Home |
Help |
Advanced search
2024-04-27 07:23:09, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_000598 2620 bp mRNA linear PRI 15-JUL-2013
DEFINITION Homo sapiens insulin-like growth factor binding protein 3 (IGFBP3),
transcript variant 2, mRNA.
ACCESSION NM_000598
VERSION NM_000598.4 GI:62243067
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2620)
AUTHORS Tsilidis,K.K., Travis,R.C., Appleby,P.N., Allen,N.E., Lindstrom,S.,
Albanes,D., Ziegler,R.G., McCullough,M.L., Siddiq,A.,
Barricarte,A., Berndt,S.I., Bueno-de-Mesquita,H.B., Chanock,S.J.,
Crawford,E.D., Diver,W.R., Gapstur,S.M., Giovannucci,E., Gu,F.,
Haiman,C.A., Hayes,R.B., Hunter,D.J., Johansson,M., Kaaks,R.,
Kolonel,L.N., Kraft,P., Le Marchand,L., Overvad,K., Polidoro,S.,
Riboli,E., Schumacher,F.R., Stevens,V.L., Trichopoulos,D.,
Virtamo,J., Willett,W.C. and Key,T.J.
TITLE Insulin-like growth factor pathway genes and blood concentrations,
dietary protein and risk of prostate cancer in the NCI Breast and
Prostate Cancer Cohort Consortium (BPC3)
JOURNAL Int. J. Cancer 133 (2), 495-504 (2013)
PUBMED 23341348
REMARK GeneRIF: analysis of 16 IGF pathway SNPs, including IGF-1 and
IGFBP-3, reveals that prostate cancer risk varies by intakes of
dietary protein
REFERENCE 2 (bases 1 to 2620)
AUTHORS Suh,Y.A., Kim,J.H., Sung,M.A., Boo,H.J., Yun,H.J., Lee,S.H.,
Lee,H.J., Min,H.Y., Suh,Y.G., Kim,K.W. and Lee,H.Y.
TITLE A novel antitumor activity of deguelin targeting the insulin-like
growth factor (IGF) receptor pathway via up-regulation of
IGF-binding protein-3 expression in breast cancer
JOURNAL Cancer Lett. 332 (1), 102-109 (2013)
PUBMED 23348700
REMARK GeneRIF: Deguelin suppresses the growth of breast cancer cells via
its impact on the expression of IGFBP3.
REFERENCE 3 (bases 1 to 2620)
CONSRTM GENDEP Investigators; MARS Investigators; STAR*D Investigators
TITLE Common genetic variation and antidepressant efficacy in major
depressive disorder: a meta-analysis of three genome-wide
pharmacogenetic studies
JOURNAL Am J Psychiatry 170 (2), 207-217 (2013)
PUBMED 23377640
REFERENCE 4 (bases 1 to 2620)
AUTHORS Wu,C., Liu,X., Wang,Y., Tian,H., Xie,Y., Li,Q., Zhang,X. and Liu,F.
TITLE Insulin-like factor binding protein-3 promotes the G1 cell cycle
arrest in several cancer cell lines
JOURNAL Gene 512 (1), 127-133 (2013)
PUBMED 23041555
REMARK GeneRIF: Insulin-like factor binding protein-3 promotes the G1 cell
cycle arrest in several cancer cell lines
REFERENCE 5 (bases 1 to 2620)
AUTHORS Safarinejad,M.R., Shafiei,N. and Safarinejad,S.
TITLE The influence of promoter -202 A/C polymorphism (rs2854744) of the
IGFBP-3 gene on erectile dysfunction risk and serum levels of IGF-I
and IGFBP-3
JOURNAL J. Urol. 189 (1), 374-379 (2013)
PUBMED 23174226
REMARK GeneRIF: The IGFBP-3 gene A-202C polymorphism does not modulate the
risk of erectile dysfunction
REFERENCE 6 (bases 1 to 2620)
AUTHORS Gargosky,S.E., Pham,H.M., Wilson,K.F., Liu,F., Giudice,L.C. and
Rosenfeld,R.G.
TITLE Measurement and characterization of insulin-like growth factor
binding protein-3 in human biological fluids: discrepancies between
radioimmunoassay and ligand blotting
JOURNAL Endocrinology 131 (6), 3051-3060 (1992)
PUBMED 1280211
REFERENCE 7 (bases 1 to 2620)
AUTHORS Takahashi,T., Monica-Masuda,L., Ito,S., Katsumoto,T., Ishibashi,Y.
and Onodera,K.
TITLE Biochemical study of cells cultured from a patient with tuberous
sclerosis
JOURNAL J. Dermatol. 19 (11), 909-913 (1992)
PUBMED 1293182
REFERENCE 8 (bases 1 to 2620)
AUTHORS Cohen,P., Graves,H.C., Peehl,D.M., Kamarei,M., Giudice,L.C. and
Rosenfeld,R.G.
TITLE Prostate-specific antigen (PSA) is an insulin-like growth factor
binding protein-3 protease found in seminal plasma
JOURNAL J. Clin. Endocrinol. Metab. 75 (4), 1046-1053 (1992)
PUBMED 1383255
REFERENCE 9 (bases 1 to 2620)
AUTHORS Ehrenborg,E., Larsson,C., Stern,I., Janson,M., Powell,D.R. and
Luthman,H.
TITLE Contiguous localization of the genes encoding human insulin-like
growth factor binding proteins 1 (IGBP1) and 3 (IGBP3) on
chromosome 7
JOURNAL Genomics 12 (3), 497-502 (1992)
PUBMED 1373120
REFERENCE 10 (bases 1 to 2620)
AUTHORS Cubbage,M.L., Suwanichkul,A. and Powell,D.R.
TITLE Insulin-like growth factor binding protein-3. Organization of the
human chromosomal gene and demonstration of promoter activity
JOURNAL J. Biol. Chem. 265 (21), 12642-12649 (1990)
PUBMED 1695633
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AU102436.1, BC064987.1,
AK056274.1 and AI142967.1.
On Apr 6, 2005 this sequence version replaced gi:52851420.
Summary: This gene is a member of the insulin-like growth factor
binding protein (IGFBP) family and encodes a protein with an IGFBP
domain and a thyroglobulin type-I domain. The protein forms a
ternary complex with insulin-like growth factor acid-labile subunit
(IGFALS) and either insulin-like growth factor (IGF) I or II. In
this form, it circulates in the plasma, prolonging the half-life of
IGFs and altering their interaction with cell surface receptors.
Alternate transcriptional splice variants, encoding different
isoforms, have been characterized. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (2) uses an alternate in-frame
splice site in the 5' coding region, compared to variant 1,
resulting in a shorter protein (isoform b).
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: X64875.1, BC064987.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084, ERS025098 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-16 AU102436.1 1-16
17-1652 BC064987.1 1-1636
1653-2499 AK056274.1 1526-2372
2500-2620 AI142967.1 1-121 c
FEATURES Location/Qualifiers
source 1..2620
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="7"
/map="7p13-p12"
gene 1..2620
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/note="insulin-like growth factor binding protein 3"
/db_xref="GeneID:3486"
/db_xref="HGNC:5472"
/db_xref="MIM:146732"
exon 1..535
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/inference="alignment:Splign:1.39.8"
variation 86
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="c"
/db_xref="dbSNP:35925180"
CDS 133..1008
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/note="isoform b precursor is encoded by transcript
variant 2; IGF-binding protein 3; growth hormone-dependent
binding protein; acid stable subunit of the 140 K IGF
complex; binding protein 53; binding protein 29; IBP-3;
IGFBP-3"
/codon_start=1
/product="insulin-like growth factor-binding protein 3
isoform b precursor"
/protein_id="NP_000589.2"
/db_xref="GI:62243068"
/db_xref="CCDS:CCDS5505.1"
/db_xref="GeneID:3486"
/db_xref="HGNC:5472"
/db_xref="MIM:146732"
/translation="
MQRARPTLWAAALTLLVLLRGPPVARAGASSAGLGPVVRCEPCDARALAQCAPPPAVCAELVREPGCGCCLTCALSEGQPCGIYTERCGSGLRCQPSPDEARPLQALLDGRGLCVNASAVSRLRAYLLPAPPAPGNASESEEDRSAGSVESPSVSSTHRVSDPKFHPLHSKIIIIKKGHAKDSQRYKVDYESQSTDTQNFSSESKRETEYGPCRREMEDTLNHLKFLNVLSPRGVHIPNCDKKGFYKKKQCRPSKGRKRGFCWCVDKYGQPLPGYTTKGKEDVHCYSMQSK
"
sig_peptide 133..213
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
misc_feature 211..213
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01417"
misc_feature 211..213
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01488"
mat_peptide 214..1005
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/product="insulin-like growth factor-binding protein 3
isoform b"
misc_feature 214..534
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (P17936.2);
Region: IGF-binding (Potential)"
misc_feature 244..477
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/note="Insulin growth factor-binding protein homologues;
Region: IB; smart00121"
/db_xref="CDD:197525"
misc_feature 478..480
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="glycosylation site"
misc_feature 496..498
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01417"
misc_feature 499..501
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00384"
misc_feature 499..501
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00386"
misc_feature 502..504
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01417"
misc_feature 502..504
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01461"
misc_feature 502..504
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01488"
misc_feature 508..510
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00291"
misc_feature 508..510
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00384"
misc_feature 508..510
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00386"
misc_feature 508..510
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01703"
misc_feature 538..540
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="glycosylation site"
misc_feature 538..540
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01703"
misc_feature 544..546
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00277"
misc_feature 550..552
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00277"
misc_feature 607..609
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01461"
misc_feature 634..636
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00384"
misc_feature 634..636
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00386"
misc_feature 637..639
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00289"
misc_feature 637..639
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01417"
misc_feature 643..645
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00293"
misc_feature 658..660
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
misc_feature 661..663
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
misc_feature 673..675
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
misc_feature 685..687
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01417"
misc_feature 688..690
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01461"
misc_feature 691..693
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00291"
misc_feature 691..693
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01417"
misc_feature 703..705
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00291"
misc_feature 727..729
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="glycosylation site"
misc_feature 730..732
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01461"
misc_feature 739..741
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01703"
misc_feature 748..750
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01461"
misc_feature 766..975
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/note="Thyroglobulin type I repeats.; The N-terminal
region of human thyroglobulin contains 11 type-1 repeats
TY repeats are proposed to be inhibitors of cysteine
proteases; Region: TY; cd00191"
/db_xref="CDD:29153"
misc_feature order(781..783,835..837,889..891,913..915)
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/note="protease interaction site; other site"
/db_xref="CDD:29153"
misc_feature 805..807
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01417"
misc_feature 814..816
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00291"
misc_feature 820..822
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00289"
misc_feature 829..831
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01488"
misc_feature 871..873
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:01417"
variation 141
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:34239916"
variation 227
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="c"
/replace="g"
/db_xref="dbSNP:2854746"
variation 298
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:34257987"
exon 536..762
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/inference="alignment:Splign:1.39.8"
variation 605
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="c"
/db_xref="dbSNP:9282734"
STS 678..865
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/standard_name="D7S2146E"
/db_xref="UniSTS:151142"
STS 718..937
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/standard_name="Igfbp3"
/db_xref="UniSTS:143488"
exon 763..882
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/inference="alignment:Splign:1.39.8"
variation 832
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:35712717"
exon 883..1023
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/inference="alignment:Splign:1.39.8"
variation 887
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:17847676"
variation 917..962
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="c"
/replace="t"
/db_xref="dbSNP:45490491"
exon 1024..2613
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/inference="alignment:Splign:1.39.8"
STS 1070..1414
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/standard_name="D7S2833"
/db_xref="UniSTS:14552"
variation 1172
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:35704214"
STS 1175..1990
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/standard_name="IGFBP3_1859"
/db_xref="UniSTS:280776"
variation 1335
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:45599232"
variation 1402
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="c"
/replace="t"
/db_xref="dbSNP:11537920"
STS 1419..2064
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/standard_name="IGFBP3-X4.4"
/db_xref="UniSTS:255348"
variation 1455
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:9911"
variation 1609
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="g"
/replace="t"
/db_xref="dbSNP:11537917"
variation 1767
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:35751739"
variation 1768
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:34735423"
variation 1780
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace=""
/replace="a"
/db_xref="dbSNP:35496550"
STS 1948..2553
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/standard_name="IGFBP3-X4.5"
/db_xref="UniSTS:255349"
variation 1982
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="t"
/db_xref="dbSNP:11537919"
variation 2203
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="a"
/replace="t"
/db_xref="dbSNP:6670"
STS 2215..2390
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/standard_name="D7S2379"
/db_xref="UniSTS:73386"
variation 2287
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace="c"
/replace="t"
/db_xref="dbSNP:1050566"
STS 2336..2548
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/standard_name="STS-M35878"
/db_xref="UniSTS:72873"
polyA_signal 2482..2487
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
polyA_site 2499
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
polyA_site 2508
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/experiment="experimental evidence, no additional details
recorded"
variation 2571
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
/replace=""
/replace="taataattattttattata"
/db_xref="dbSNP:34663167"
polyA_signal 2589..2594
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
polyA_site 2612
/gene="IGFBP3"
/gene_synonym="BP-53; IBP3"
ORIGIN
agatgcgagcactgcggctgggcgctgaggatcagccgcttcctgcctggattccacagcttcgcgccgtgtactgtcgccccatccctgcgcgcccagcctgccaagcagcgtgccccggttgcaggcgtcatgcagcgggcgcgacccacgctctgggccgctgcgctgactctgctggtgctgctccgcgggccgccggtggcgcgggctggcgcgagctcggcgggcttgggtcccgtggtgcgctgcgagccgtgcgacgcgcgtgcactggcccagtgcgcgcctccgcccgccgtgtgcgcggagctggtgcgcgagccgggctgcggctgctgcctgacgtgcgcactgagcgagggccagccgtgcggcatctacaccgagcgctgtggctccggccttcgctgccagccgtcgcccgacgaggcgcgaccgctgcaggcgctgctggacggccgcgggctctgcgtcaacgctagtgccgtcagccgcctgcgcgcctacctgctgccagcgccgccagctccaggaaatgctagtgagtcggaggaagaccgcagcgccggcagtgtggagagcccgtccgtctccagcacgcaccgggtgtctgatcccaagttccaccccctccattcaaagataatcatcatcaagaaagggcatgctaaagacagccagcgctacaaagttgactacgagtctcagagcacagatacccagaacttctcctccgagtccaagcgggagacagaatatggtccctgccgtagagaaatggaagacacactgaatcacctgaagttcctcaatgtgctgagtcccaggggtgtacacattcccaactgtgacaagaagggattttataagaaaaagcagtgtcgcccttccaaaggcaggaagcggggcttctgctggtgtgtggataagtatgggcagcctctcccaggctacaccaccaaggggaaggaggacgtgcactgctacagcatgcagagcaagtagacgcctgccgcaaggttaatgtggagctcaaatatgccttattttgcacaaaagactgccaaggacatgaccagcagctggctacagcctcgatttatatttctgtttgtggtgaactgattttttttaaaccaaagtttagaaagaggtttttgaaatgcctatggtttctttgaatggtaaacttgagcatcttttcactttccagtagtcagcaaagagcagtttgaattttcttgtcgcttcctatcaaaatattcagagactcgagcacagcacccagacttcatgcgcccgtggaatgctcaccacatgttggtcgaagcggccgaccactgactttgtgacttaggcggctgtgttgcctatgtagagaacacgcttcacccccactccccgtacagtgcgcacaggctttatcgagaataggaaaacctttaaaccccggtcatccggacatcccaacgcatgctcctggagctcacagccttctgtggtgtcatttctgaaacaagggcgtggatccctcaaccaagaagaatgtttatgtcttcaagtgacctgtactgcttggggactattggagaaaataaggtggagtcctacttgtttaaaaaatatgtatctaagaatgttctagggcactctgggaacctataaaggcaggtatttcgggccctcctcttcaggaatcttcctgaagacatggcccagtcgaaggcccaggatggcttttgctgcggccccgtggggtaggagggacagagagacagggagagtcagcctccacattcagaggcatcacaagtaatggcacaattcttcggatgactgcagaaaatagtgttttgtagttcaacaactcaagacgaagcttatttctgaggataagctctttaaaggcaaagctttattttcatctctcatcttttgtcctccttagcacaatgtaaaaaagaatagtaatatcagaacaggaaggaggaatggcttgctggggagcccatccaggacactgggagcacatagagattcacccatgtttgttgaacttagagtcattctcatgcttttctttataattcacacatatatgcagagaagatatgttcttgttaacattgtatacaacatagccccaaatatagtaagatctatactagataatcctagatgaaatgttagagatgctatatgatacaactgtggccatgactgaggaaaggagctcacgcccagagactgggctgctctcccggaggccaaacccaagaaggtctggcaaagtcaggctcagggagactctgccctgctgcagacctcggtgtggacacacgctgcatagagctctccttgaaaacagaggggtctcaagacattctgcctacctattagcttttctttatttttttaactttttggggggaaaagtatttttgagaagtttgtcttgcaatgtatttataaatagtaaataaagtttttaccattaaaaaaatatctttccctttgttattgaccatctctgggctttgtatcactaattattttattttattatataataattattttattataataaaatcctgaaaggggaaaataaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:3486 -> Molecular function: GO:0001968 [fibronectin binding] evidence: IEA
GeneID:3486 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:3486 -> Molecular function: GO:0005520 [insulin-like growth factor binding] evidence: NAS
GeneID:3486 -> Molecular function: GO:0008160 [protein tyrosine phosphatase activator activity] evidence: IDA
GeneID:3486 -> Molecular function: GO:0031994 [insulin-like growth factor I binding] evidence: IPI
GeneID:3486 -> Molecular function: GO:0046872 [metal ion binding] evidence: NAS
GeneID:3486 -> Biological process: GO:0001558 [regulation of cell growth] evidence: IEA
GeneID:3486 -> Biological process: GO:0001933 [negative regulation of protein phosphorylation] evidence: IDA
GeneID:3486 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA
GeneID:3486 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:3486 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: IGI
GeneID:3486 -> Biological process: GO:0009968 [negative regulation of signal transduction] evidence: NAS
GeneID:3486 -> Biological process: GO:0010906 [regulation of glucose metabolic process] evidence: IEA
GeneID:3486 -> Biological process: GO:0014912 [negative regulation of smooth muscle cell migration] evidence: IDA
GeneID:3486 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: IMP
GeneID:3486 -> Biological process: GO:0043410 [positive regulation of MAPK cascade] evidence: IEA
GeneID:3486 -> Biological process: GO:0043568 [positive regulation of insulin-like growth factor receptor signaling pathway] evidence: IEA
GeneID:3486 -> Biological process: GO:0044267 [cellular protein metabolic process] evidence: TAS
GeneID:3486 -> Biological process: GO:0044342 [type B pancreatic cell proliferation] evidence: IEA
GeneID:3486 -> Biological process: GO:0045663 [positive regulation of myoblast differentiation] evidence: IDA
GeneID:3486 -> Biological process: GO:0048662 [negative regulation of smooth muscle cell proliferation] evidence: IDA
GeneID:3486 -> Cellular component: GO:0005576 [extracellular region] evidence: NAS
GeneID:3486 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS
GeneID:3486 -> Cellular component: GO:0005615 [extracellular space] evidence: IDA
GeneID:3486 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:3486 -> Cellular component: GO:0016942 [insulin-like growth factor binding protein complex] evidence: IC
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.