Home |
Help |
Advanced search
2024-04-19 13:20:45, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_000696 2500 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens aldehyde dehydrogenase 9 family, member A1 (ALDH9A1),
mRNA.
ACCESSION NM_000696
VERSION NM_000696.3 GI:115387103
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2500)
AUTHORS Hendrickson,S.L., Lautenberger,J.A., Chinn,L.W., Malasky,M.,
Sezgin,E., Kingsley,L.A., Goedert,J.J., Kirk,G.D., Gomperts,E.D.,
Buchbinder,S.P., Troyer,J.L. and O'Brien,S.J.
TITLE Genetic variants in nuclear-encoded mitochondrial genes influence
AIDS progression
JOURNAL PLoS ONE 5 (9), E12862 (2010)
PUBMED 20877624
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 2500)
AUTHORS Ehret,G.B., O'Connor,A.A., Weder,A., Cooper,R.S. and Chakravarti,A.
TITLE Follow-up of a major linkage peak on chromosome 1 reveals
suggestive QTLs associated with essential hypertension: GenNet
study
JOURNAL Eur. J. Hum. Genet. 17 (12), 1650-1657 (2009)
PUBMED 19536175
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 3 (bases 1 to 2500)
AUTHORS Saito,A., Kawamoto,M. and Kamatani,N.
TITLE Association study between single-nucleotide polymorphisms in 199
drug-related genes and commonly measured quantitative traits of 752
healthy Japanese subjects
JOURNAL J. Hum. Genet. 54 (6), 317-323 (2009)
PUBMED 19343046
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 4 (bases 1 to 2500)
AUTHORS Cheung,C.L., Chan,B.Y., Chan,V., Ikegawa,S., Kou,I., Ngai,H.,
Smith,D., Luk,K.D., Huang,Q.Y., Mori,S., Sham,P.C. and Kung,A.W.
TITLE Pre-B-cell leukemia homeobox 1 (PBX1) shows functional and possible
genetic association with bone mineral density variation
JOURNAL Hum. Mol. Genet. 18 (4), 679-687 (2009)
PUBMED 19064610
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 5 (bases 1 to 2500)
AUTHORS Inada,T., Koga,M., Ishiguro,H., Horiuchi,Y., Syu,A., Yoshio,T.,
Takahashi,N., Ozaki,N. and Arinami,T.
TITLE Pathway-based association analysis of genome-wide screening data
suggest that genes associated with the gamma-aminobutyric acid
receptor signaling pathway are involved in neuroleptic-induced,
treatment-resistant tardive dyskinesia
JOURNAL Pharmacogenet. Genomics 18 (4), 317-323 (2008)
PUBMED 18334916
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 6 (bases 1 to 2500)
AUTHORS Lin,S.W., Chen,J.C., Hsu,L.C., Hsieh,C.L. and Yoshida,A.
TITLE Human gamma-aminobutyraldehyde dehydrogenase (ALDH9): cDNA
sequence, genomic organization, polymorphism, chromosomal
localization, and tissue expression
JOURNAL Genomics 34 (3), 376-380 (1996)
PUBMED 8786138
REFERENCE 7 (bases 1 to 2500)
AUTHORS Kikonyogo,A. and Pietruszko,R.
TITLE Aldehyde dehydrogenase from adult human brain that dehydrogenates
gamma-aminobutyraldehyde: purification, characterization, cloning
and distribution
JOURNAL Biochem. J. 316 (PT 1), 317-324 (1996)
PUBMED 8645224
REFERENCE 8 (bases 1 to 2500)
AUTHORS McPherson,J.D., Wasmuth,J.J., Kurys,G. and Pietruszko,R.
TITLE Human aldehyde dehydrogenase: chromosomal assignment of the gene
for the isozyme that metabolizes gamma-aminobutyraldehyde
JOURNAL Hum. Genet. 93 (2), 211-212 (1994)
PUBMED 8112751
REFERENCE 9 (bases 1 to 2500)
AUTHORS Kurys,G., Shah,P.C., Kikonygo,A., Reed,D., Ambroziak,W. and
Pietruszko,R.
TITLE Human aldehyde dehydrogenase. cDNA cloning and primary structure of
the enzyme that catalyzes dehydrogenation of 4-aminobutyraldehyde
JOURNAL Eur. J. Biochem. 218 (2), 311-320 (1993)
PUBMED 8269919
REFERENCE 10 (bases 1 to 2500)
AUTHORS Kurys,G., Ambroziak,W. and Pietruszko,R.
TITLE Human aldehyde dehydrogenase. Purification and characterization of
a third isozyme with low Km for gamma-aminobutyraldehyde
JOURNAL J. Biol. Chem. 264 (8), 4715-4721 (1989)
PUBMED 2925663
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AL451074.13 and AF172093.1.
This sequence is a reference standard in the RefSeqGene project.
On Sep 28, 2006 this sequence version replaced gi:25777738.
Summary: This protein belongs to the aldehyde dehydrogenase family
of proteins. It has a high activity for oxidation of
gamma-aminobutyraldehyde and other amino aldehydes. The enzyme
catalyzes the dehydrogenation of gamma-aminobutyraldehyde to
gamma-aminobutyric acid (GABA). This isozyme is a tetramer of
identical 54-kD subunits. [provided by RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC070030.1, U34252.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-177 AL451074.13 51414-51590 c
178-1662 AF172093.1 1-1485
1663-2500 AL451074.13 15139-15976 c
FEATURES Location/Qualifiers
source 1..2500
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1q23.1"
gene 1..2500
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/note="aldehyde dehydrogenase 9 family, member A1"
/db_xref="GeneID:223"
/db_xref="HGNC:412"
/db_xref="MIM:602733"
exon 1..286
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/inference="alignment:Splign:1.39.8"
CDS 106..1662
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/EC_number="1.2.1.3"
/EC_number="1.2.1.19"
/EC_number="1.2.1.47"
/note="gamma-aminobutyraldehyde dehydrogenase; aldehyde
dehydrogenase E3 isozyme; aldehyde dehydrogenase (NAD+);
R-aminobutyraldehyde dehydrogenase; aldehyde dehydrogenase
family 9 member A1"
/codon_start=1
/product="4-trimethylaminobutyraldehyde dehydrogenase"
/protein_id="NP_000687.3"
/db_xref="GI:115387104"
/db_xref="CCDS:CCDS1250.2"
/db_xref="GeneID:223"
/db_xref="HGNC:412"
/db_xref="MIM:602733"
/translation="
MFLRAGLAALSPLLRSLRPSPVAAMSTGTFVVSQPLNYRGGARVEPADASGTEKAFEPATGRVIATFTCSGEKEVNLAVQNAKAAFKIWSQKSGMERCRILLEAARIIREREDEIATMECINNGKSIFEARLDIDISWQCLEYYAGLAASMAGEHIQLPGGSFGYTRREPLGVCVGIGAWNYPFQIASWKSAPALACGNAMVFKPSPFTPVSALLLAEIYSEAGVPPGLFNVVQGGAATGQFLCQHPDVAKVSFTGSVPTGMKIMEMSAKGIKPVTLELGGKSPLIIFSDCDMNNAVKGALMANFLTQGQVCCNGTRVFVQKEILDKFTEEVVKQTQRIKIGDPLLEDTRMGPLINRPHLERVLGFVKVAKEQGAKVLCGGDIYVPEDPKLKDGYYMRPCVLTNCRDDMTCVKEEIFGPVMSILSFDTEAEVLERANDTTFGLAAGVFTRDIQRAHRVVAELQAGTCFINNYNVSPVELPFGGYKKSGFGRENGRVTIEYYSQLKTVCVEMGDVESAF
"
misc_feature 202..1659
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/note="betaine aldehyde dehydrogenase; Provisional;
Region: PRK13252"
/db_xref="CDD:183918"
misc_feature 268..1641
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/note="NAD+-dependent 4-trimethylaminobutyraldehyde
dehydrogenase, ALDH family 9A1; Region: ALDH_F9_TMBADH;
cd07090"
/db_xref="CDD:143409"
misc_feature order(382..384,388..390,400..402,409..411,421..423,
430..432,529..531,541..543,562..576,598..600,604..612,
889..891,922..924,988..990,997..999,1006..1011,1108..1110,
1153..1155,1453..1464,1471..1476,1480..1482,1489..1491,
1495..1506,1510..1515,1537..1539,1543..1545,1555..1557,
1561..1563,1570..1572,1576..1578,1612..1629,1633..1638)
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/note="tetrameric interface [polypeptide binding]; other
site"
/db_xref="CDD:143409"
misc_feature order(634..639,643..648,715..717,811..813,865..867,
871..876,883..885,937..945,1039..1041,1348..1350,
1354..1356,1546..1548)
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/note="NAD binding site [chemical binding]; other site"
/db_xref="CDD:143409"
misc_feature order(646..648,937..939,1030..1032,1039..1041)
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/note="catalytic residues [active]"
/db_xref="CDD:143409"
exon 287..432
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/inference="alignment:Splign:1.39.8"
exon 433..562
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/inference="alignment:Splign:1.39.8"
variation 507
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/replace="c"
/replace="t"
/db_xref="dbSNP:1143659"
exon 563..697
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/inference="alignment:Splign:1.39.8"
exon 698..894
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/inference="alignment:Splign:1.39.8"
variation 767
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/replace="c"
/replace="g"
/db_xref="dbSNP:1065756"
exon 895..1035
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/inference="alignment:Splign:1.39.8"
variation 1004
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/replace="c"
/replace="t"
/db_xref="dbSNP:1143660"
variation 1005
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/replace="a"
/replace="g"
/db_xref="dbSNP:1143661"
exon 1036..1224
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/inference="alignment:Splign:1.39.8"
STS 1125..1249
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/standard_name="WI-12686"
/db_xref="UniSTS:6667"
exon 1225..1312
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/inference="alignment:Splign:1.39.8"
exon 1313..1454
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/inference="alignment:Splign:1.39.8"
exon 1455..1567
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/inference="alignment:Splign:1.39.8"
exon 1568..2500
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/inference="alignment:Splign:1.39.8"
STS 1867..1990
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/standard_name="D1S3343"
/db_xref="UniSTS:8469"
variation 2154
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/replace=""
/replace="a"
/db_xref="dbSNP:4646902"
variation 2225
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/replace="a"
/replace="g"
/db_xref="dbSNP:9164"
variation 2279
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/replace="a"
/replace="c"
/db_xref="dbSNP:12670"
variation 2377
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/replace="a"
/replace="c"
/db_xref="dbSNP:11555775"
variation 2443
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
/replace="c"
/replace="t"
/db_xref="dbSNP:11506"
polyA_signal 2469..2474
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
polyA_signal 2474..2479
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
polyA_site 2491
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
polyA_site 2496
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
polyA_site 2500
/gene="ALDH9A1"
/gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH"
ORIGIN
ctgcccctaaaatctcctagaaccgatcccgcggccccgcccctcccgcggccccgcccctcccgcggcccgtcagcctctgccgcggagctgcgtccgccactcatgtttctccgagcaggcctggccgcgctctccccgcttcttcgcagtcttcggccctctcctgtcgccgccatgagcactggcaccttcgtcgtgtcgcagccgctcaattaccgcggcggggcccgcgtggagccggcggacgcctccggtaccgagaaagctttcgagccagcaaccggccgagtgatagctactttcacatgttcaggagaaaaggaagtaaatttggctgttcaaaatgcaaaggctgcttttaaaatatggagtcaaaaatctggcatggagcgttgccgaatccttttggaggctgccaggataataagggaacgggaggatgaaattgctactatggagtgcatcaacaatggcaagtccatctttgaggcccgcttggacattgacatttcctggcagtgcctggagtattatgcgggcttggctgcatccatggctggtgaacacatccagctcccaggtggatcgtttggttataccagaagagaaccacttggggtatgtgtgggaataggagcatggaactacccctttcagattgcctcttggaagtcggctccagcattagcctgtggtaatgccatggtctttaaaccttctccctttacacctgtttctgcattgctactggctgaaatctacagtgaggctggtgtacctcctgggctcttcaatgtggtgcagggaggggctgccacaggccagtttctgtgtcagcatcccgatgtggccaaagtctccttcactggaagtgtgcccactggcatgaagatcatggagatgtcagctaaaggaatcaaacctgttaccttggaacttggaggcaaatctccactcatcatcttctcagactgtgatatgaacaatgctgtaaagggggcgctgatggccaacttcctcacacaaggccaggtttgctgtaatggcacaagagtatttgtgcagaaagaaattcttgataaatttacagaggaagtggtgaaacagacccaaaggattaaaattggagatccccttctggaagatacaaggatgggtccactcatcaaccgaccacacctggagcgagtccttgggtttgtcaaagtggcaaaggagcagggtgctaaagtgttatgtggtggagatatatatgtacctgaagatcccaaattaaaggatggatattacatgagaccttgtgtattaactaattgcagagacgacatgacctgtgtgaaggaagagatctttgggcctgttatgtccattttatcatttgacactgaagctgaggttctagaaagagccaatgataccacttttggactagcagctggcgtctttaccagggacatccaacgggctcatagagtggtagctgagcttcaggctgggacgtgcttcattaacaactataacgtcagcccagtggagttgccctttggtggatataagaagtcaggatttggcagagagaacggccgtgtgacaatcgaatattattcacagctgaagactgtgtgtgtggagatgggtgatgtggaatctgctttttgaaaacctgcagtgaaacctattgacatggccacgctgtggaatgatgtgaattggccctgtttacagaggcagtacaactgaatgttattttacatccagaattttggcgttcagtataagagaatggttcatgttactctttctctctccatcagcttcctcactgaaaatgtgcattaagtgccttgtagatactaatcaagaaagctgtgattctcctcaaagcgtatttttgtgaaatcttttaagagccagtaacatacttctagagaacaggaaaagagactaggataatacatcttccacacatttggcccactgataatgttaattctctggcgtatttcaaagaacttgttcctggctgatccaagtgcagtggtatttacaactaattgatcacaaccagtttgtagatttctttgttccttctccattcccactgcttcacttgcctagtcttgaagaaaaaaaacaaaaaacaaaaaaaaaccttgttcctttataggttcctggtagaatcagtagagatgatttcagctcattgacatttttttaagctatatccccttgtcattccattgagaaagctgacaactgggatagggaggggattagataatagatggggtcaaattctgtgtgaatgtgaacttgcctagtaagcactttgtctctgttcactactgcgatagaggaaatctatctccctatcttgggtccttgaactacagcctgctgtcttacaccagtggagctaccctttaaatgtacaaattatttgtatgctaatgtaatatggtgaaattaaaataaatcacactgttaattgttttcc
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:223 -> Molecular function: GO:0004028 [3-chloroallyl aldehyde dehydrogenase activity] evidence: TAS
GeneID:223 -> Molecular function: GO:0004029 [aldehyde dehydrogenase (NAD) activity] evidence: IDA
GeneID:223 -> Molecular function: GO:0019145 [aminobutyraldehyde dehydrogenase activity] evidence: IDA
GeneID:223 -> Molecular function: GO:0033737 [1-pyrroline dehydrogenase activity] evidence: IEA
GeneID:223 -> Molecular function: GO:0047105 [4-trimethylammoniobutyraldehyde dehydrogenase activity] evidence: IEA
GeneID:223 -> Biological process: GO:0006081 [cellular aldehyde metabolic process] evidence: IDA
GeneID:223 -> Biological process: GO:0034641 [cellular nitrogen compound metabolic process] evidence: TAS
GeneID:223 -> Biological process: GO:0042136 [neurotransmitter biosynthetic process] evidence: IDA
GeneID:223 -> Biological process: GO:0042445 [hormone metabolic process] evidence: TAS
GeneID:223 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
GeneID:223 -> Biological process: GO:0045329 [carnitine biosynthetic process] evidence: IEA
GeneID:223 -> Biological process: GO:0045329 [carnitine biosynthetic process] evidence: TAS
GeneID:223 -> Biological process: GO:0055114 [oxidation-reduction process] evidence: IDA
GeneID:223 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:223 -> Cellular component: GO:0005737 [cytoplasm] evidence: TAS
GeneID:223 -> Cellular component: GO:0005739 [mitochondrion] evidence: IEA
GeneID:223 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:223 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_000687 -> EC 1.2.1.19
NP_000687 -> EC 1.2.1.3
NP_000687 -> EC 1.2.1.47
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.