., Karssen,L.C., Pirastu,M., Murgia,F., Ang,W., Mishra,A., Montgomery,G.W., Pennell,C.E., Cumberland,P.M., Cotlarciuc,I., Mitchell,P., Wang,J.J., Schache,M., Janmahasathian,S., Igo,R.P. Jr., Lass,J.H., Chew,E., Iyengar,S.K., Gorgels,T.G., Rudan,I., Hayward,C., Wright,A.F., Polasek,O., Vatavuk,Z., Wilson,J.F., Fleck,B., Zeller,T., Mirshahi,A., Muller,C., Uitterlinden,A.G., Rivadeneira,F., Vingerling,J.R., Hofman,A., Oostra,B.A., Amin,N., Bergen,A.A., Teo,Y.Y., Rahi,J.S., Vitart,V., Williams,C., Baird,P.N., Wong,T.Y., Oexle,K., Pfeiffer,N., Mackey,D.A., Young,T.L., van Duijn,C.M., Saw,S.M., Bailey-Wilson,J.E., Stambolian,D., Klaver,C.C. and Hammond,C.J. CONSRTM Consortium for Refractive Error and Myopia (CREAM); Diabetes Control and Complications Trial/Epidemiology of Diabetes Interventions and Complications (DCCT/EDIC) Research Group; Wellcome Trust Case Control Consortium 2 (WTCCC2); Fuchs' Genetics Multi-Center Study Group TITLE Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia JOURNAL Nat. Genet. 45 (3), 314-318 (2013) PUBMED 23396134 REFERENCE 2 (bases 1 to 2119) AUTHORS Topletz,A.R., Thatcher,J.E., Zelter,A., Lutz,J.D., Tay,S., Nelson,W.L. and Isoherranen,N. TITLE Comparison of the function and expression of CYP26A1 and CYP26B1, the two retinoic acid hydroxylases JOURNAL Biochem. Pharmacol. 83 (1), 149-163 (2012) PUBMED 22020119 REMARK GeneRIF: CYP26A1 and CYP26B1 are qualitatively similar retinoic acid hydroxylases with overlapping expression profiles; CYP26A1 has higher catalytic activity than CYP26B1. REFERENCE 3 (bases 1 to 2119) AUTHORS Osanai,M. and Lee,G.H. TITLE Enhanced expression of retinoic acid-metabolizing enzyme CYP26A1 in sunlight-damaged human skin JOURNAL Med Mol Morphol 44 (4), 200-206 (2011) PUBMED 22179182 REMARK GeneRIF: Our observation suggests an involvement of enhanced CYP26A1 expression causing a functional vitamin A deficieny state in skin that can potentially lead to neoplastic transformation of keratinocytes in an early phase during skin carcinogenesis REFERENCE 4 (bases 1 to 2119) AUTHORS Pascual,M., Suzuki,M., Isidoro-Garcia,M., Padron,J., Turner,T., Lorente,F., Davila,I. and Greally,J.M. TITLE Epigenetic changes in B lymphocytes associated with house dust mite allergic asthma JOURNAL Epigenetics 6 (9), 1131-1137 (2011) PUBMED 21975512 REMARK GeneRIF: The promoter region of CYP26A1 is significantly hypermethylated in allergic asthmatic subjects. REFERENCE 5 (bases 1 to 2119) AUTHORS Meire,F., Delpierre,I., Brachet,C., Roulez,F., Van Nechel,C., Depasse,F., Christophe,C., Menten,B. and De Baere,E. TITLE Nonsyndromic bilateral and unilateral optic nerve aplasia: first familial occurrence and potential implication of CYP26A1 and CYP26C1 genes JOURNAL Mol. Vis. 17, 2072-2079 (2011) PUBMED 21850183 REMARK GeneRIF: CYP26A1 and CYP26C1 play a pivotal role in the pathogenesis of nonsyndromic bilateral and unilateral optic nerve aplasia. REFERENCE 6 (bases 1 to 2119) AUTHORS Nelson,D.R., Zeldin,D.C., Hoffman,S.M., Maltais,L.J., Wain,H.M. and Nebert,D.W. TITLE Comparison of cytochrome P450 (CYP) genes from the mouse and human genomes, including nomenclature recommendations for genes, pseudogenes and alternative-splice variants JOURNAL Pharmacogenetics 14 (1), 1-18 (2004) PUBMED 15128046 REMARK Review article REFERENCE 7 (bases 1 to 2119) AUTHORS White,J.A., Beckett,B., Scherer,S.W., Herbrick,J.A. and Petkovich,M. TITLE P450RAI (CYP26A1) maps to human chromosome 10q23-q24 and mouse chromosome 19C2-3 JOURNAL Genomics 48 (2), 270-272 (1998) PUBMED 9521883 REFERENCE 8 (bases 1 to 2119) AUTHORS Ray,W.J., Bain,G., Yao,M. and Gottlieb,D.I. TITLE CYP26, a novel mammalian cytochrome P450, is induced by retinoic acid and defines a new family JOURNAL J. Biol. Chem. 272 (30), 18702-18708 (1997) PUBMED 9228041 REFERENCE 9 (bases 1 to 2119) AUTHORS White,J.A., Beckett-Jones,B., Guo,Y.D., Dilworth,F.J., Bonasoro,J., Jones,G. and Petkovich,M. TITLE cDNA cloning of human retinoic acid-metabolizing enzyme (hP450RAI) identifies a novel family of cytochromes P450 JOURNAL J. Biol. Chem. 272 (30), 18538-18541 (1997) PUBMED 9228017 REFERENCE 10 (bases 1 to 2119) AUTHORS Duell,E.A., Kang,S. and Voorhees,J.J. TITLE Retinoic acid isomers applied to human skin in vivo each induce a 4-hydroxylase that inactivates only trans retinoic acid JOURNAL J. Invest. Dermatol. 106 (2), 316-320 (1996) PUBMED 8601734 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL358613.16. This sequence is a reference standard in the RefSeqGene project. On Jun 4, 2008 this sequence version replaced gi:16933529. Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein acts on retinoids, including all-trans-retinoic acid (RA), with both 4-hydroxylation and 18-hydroxylation activities. This enzyme regulates the cellular level of retinoic acid which is involved in regulation of gene expression in both embryonic and adult tissues. Two alternatively spliced transcript variants of this gene, which encode the distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (1) encodes the longer protein (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK075374.1, AF005418.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025082, ERS025084 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-234 AL358613.16 23522-23755 235-459 AL358613.16 23940-24164 460-750 AL358613.16 24411-24701 751-909 AL358613.16 24781-24939 910-1044 AL358613.16 25458-25592 1045-1197 AL358613.16 26176-26328 1198-2119 AL358613.16 26595-27516 FEATURES Location/Qualifiers source 1..2119 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="10" /map="10q23-q24" gene 1..2119 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /note="cytochrome P450, family 26, subfamily A, polypeptide 1" /db_xref="GeneID:1592" /db_xref="HGNC:2603" /db_xref="HPRD:03759" /db_xref="MIM:602239" exon 1..234 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /inference="alignment:Splign:1.39.8" variation 10 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="g" /replace="t" /db_xref="dbSNP:376312987" STS 21..1589 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /db_xref="UniSTS:481151" variation 42 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:374478271" CDS 46..1539 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /EC_number="1.14.-.-" /note="isoform 1 is encoded by transcript variant 1; P450, retinoic acid-inactivating, 1; retinoic acid-metabolizing cytochrome; retinoic acid 4-hydroxylase; cytochrome P450, subfamily XXVIA, polypeptide 1; cytochrome P450 26A1; hP450RAI; cytochrome P450RAI; cytochrome P450 retinoic acid-inactivating 1" /codon_start=1 /product="cytochrome P450 26A1 isoform 1" /protein_id="NP_000774.2" /db_xref="GI:16933530" /db_xref="CCDS:CCDS7426.1" /db_xref="GeneID:1592" /db_xref="HGNC:2603" /db_xref="HPRD:03759" /db_xref="MIM:602239" /translation="
MGLPALLASALCTFVLPLLLFLAAIKLWDLYCVSGRDRSCALPLPPGTMGFPFFGETLQMVLQRRKFLQMKRRKYGFIYKTHLFGRPTVRVMGADNVRRILLGEHRLVSVHWPASVRTILGSGCLSNLHDSSHKQRKKVIMRAFSREALECYVPVITEEVGSSLEQWLSCGERGLLVYPEVKRLMFRIAMRILLGCEPQLAGDGDSEQQLVEAFEEMTRNLFSLPIDVPFSGLYRGMKARNLIHARIEQNIRAKICGLRASEAGQGCKDALQLLIEHSWERGERLDMQALKQSSTELLFGGHETTASAATSLITYLGLYPHVLQKVREELKSKGLLCKSNQDNKLDMEILEQLKYIGCVIKETLRLNPPVPGGFRVALKTFELNGYQIPKGWNVIYSICDTHDVAEIFTNKEEFNPDRFMLPHPEDASRFSFIPFGGGLRSCVGKEFAKILLKIFTVELARHCDWQLLNGPPTMKTSPTVYPVDNLPARFTHFHGEI
" misc_feature 172..1518 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /note="Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; cl12078" /db_xref="CDD:212625" misc_feature 178..1455 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /note="Cytochrome P450; Region: p450; pfam00067" /db_xref="CDD:200971" misc_feature 1369..1371 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /note="heme binding site" variation 72 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="g" /replace="t" /db_xref="dbSNP:368711839" variation 117 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="g" /replace="t" /db_xref="dbSNP:151313962" variation 138 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:375080816" variation 157 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="c" /db_xref="dbSNP:367989867" variation 183 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:372180164" exon 235..459 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /inference="alignment:Splign:1.39.8" variation 252 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:376312852" variation 267 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:140561960" variation 336 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="g" /replace="t" /db_xref="dbSNP:182251373" variation 368 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="g" /replace="t" /db_xref="dbSNP:199888287" variation 414 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:150026228" variation 447 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:145329305" variation 452 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:140932042" exon 460..750 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /inference="alignment:Splign:1.39.8" variation 477 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:60549655" variation 492 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="g" /db_xref="dbSNP:35355587" variation 502 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:140213678" variation 519 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:143605675" variation 523 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:374370768" variation 533 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:73319394" variation 536 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="t" /db_xref="dbSNP:148053802" variation 540 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:141743098" variation 545 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:150571738" variation 556 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:138806671" variation 558 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="c" /db_xref="dbSNP:143939065" variation 562 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="c" /db_xref="dbSNP:61735552" variation 592 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:368680474" variation 593 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:200654050" variation 594 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="c" /db_xref="dbSNP:199767327" variation 609 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="c" /db_xref="dbSNP:372113028" variation 624 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:140717057" variation 641 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="c" /db_xref="dbSNP:75690427" variation 658 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:371233600" variation 676 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="g" /replace="t" /db_xref="dbSNP:149343022" variation 698 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:374294057" exon 751..909 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /inference="alignment:Splign:1.39.8" variation 751 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:79622881" variation 754 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:368110826" variation 762 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:200805136" variation 787 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="g" /db_xref="dbSNP:200516628" variation 791 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:367762887" variation 796 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:370074492" variation 834 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:367860330" variation 835 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:144846699" variation 888 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:201685188" variation 905 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="t" /db_xref="dbSNP:56956463" exon 910..1044 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /inference="alignment:Splign:1.39.8" variation 958 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:74435030" variation 959 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:142962735" variation 1027 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:369951759" exon 1045..1197 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /inference="alignment:Splign:1.39.8" variation 1072 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="t" /db_xref="dbSNP:376570347" variation 1117 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:146619916" variation 1146 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="t" /db_xref="dbSNP:370584989" variation 1147 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="c" /db_xref="dbSNP:140125959" variation 1150 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:377406709" variation 1171 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:370744399" variation 1176 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:374596674" variation 1179 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:35768328" variation 1189 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="g" /db_xref="dbSNP:202094176" exon 1198..2119 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /inference="alignment:Splign:1.39.8" variation 1228 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:200904706" variation 1236 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:73319400" variation 1253 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:200246602" variation 1281 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:202120226" variation 1353 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="t" /db_xref="dbSNP:186901298" variation 1359 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="g" /db_xref="dbSNP:2229104" variation 1367 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:140117559" variation 1374 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:144194304" variation 1375 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:371966523" variation 1420 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:146552397" variation 1488 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:375225582" variation 1535 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:200820945" polyA_signal 1710..1715 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" variation 1725 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:192234280" polyA_site 1730 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" variation 1732..1733 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="" /replace="t" /db_xref="dbSNP:34739947" variation 1732 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="g" /db_xref="dbSNP:184072831" variation 1949 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:4917998" variation 1965 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:187859329" variation 2011 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="c" /db_xref="dbSNP:149158167" variation 2055 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:41290188" polyA_signal 2099..2104 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" polyA_site 2107 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" ORIGIN
agcgctggcggcggcggcaggtggcgcgggaggtcgcggcgcgccatggggctcccggcgctgctggccagtgcgctctgcaccttcgtgctgccgctgctgctcttcctggctgcgatcaagctctgggacctgtactgcgtgagcggccgcgaccgcagttgtgccctcccattgccccccgggactatgggcttccccttctttggggaaaccttgcagatggtactgcagcggaggaagttcctgcagatgaagcgcaggaaatacggcttcatctacaagacgcatctgttcgggcggcccaccgtacgggtgatgggcgcggacaatgtgcggcgcatcttgctcggagagcaccggctggtgtcggtccactggccagcgtcggtgcgcaccattctgggatctggctgcctctctaacctgcacgactcctcgcacaagcagcgcaagaaggtgattatgcgggccttcagccgcgaggcactcgaatgctacgtgccggtgatcaccgaggaagtgggcagcagcctggagcagtggctgagctgcggcgagcgcggcctcctggtctaccccgaggtgaagcgcctcatgttccgaatcgccatgcgcatcctactgggctgcgaaccccaactggcgggcgacggggactccgagcagcagcttgtggaggccttcgaggaaatgacccgcaatctcttctcgctgcccatcgacgtgcccttcagcgggctgtaccggggcatgaaggcgcggaacctcattcacgcgcgcatcgagcagaacattcgcgccaagatctgcgggctgcgggcatccgaggcgggccagggctgcaaagacgcgctgcagctgttgatcgagcactcgtgggagaggggagagcggctggacatgcaggcactaaagcaatcttcaaccgaactcctctttggaggacacgaaaccacggccagtgcagccacatctctgatcacttacctggggctctacccacatgttctccagaaagtgcgagaagagctgaagagtaagggtttactttgcaagagcaatcaagacaacaagttggacatggaaattttggaacaacttaaatacatcgggtgtgttattaaggagacccttcgactgaatcccccagttccaggagggtttcgggttgctctgaagacttttgaattaaatggataccagattcccaagggctggaatgttatctacagtatctgtgatactcatgatgtggcagagatcttcaccaacaaggaagaatttaatcctgaccgattcatgctgcctcacccagaggatgcatccaggttcagcttcattccatttggaggaggccttaggagctgtgtaggcaaagaatttgcaaaaattcttctcaaaatatttacagtggagctggccaggcattgtgactggcagcttctaaatggacctcctacaatgaaaaccagtcccaccgtgtatcctgtggacaatctccctgcaagattcacccatttccatggggaaatctgatgagcttgaatgttcaaacctgagacttattggaagtgtacatatgagtttttaaggagtgttgtgttgactttatatttaatttctaaatgtatattataatatttatgtgttttgactatactaccacaatctttaaatattaaaataatgaatttgtatcatttccaaataaagtaaaatttgaaggtacttttctggtattttaagattcctgttgggtaaaactcaccagtttagtattttcttagtgtatttaaccagattttacaatgcctacctggacttatttgtcatctttgcatctgttttctgtgagaagaaatcttagctgttttttatgttaacagttattagaaaatatatgtctgtgtgtgttattccagacgtatctctgtaaattcttctacagtcacttagattccctatttggaaaattgatccaagttaatttaatttttttttggtttgctgtactttagggaaagatgaacctgaaaaggtaacactgagaactgtcactctaacctctccagcttatctaacatgtcataaacataataaatctgtgttgtccaat
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:1592 -> Molecular function: GO:0001972 [retinoic acid binding] evidence: IDA GeneID:1592 -> Molecular function: GO:0005506 [iron ion binding] evidence: IEA GeneID:1592 -> Molecular function: GO:0008401 [retinoic acid 4-hydroxylase activity] evidence: IDA GeneID:1592 -> Molecular function: GO:0009055 [electron carrier activity] evidence: IEA GeneID:1592 -> Molecular function: GO:0019825 [oxygen binding] evidence: TAS GeneID:1592 -> Molecular function: GO:0020037 [heme binding] evidence: NAS GeneID:1592 -> Biological process: GO:0006766 [vitamin metabolic process] evidence: TAS GeneID:1592 -> Biological process: GO:0006805 [xenobiotic metabolic process] evidence: TAS GeneID:1592 -> Biological process: GO:0007417 [central nervous system development] evidence: IEA GeneID:1592 -> Biological process: GO:0008152 [metabolic process] evidence: TAS GeneID:1592 -> Biological process: GO:0009952 [anterior/posterior pattern specification] evidence: IEA GeneID:1592 -> Biological process: GO:0014032 [neural crest cell development] evidence: IEA GeneID:1592 -> Biological process: GO:0034653 [retinoic acid catabolic process] evidence: IDA GeneID:1592 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS GeneID:1592 -> Biological process: GO:0048384 [retinoic acid receptor signaling pathway] evidence: IEA GeneID:1592 -> Biological process: GO:0048387 [negative regulation of retinoic acid receptor signaling pathway] evidence: TAS GeneID:1592 -> Biological process: GO:0071300 [cellular response to retinoic acid] evidence: IEA GeneID:1592 -> Cellular component: GO:0005789 [endoplasmic reticulum membrane] evidence: TAS ANNOTATIONS from NCBI Entrez Gene (20130726): NP_000774 -> EC 1.14.-.-
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.