Home |
Help |
Advanced search
2024-04-26 18:45:34, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_000452 3779 bp mRNA linear PRI 15-JUN-2013
DEFINITION Homo sapiens solute carrier family 10 (sodium/bile acid
cotransporter family), member 2 (SLC10A2), mRNA.
ACCESSION NM_000452
VERSION NM_000452.2 GI:188528631
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3779)
AUTHORS Wu,C., Kraft,P., Zhai,K., Chang,J., Wang,Z., Li,Y., Hu,Z., He,Z.,
Jia,W., Abnet,C.C., Liang,L., Hu,N., Miao,X., Zhou,Y., Liu,Z.,
Zhan,Q., Liu,Y., Qiao,Y., Zhou,Y., Jin,G., Guo,C., Lu,C., Yang,H.,
Fu,J., Yu,D., Freedman,N.D., Ding,T., Tan,W., Goldstein,A.M.,
Wu,T., Shen,H., Ke,Y., Zeng,Y., Chanock,S.J., Taylor,P.R. and
Lin,D.
TITLE Genome-wide association analyses of esophageal squamous cell
carcinoma in Chinese identify multiple susceptibility loci and
gene-environment interactions
JOURNAL Nat. Genet. 44 (10), 1090-1097 (2012)
PUBMED 22960999
REFERENCE 2 (bases 1 to 3779)
AUTHORS Lionarons,D.A., Boyer,J.L. and Cai,S.Y.
TITLE Evolution of substrate specificity for the bile salt transporter
ASBT (SLC10A2)
JOURNAL J. Lipid Res. 53 (8), 1535-1542 (2012)
PUBMED 22669917
REMARK GeneRIF: ASBT evolved from the earliest vertebrates by gaining
affinity for modern bile salts while retaining affinity for older
bile salts
REFERENCE 3 (bases 1 to 3779)
AUTHORS Annaba,F., Sarwar,Z., Gill,R.K., Ghosh,A., Saksena,S.,
Borthakur,A., Hecht,G.A., Dudeja,P.K. and Alrefai,W.A.
TITLE Enteropathogenic Escherichia coli inhibits ileal sodium-dependent
bile acid transporter ASBT
JOURNAL Am. J. Physiol. Gastrointest. Liver Physiol. 302 (10), G1216-G1222
(2012)
PUBMED 22403793
REMARK GeneRIF: This study provided novel evidence for the alterations in
the activity of ASBT by enteropathogenic Escherichia coli
infection.
REFERENCE 4 (bases 1 to 3779)
AUTHORS Ma,L., Juttner,M., Kullak-Ublick,G.A. and Eloranta,J.J.
TITLE Regulation of the gene encoding the intestinal bile acid
transporter ASBT by the caudal-type homeobox proteins CDX1 and CDX2
JOURNAL Am. J. Physiol. Gastrointest. Liver Physiol. 302 (1), G123-G133
(2012)
PUBMED 22016432
REMARK GeneRIF: The human ASBT promoter was activated transcriptionally by
CDX1 and CDX2.
REFERENCE 5 (bases 1 to 3779)
AUTHORS Tonjes,A., Wittenburg,H., Halbritter,J., Renner,O., Harsch,S.,
Stange,E.F., Lammert,F., Stumvoll,M. and Kovacs,P.
TITLE Effects of SLC10A2 variant rs9514089 on gallstone risk and serum
cholesterol levels- meta-analysis of three independent cohorts
JOURNAL BMC Med. Genet. 12, 149 (2011)
PUBMED 22093174
REMARK GeneRIF: There was no significant association of rs9514089 with
gallstone risk, serum lipid parameters and BMI in the Sorbs and in
the meta-analysis of all three cohorts. [meta-analysis]
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 3779)
AUTHORS Shneider,B.L.
TITLE Intestinal bile acid transport: biology, physiology, and
pathophysiology
JOURNAL J. Pediatr. Gastroenterol. Nutr. 32 (4), 407-417 (2001)
PUBMED 11396803
REMARK Review article
REFERENCE 7 (bases 1 to 3779)
AUTHORS Craddock,A.L., Love,M.W., Daniel,R.W., Kirby,L.C., Walters,H.C.,
Wong,M.H. and Dawson,P.A.
TITLE Expression and transport properties of the human ileal and renal
sodium-dependent bile acid transporter
JOURNAL Am. J. Physiol. 274 (1 PT 1), G157-G169 (1998)
PUBMED 9458785
REFERENCE 8 (bases 1 to 3779)
AUTHORS Oelkers,P., Kirby,L.C., Heubi,J.E. and Dawson,P.A.
TITLE Primary bile acid malabsorption caused by mutations in the ileal
sodium-dependent bile acid transporter gene (SLC10A2)
JOURNAL J. Clin. Invest. 99 (8), 1880-1887 (1997)
PUBMED 9109432
REFERENCE 9 (bases 1 to 3779)
AUTHORS Wong,M.H., Rao,P.N., Pettenati,M.J. and Dawson,P.A.
TITLE Localization of the ileal sodium-bile acid cotransporter gene
(SLC10A2) to human chromosome 13q33
JOURNAL Genomics 33 (3), 538-540 (1996)
PUBMED 8661017
REFERENCE 10 (bases 1 to 3779)
AUTHORS Wong,M.H., Oelkers,P. and Dawson,P.A.
TITLE Identification of a mutation in the ileal sodium-dependent bile
acid transporter gene that abolishes transport activity
JOURNAL J. Biol. Chem. 270 (45), 27228-27234 (1995)
PUBMED 7592981
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from U10417.1 and AL161771.17.
This sequence is a reference standard in the RefSeqGene project.
On May 17, 2008 this sequence version replaced gi:4506972.
Summary: This gene encodes a sodium/bile acid cotransporter. This
transporter is the primary mechanism for uptake of intestinal bile
acids by apical cells in the distal ileum. Bile acids are the
catabolic product of cholesterol metabolism, so this protein is
also critical for cholesterol homeostasis. Mutations in this gene
cause primary bile acid malabsorption (PBAM); muatations in this
gene may also be associated with other diseases of the liver and
intestines, such as familial hypertriglyceridemia (FHTG). [provided
by RefSeq, Mar 2010].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: U10417.1, BC130521.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025084 [ECO:0000350]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-196 U10417.1 1-196
197-1958 U10417.1 198-1959
1959-3779 AL161771.17 116972-118792 c
FEATURES Location/Qualifiers
source 1..3779
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="13"
/map="13q33"
gene 1..3779
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/note="solute carrier family 10 (sodium/bile acid
cotransporter family), member 2"
/db_xref="GeneID:6555"
/db_xref="HGNC:10906"
/db_xref="HPRD:03189"
/db_xref="MIM:601295"
misc_feature <1..>1821
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/note="annotated region of clone"
exon 1..974
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/inference="alignment:Splign:1.39.8"
variation 50
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/replace="c"
/replace="t"
/db_xref="dbSNP:71653645"
variation 266
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/replace="c"
/replace="t"
/db_xref="dbSNP:71653646"
STS 367..610
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/standard_name="RH70986"
/db_xref="UniSTS:3214"
misc_feature 520..522
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/note="upstream in-frame stop codon"
CDS 598..1644
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/note="ileal apical sodium-dependent bile acid
transporter; ileal sodium-dependent bile acid transporter;
Na(+)-dependent ileal bile acid transporter;
sodium/taurocholate cotransporting polypeptide, ileal"
/codon_start=1
/product="ileal sodium/bile acid cotransporter"
/protein_id="NP_000443.1"
/db_xref="GI:4506973"
/db_xref="CCDS:CCDS9506.1"
/db_xref="GeneID:6555"
/db_xref="HGNC:10906"
/db_xref="HPRD:03189"
/db_xref="MIM:601295"
/translation="
MNDPNSCVDNATVCSGASCVVPESNFNNILSVVLSTVLTILLALVMFSMGCNVEIKKFLGHIKRPWGICVGFLCQFGIMPLTGFILSVAFDILPLQAVVVLIIGCCPGGTASNILAYWVDGDMDLSVSMTTCSTLLALGMMPLCLLIYTKMWVDSGSIVIPYDNIGTSLVALVVPVSIGMFVNHKWPQKAKIILKIGSIAGAILIVLIAVVGGILYQSAWIIAPKLWIIGTIFPVAGYSLGFLLARIAGLPWYRCRTVAFETGMQNTQLCSTIVQLSFTPEELNVVFTFPLIYSIFQLAFAAIFLGFYVAYKKCHGKNKAEIPESKENGTEPESSFYKANGGFQPDEK
"
misc_feature 682..744
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q12908.2);
transmembrane region"
misc_feature 733..1542
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/note="bile acid transporter; Region: bass; TIGR00841"
/db_xref="CDD:188087"
misc_feature 733..1191
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/note="Sodium Bile acid symporter family; Region: SBF;
pfam01758"
/db_xref="CDD:145094"
misc_feature 844..906
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q12908.2);
transmembrane region"
misc_feature 976..1038
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q12908.2);
transmembrane region"
misc_feature 1069..1131
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q12908.2);
transmembrane region"
misc_feature 1183..1245
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q12908.2);
transmembrane region"
misc_feature 1270..1332
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q12908.2);
transmembrane region"
misc_feature 1450..1512
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q12908.2);
transmembrane region"
misc_feature 1579..1581
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/experiment="experimental evidence, no additional details
recorded"
/note="Not glycosylated; propagated from
UniProtKB/Swiss-Prot (Q12908.2); other site"
variation 753
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/replace="c"
/replace="t"
/db_xref="dbSNP:71640246"
variation 794
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/replace="a"
/replace="g"
/db_xref="dbSNP:71640247"
exon 975..1093
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/inference="alignment:Splign:1.39.8"
exon 1094..1182
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/inference="alignment:Splign:1.39.8"
exon 1183..1358
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/inference="alignment:Splign:1.39.8"
exon 1359..1516
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/inference="alignment:Splign:1.39.8"
misc_feature 1400
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/note="Clone_left_end: RP11-104J12"
variation 1483
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/replace="c"
/replace="t"
/db_xref="dbSNP:71640248"
exon 1517..3779
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/inference="alignment:Splign:1.39.8"
variation 1764
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/replace="c"
/replace="t"
/db_xref="dbSNP:2301157"
variation 1848
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/replace="a"
/replace="g"
/db_xref="dbSNP:2301158"
variation 1959
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:279941"
variation 2017
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/replace="c"
/replace="g"
/db_xref="dbSNP:279942"
variation 2399
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/replace="c"
/replace="t"
/db_xref="dbSNP:2301159"
variation 2665..2669
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/replace=""
/replace="cttaa"
/db_xref="dbSNP:3216781"
STS 3512..3631
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/standard_name="RH98835"
/db_xref="UniSTS:86576"
STS 3525..3645
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
/standard_name="RH93919"
/db_xref="UniSTS:85196"
polyA_signal 3756..3761
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
polyA_site 3779
/gene="SLC10A2"
/gene_synonym="ASBT; IBAT; ISBT; NTCP2; PBAM"
ORIGIN
ttctattgaaagggaaatgggagaacaatatgtgttcctatggctcagtccctataagattctgtactattcagagttgattttaagtgtcacttaactgaaattatccaacaaaccttcatggcatgaaacattaacacagctctttttatatggcatggttcctatggctcaatccctataagattctgtactattcagagttgattttaaaagtcacttaactgaaattatccaacaaaccctcgaggacattaaacattaacgtggctctttttatatggcatggttcattatcatgccaataaatgattaatcgtaactctctgtcttgaccaataattttgctggacttttgtgattcacaacgtgctctgtgttgtaatgctacctcttgaaactgacatcctagctttattgttttttattacttccctaaggtggctttcaaaagagacaccaagtgacatatttttaggaggggtttaaaagtttgatggggtagaagtaaacgttgcttaactcaaccagcagcagagccagggcccagggaccagcgcttctgtggacttggcctttccagcagcagacccagcaatgaatgatccgaacagctgtgtggacaatgcaacagtttgctctggtgcatcctgtgtggtacctgagagcaatttcaataacatcctaagtgtggtcctaagtacggtgctgaccatcctgttggccttggtgatgttctccatgggatgcaacgtggaaatcaagaaatttctagggcacataaagcggccgtggggcatttgtgttggcttcctctgtcagtttggaatcatgcccctcacaggattcatcctgtcggtggcctttgacatcctcccgctccaggccgtagtggtgctcattataggatgctgccctggaggaactgcctccaatatcttggcctattgggtcgatggcgacatggacctgagcgtcagcatgaccacatgctccacactgcttgccctcggaatgatgccgctgtgcctccttatctataccaaaatgtgggtcgactctgggagcatcgtaattccctatgataacataggtacatctctggttgctctcgttgttcctgtttccattggaatgtttgttaatcacaaatggccccaaaaagcaaagatcatacttaaaattgggtccatcgcgggcgccatcctcattgtgctcatagctgtggttggaggaatattgtaccaaagcgcctggatcattgctcccaaactgtggattataggaacaatatttcctgtggcgggttactccctggggtttcttctggctagaattgctggtctaccctggtacaggtgccgaacggttgcttttgaaacggggatgcagaacacgcagctatgttccaccatcgttcagctctccttcactcctgaggagctcaatgtcgtattcaccttcccgctcatctacagcattttccagctcgcctttgccgcaatattcttaggattttatgtggcatacaagaaatgtcatggaaaaaacaaggcagaaattccagagagcaaagaaaatggaacggagccagagtcatcgttttataaggcaaatggaggatttcaacctgacgaaaagtagacatcaagtggacaaaacagacgagttccaaattacgttcttaaaccgtaactatatttaattatttgttttggtaggacagttggcagaaaagagttaaagtgaaaattggaatttcattggaattcatgtattggtttcagtaccaagtgactggtggcccaattctttaatgggacaaatattgtttcctatatatatgtatatgttttatatatgtatgtatactcatatagatatattgtcattgaaatattcccccaaaatattctcagactaaacctgacatagggaacaccgagaatgaaaacatctttaacaccaaaactgaattcttatgcagaatttcctagcccatagatgacaacctgactttctgtatgttaaagtagatgtaatgaattattattattacagtggtcacgattttcttcagtgtttatgattataaaaattgacatgaacatctttcactgacattttaatcattattttaaaagctttgcaacctatatatttatataactttgtaatataacatgggcaaatatctgacttctgtatttttaaaaagttgccttctccagtggcagtccaaaagcagaaatgagaggaaattattacaaaatagaattcaataaccatattggatgcaggctcttaactcagcagggatatcgtacatctattgctctacctcaggggtccagtgatacccactagatcttccaaggaaaaacataattctttcaaacggtgtgtatttggcaaagagctcttcaaatctgggagagggacttcctcaaggttttcctgtgtgcagtggatccacatagctaatatgacagctagtcagttgacagggaccacccacagtaagcaccatggtcagggaggtggcaggaggtgcaaagacagaagtattgagagaaacaccaagactctagtggaggaattaattcaatgggagatagtataaaatacatagaaaacacaagtaacagaaacctggttgaaatgcttaactagagtcaattagatgtgcaggagtaagtagtataagaagaatcaagtccgagagtgatcaggaaatgagtattaaacagtatttgaaacagagaacgtgtcccagggcccaaaagtcagaagggccccaccagccaggaaagttgtttcaatgctgtaagtaggtgtagccaagggaagccaggactatctgatatacggtagcaggggtttacggctgccaggggaaaataactcatcaagtgttggactttcaattataagatcgaatttaatttcctttccctcattctgcagcaatcagaatacacaatcttaaccactcggtccttagtggttttgttccattttgcattgggtattttcactgcctcatagagtctatttcaagtgttttggctgaaagggctttttgcatttgcatgttctgagttcagattctgctggtgcacccaagcattatgggaacaggaactcaacttagctcttccagtagaggggtgagggattctgcttttcaaattcataacattgatctttttatgcaagatttccatttacagttgaataagtacttcatatttttccatcattagacaaatacaaaatggactaaataattttaagagatagtggaggagagggggtacagacttccttcttagagagtgtcagagaatatgctcccaatggtggaaaggaagatttacagtctagcggctaagtacctcctacacatttcccatcaatcagaaaatagacaggtacactaaagggaccctgagaactcctcttgtaatttcaacacacccaaaatcaagggcctggatgccagcagctgcagcaagcaggtttttcctccctgttgagcaagacaggtgagcaagataggacttggctttcttacatgatgcggtaacttgtgacttgagtctttttccctaatttgctagtgggaagaaaaatagctgagctttctaaaatgatagctctctatttttaaatgaatttgaaaagtcgattaaattatgtattttattgcctctgagtatcatattaaatgaatattttattttaaaggcttaaataaatgaaaatgatttttgtaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:6555 -> Molecular function: GO:0008508 [bile acid:sodium symporter activity] evidence: IEA
GeneID:6555 -> Biological process: GO:0006810 [transport] evidence: TAS
GeneID:6555 -> Biological process: GO:0008206 [bile acid metabolic process] evidence: TAS
GeneID:6555 -> Biological process: GO:0015721 [bile acid and bile salt transport] evidence: TAS
GeneID:6555 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
GeneID:6555 -> Cellular component: GO:0000502 [proteasome complex] evidence: IEA
GeneID:6555 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
GeneID:6555 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
GeneID:6555 -> Cellular component: GO:0005887 [integral to plasma membrane] evidence: TAS
GeneID:6555 -> Cellular component: GO:0016324 [apical plasma membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.