Home |
Help |
Advanced search
2024-04-25 20:45:07, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_000417 3216 bp mRNA linear PRI 15-JUL-2013
DEFINITION Homo sapiens interleukin 2 receptor, alpha (IL2RA), mRNA.
ACCESSION NM_000417
VERSION NM_000417.2 GI:269973860
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3216)
AUTHORS Duan,Q.L., Lasky-Su,J., Himes,B.E., Qiu,W., Litonjua,A.A.,
Damask,A., Lazarus,R., Klanderman,B., Irvin,C.G., Peters,S.P.,
Hanrahan,J.P., Lima,J.J., Martinez,F.D., Mauger,D.,
Chinchilli,V.M., Soto-Quiros,M., Avila,L., Celedon,J.C., Lange,C.,
Weiss,S.T. and Tantisira,K.G.
TITLE A genome-wide association study of bronchodilator response in
asthmatics
JOURNAL Pharmacogenomics J. (2013) In press
PUBMED 23508266
REMARK Publication Status: Available-Online prior to print
REFERENCE 2 (bases 1 to 3216)
AUTHORS Pekalski,M.L., Ferreira,R.C., Coulson,R.M., Cutler,A.J., Guo,H.,
Smyth,D.J., Downes,K., Dendrou,C.A., Castro Dopico,X., Esposito,L.,
Coleman,G., Stevens,H.E., Nutland,S., Walker,N.M., Guy,C.,
Dunger,D.B., Wallace,C., Tree,T.I., Todd,J.A. and Wicker,L.S.
TITLE Postthymic expansion in human CD4 naive T cells defined by
expression of functional high-affinity IL-2 receptors
JOURNAL J. Immunol. 190 (6), 2554-2566 (2013)
PUBMED 23418630
REMARK GeneRIF: The frequency of naive CD4 T cells that express CD25 (IL-2
receptor alpha-chain) increases with age on subsets of naive CD4 T
cells.
REFERENCE 3 (bases 1 to 3216)
AUTHORS Goudy,K., Aydin,D., Barzaghi,F., Gambineri,E., Vignoli,M., Ciullini
Mannurita,S., Doglioni,C., Ponzoni,M., Cicalese,M.P., Assanelli,A.,
Tommasini,A., Brigida,I., Dellepiane,R.M., Martino,S., Olek,S.,
Aiuti,A., Ciceri,F., Roncarolo,M.G. and Bacchetta,R.
TITLE Human IL2RA null mutation mediates immunodeficiency with
lymphoproliferation and autoimmunity
JOURNAL Clin. Immunol. 146 (3), 248-261 (2013)
PUBMED 23416241
REMARK GeneRIF: The complex pathogenesis of CD25 deficiency provides
invaluable insight into the role of IL2/IL2RA-dependent regulation
in autoimmunity and inflammatory diseases
REFERENCE 4 (bases 1 to 3216)
AUTHORS Heninger,A.K., Theil,A., Wilhelm,C., Petzold,C., Huebel,N.,
Kretschmer,K., Bonifacio,E. and Monti,P.
TITLE IL-7 abrogates suppressive activity of human CD4+CD25+FOXP3+
regulatory T cells and allows expansion of alloreactive and
autoreactive T cells
JOURNAL J. Immunol. 189 (12), 5649-5658 (2012)
PUBMED 23129754
REMARK GeneRIF: Environments in which IL-7-IL-7 receptor signaling is
enhanced favor alloreactive and autoreactive T cell expansion by
releasing T cells from the inhibitory network ofCD4+CD25+FOXP3+
Tregs.
REFERENCE 5 (bases 1 to 3216)
AUTHORS Huang,X., Kuhne,V., Kun,J.F., Soboslay,P.T., Lell,B. and Tp,V.
TITLE In-vitro characterization of novel and functional regulatory SNPs
in the promoter region of IL2 and IL2R alpha in a Gabonese
population
JOURNAL BMC Med. Genet. 13, 117 (2012)
PUBMED 23217119
REMARK GeneRIF: in a Gabonese population, study identified 2 reported
variants each for IL2 and its receptor IL2R alpha gene loci; also
identified were 2 novel variants, -83 /-84 CT deletions
(ss410961576) for IL2 and -409C/T (ss410961577) for IL2R alpha
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 3216)
AUTHORS Purvis,S.F., Georges,D.L., Williams,T.M. and Lederman,M.M.
TITLE Suppression of interleukin-2 and interleukin-2 receptor expression
in Jurkat cells stably expressing the human immunodeficiency virus
Tat protein
JOURNAL Cell. Immunol. 144 (1), 32-42 (1992)
PUBMED 1394441
REFERENCE 7 (bases 1 to 3216)
AUTHORS Carter,C.R., Hancock,B.W. and Rees,R.C.
TITLE The augmentation of lymphokine-activated killer activity following
pulsing of human peripheral blood mononuclear cells with
recombinant human interleukin-2
JOURNAL Cancer Immunol. Immunother. 35 (4), 264-270 (1992)
PUBMED 1511461
REFERENCE 8 (bases 1 to 3216)
AUTHORS Kanegane,H., Miyawaki,T., Kato,K., Yokoi,T., Uehara,T., Yachie,A.
and Taniguchi,N.
TITLE A novel subpopulation of CD45RA+ CD4+ T cells expressing IL-2
receptor alpha-chain (CD25) and having a functionally transitional
nature into memory cells
JOURNAL Int. Immunol. 3 (12), 1349-1356 (1991)
PUBMED 1685671
REFERENCE 9 (bases 1 to 3216)
AUTHORS Burton,J., Goldman,C.K., Rao,P., Moos,M. and Waldmann,T.A.
TITLE Association of intercellular adhesion molecule 1 with the
multichain high-affinity interleukin 2 receptor
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 87 (18), 7329-7333 (1990)
PUBMED 1976256
REFERENCE 10 (bases 1 to 3216)
AUTHORS Kuziel,W.A. and Greene,W.C.
TITLE Interleukin-2 and the IL-2 receptor: new insights into structure
and function
JOURNAL J. Invest. Dermatol. 94 (6 SUPPL), 27S-32S (1990)
PUBMED 1693645
REMARK Review article
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AL157395.17, X01057.1 and
AL137186.18.
This sequence is a reference standard in the RefSeqGene project.
On Nov 28, 2009 this sequence version replaced gi:4557666.
Summary: The interleukin 2 (IL2) receptor alpha (IL2RA) and beta
(IL2RB) chains, together with the common gamma chain (IL2RG),
constitute the high-affinity IL2 receptor. Homodimeric alpha chains
(IL2RA) result in low-affinity receptor, while homodimeric beta
(IL2RB) chains produce a medium-affinity receptor. Normally an
integral-membrane protein, soluble IL2RA has been isolated and
determined to result from extracellular proteolyisis.
Alternately-spliced IL2RA mRNAs have been isolated, but the
significance of each is presently unknown. Mutations in this gene
are associated with interleukin 2 receptor alpha
deficiency.[provided by RefSeq, Nov 2009].
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: X01057.1, AK223313.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084, ERS025088 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-62 AL157395.17 6404-6465 c
63-2367 X01057.1 24-2328
2368-3216 AL137186.18 144397-145245 c
FEATURES Location/Qualifiers
source 1..3216
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="10"
/map="10p15-p14"
gene 1..3216
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/note="interleukin 2 receptor, alpha"
/db_xref="GeneID:3559"
/db_xref="HGNC:6008"
/db_xref="HPRD:00986"
/db_xref="MIM:147730"
exon 1..283
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/inference="alignment:Splign:1.39.8"
variation 127
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="g"
/replace="t"
/db_xref="dbSNP:72650659"
variation 131
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="c"
/replace="g"
/db_xref="dbSNP:74162091"
STS 141..1238
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/db_xref="UniSTS:489660"
misc_feature 148..150
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/note="upstream in-frame stop codon"
CDS 220..1038
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/note="interleukin-2 receptor subunit alpha; p55; IL2-RA;
IL-2-RA; TAC antigen; IL-2R subunit alpha; IL-2 receptor
subunit alpha"
/codon_start=1
/product="interleukin-2 receptor subunit alpha precursor"
/protein_id="NP_000408.1"
/db_xref="GI:4557667"
/db_xref="CCDS:CCDS7076.1"
/db_xref="GeneID:3559"
/db_xref="HGNC:6008"
/db_xref="HPRD:00986"
/db_xref="MIM:147730"
/translation="
MDSYLLMWGLLTFIMVPGCQAELCDDDPPEIPHATFKAMAYKEGTMLNCECKRGFRRIKSGSLYMLCTGNSSHSSWDNQCQCTSSATRNTTKQVTPQPEEQKERKTTEMQSPMQPVDQASLPGHCREPPPWENEATERIYHFVVGQMVYYQCVQGYRALHRGPAESVCKMTHGKTRWTQPQLICTGEMETSQFPGEEKPQASPEGRPESETSCLVTTTDFQIQTEMAATMETSIFTTEYQVAVAGCVFLLISVLLLSGLTWQRRQRKSRRTI
"
sig_peptide 220..282
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
mat_peptide 283..1035
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/product="interleukin-2 receptor subunit alpha"
misc_feature order(289..291,418..420)
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/experiment="experimental evidence, no additional details
recorded"
/note="disulfide bridge bond"
misc_feature 295..453
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/note="Complement control protein (CCP) modules (aka short
consensus repeats SCRs or SUSHI repeats) have been
identified in several proteins of the complement system;
Region: CCP; cl00043"
/db_xref="CDD:206798"
misc_feature order(364..366,457..459)
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/experiment="experimental evidence, no additional details
recorded"
/note="disulfide bridge bond"
misc_feature order(370..372,463..465)
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/experiment="experimental evidence, no additional details
recorded"
/note="disulfide bridge bond"
misc_feature 592..771
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/note="Complement control protein (CCP) modules (aka short
consensus repeats SCRs or SUSHI repeats) have been
identified in several proteins of the complement system;
Region: CCP; cd00033"
/db_xref="CDD:153056"
misc_feature order(592..594,721..723)
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/experiment="experimental evidence, no additional details
recorded"
/note="disulfide bridge bond"
misc_feature order(619..621,676..678)
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/note="receptor-ligand interactions; other site"
/db_xref="CDD:153056"
misc_feature order(673..675,769..771)
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/experiment="experimental evidence, no additional details
recorded"
/note="disulfide bridge bond"
misc_feature 940..996
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (P01589.1);
transmembrane region"
misc_feature 1021..1023
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1030..1032
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
variation 264
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="a"
/replace="g"
/db_xref="dbSNP:74162092"
exon 284..475
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/inference="alignment:Splign:1.39.8"
variation 303
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="a"
/replace="g"
/db_xref="dbSNP:2228150"
variation 399
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="c"
/replace="t"
/db_xref="dbSNP:74162093"
exon 476..586
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/inference="alignment:Splign:1.39.8"
variation 491
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="c"
/replace="t"
/db_xref="dbSNP:72650666"
variation 566
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="c"
/replace="t"
/db_xref="dbSNP:74162095"
exon 587..802
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/inference="alignment:Splign:1.39.8"
variation 735
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="c"
/replace="t"
/db_xref="dbSNP:2228149"
exon 803..874
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/inference="alignment:Splign:1.39.8"
exon 875..946
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/inference="alignment:Splign:1.39.8"
exon 947..1013
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/inference="alignment:Splign:1.39.8"
variation 948
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="a"
/replace="g"
/db_xref="dbSNP:74162100"
variation 972
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="c"
/replace="t"
/db_xref="dbSNP:12722698"
exon 1014..3216
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/inference="alignment:Splign:1.39.8"
STS 1029..1893
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/standard_name="IL2RA_V107"
/db_xref="UniSTS:277378"
variation 1034
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="c"
/replace="t"
/db_xref="dbSNP:12722712"
STS 1058..1262
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/standard_name="STS-X01057"
/db_xref="UniSTS:82054"
variation 1093
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="c"
/replace="t"
/db_xref="dbSNP:12722713"
variation 1108
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="a"
/replace="g"
/db_xref="dbSNP:12722600"
variation 1145
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="c"
/replace="t"
/db_xref="dbSNP:12722714"
variation 1361
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="g"
/replace="t"
/db_xref="dbSNP:12722715"
variation 1482
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="a"
/replace="t"
/db_xref="dbSNP:12722601"
variation 1715
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="a"
/replace="g"
/db_xref="dbSNP:12719919"
variation 1926
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="c"
/replace="t"
/db_xref="dbSNP:12722716"
variation 1991
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="a"
/replace="g"
/db_xref="dbSNP:12722717"
variation 2007
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="a"
/replace="g"
/db_xref="dbSNP:12722602"
variation 2046
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="a"
/replace="g"
/db_xref="dbSNP:34164172"
variation 2062
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="a"
/replace="g"
/db_xref="dbSNP:12722718"
variation 2064
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="a"
/replace="g"
/db_xref="dbSNP:28360484"
STS 2132..2160
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/standard_name="D3S1674"
/db_xref="UniSTS:148451"
STS 2141..2257
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/standard_name="D22S296"
/db_xref="UniSTS:147641"
variation 2224
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="c"
/replace="t"
/db_xref="dbSNP:12722603"
variation 2381
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="a"
/replace="c"
/db_xref="dbSNP:12722719"
variation 2572..2573
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace=""
/replace="tg"
/db_xref="dbSNP:71390108"
variation 2587
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="c"
/replace="t"
/db_xref="dbSNP:12722604"
variation 2710
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="a"
/replace="t"
/db_xref="dbSNP:12722605"
variation 2740
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="c"
/replace="t"
/db_xref="dbSNP:12722606"
variation 2918
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="c"
/replace="g"
/db_xref="dbSNP:12722607"
variation 3012
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="c"
/replace="t"
/db_xref="dbSNP:12722720"
variation 3032
/gene="IL2RA"
/gene_synonym="CD25; IDDM10; IL2R; TCGFR"
/replace="g"
/replace="t"
/db_xref="dbSNP:12722608"
ORIGIN
ggcagtttcctggctgaacacgccagcccaatacttaaagagagcaactcctgactccgatagagactggatggacccacaagggtgacagcccaggcggaccgatcttcccatcccacatcctccggcgcgatgccaaaaagaggctgacggcaactgggccttctgcagagaaagacctccgcttcactgccccggctggtcccaagggtcaggaagatggattcatacctgctgatgtggggactgctcacgttcatcatggtgcctggctgccaggcagagctctgtgacgatgacccgccagagatcccacacgccacattcaaagccatggcctacaaggaaggaaccatgttgaactgtgaatgcaagagaggtttccgcagaataaaaagcgggtcactctatatgctctgtacaggaaactctagccactcgtcctgggacaaccaatgtcaatgcacaagctctgccactcggaacacaacgaaacaagtgacacctcaacctgaagaacagaaagaaaggaaaaccacagaaatgcaaagtccaatgcagccagtggaccaagcgagccttccaggtcactgcagggaacctccaccatgggaaaatgaagccacagagagaatttatcatttcgtggtggggcagatggtttattatcagtgcgtccagggatacagggctctacacagaggtcctgctgagagcgtctgcaaaatgacccacgggaagacaaggtggacccagccccagctcatatgcacaggtgaaatggagaccagtcagtttccaggtgaagagaagcctcaggcaagccccgaaggccgtcctgagagtgagacttcctgcctcgtcacaacaacagattttcaaatacagacagaaatggctgcaaccatggagacgtccatatttacaacagagtaccaggtagcagtggccggctgtgttttcctgctgatcagcgtcctcctcctgagtgggctcacctggcagcggagacagaggaagagtagaagaacaatctagaaaaccaaaagaacaagaatttcttggtaagaagccgggaacagacaacagaagtcatgaagcccaagtgaaatcaaaggtgctaaatggtcgcccaggagacatccgttgtgcttgcctgcgttttggaagctctgaagtcacatcacaggacacggggcagtggcaaccttgtctctatgccagctcagtcccatcagagagcgagcgctacccacttctaaatagcaatttcgccgttgaagaggaagggcaaaaccactagaactctccatcttattttcatgtatatgtgttcattaaagcatgaatggtatggaactctctccaccctatatgtagtataaagaaaagtaggtttacattcatctcattccaacttcccagttcaggagtcccaaggaaagccccagcactaacgtaaatacacaacacacacactctaccctatacaactggacattgtctgcgtggttcctttctcagccgcttctgactgctgattctcccgttcacgttgcctaataaacatccttcaagaactctgggctgctacccagaaatcattttacccttggctcaatcctctaagctaacccccttctactgagccttcagtcttgaatttctaaaaaacagaggccatggcagaataatctttgggtaacttcaaaacggggcagccaaacccatgaggcaatgtcaggaacagaaggatgaatgaggtcccaggcagagaatcatacttagcaaagttttacctgtgcgttactaattggcctctttaagagttagtttctttgggattgctatgaatgataccctgaatttggcctgcactaatttgatgtttacaggtggacacacaaggtgcaaatcaatgcgtacgtttcctgagaagtgtctaaaaacaccaaaaagggatccgtacattcaatgtttatgcaaggaaggaaagaaagaaggaagtgaagagggagaagggatggaggtcacactggtagaacgtaaccacggaaaagagcgcatcaggcctggcacggtggctcaggcctataaccccagctccctaggagaccaaggcgggagcatctcttgaggccaggagtttgagaccagcctgggcagcatagcaagacacatccctacaaaaaattagaaattggctggatgtggtggcatacgcctgtagtcctagccactcaggaggctgaggcaggaggattgcttgagcccaggagttcgaggctgcagtcagtcatgatggcaccactgcactccagcctgggcaacagagcaagatcctgtctttaaggaaaaaaagacaagatgagcataccagcagtccttgaacattatcaaaaagttcagcatattagaatcaccgggaggccttgttaaaagagttcgctgggcccatcttcagagtctctgagttgttggtctggaatagagccaaatgttttgtgtgtctaacaattcccaggtgctgttgctgctgctactattccaggaacacactttgagaaccattgtgttattgctctgcacgcccacccactctcaactcccacgaaaaaaatcaacttccagagctaagatttcggtggaagtcctggttccatatctggtgcaagatctcccctcacgaatcagttgagtcaacattctagctcaacaacatcacacgattaacattaacgaaaattattcatttgggaaactatcagccagttttcacttctgaaggggcaggagagtgttatgagaaatcacggcagttttcagcagggtccagattcagattaaataactattttctgtcatttctgtgaccaaccacatacaaacagactcatctgtgcactctccccctcccccttcaggtatatgttttctgagtaaagttgaaaagaatctcagaccagaaaatatagatatatatttaaatcttacttgagtagaactgattacgacttttgggtgttgaggggtctataagatcaaaacttttccatgataatactaagatgttatcgaccatttatctgtccttctctcaaaagtgtatggtggaattttccagaagctatgtgatacgtgatgatgtcatcactctgctgttaacatataataaatttattgctattgtttataaaagaataaatgatatttttt
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:3559 -> Molecular function: GO:0004911 [interleukin-2 receptor activity] evidence: IEA
GeneID:3559 -> Molecular function: GO:0008144 [drug binding] evidence: IEA
GeneID:3559 -> Molecular function: GO:0019976 [interleukin-2 binding] evidence: IEA
GeneID:3559 -> Biological process: GO:0002437 [inflammatory response to antigenic stimulus] evidence: IEA
GeneID:3559 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
GeneID:3559 -> Biological process: GO:0006924 [activation-induced cell death of T cells] evidence: IEA
GeneID:3559 -> Biological process: GO:0006955 [immune response] evidence: TAS
GeneID:3559 -> Biological process: GO:0007166 [cell surface receptor signaling pathway] evidence: TAS
GeneID:3559 -> Biological process: GO:0007219 [Notch signaling pathway] evidence: IEA
GeneID:3559 -> Biological process: GO:0008283 [cell proliferation] evidence: TAS
GeneID:3559 -> Biological process: GO:0042104 [positive regulation of activated T cell proliferation] evidence: IEA
GeneID:3559 -> Biological process: GO:0042130 [negative regulation of T cell proliferation] evidence: IEA
GeneID:3559 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: IEA
GeneID:3559 -> Biological process: GO:0045582 [positive regulation of T cell differentiation] evidence: IEA
GeneID:3559 -> Biological process: GO:0046013 [regulation of T cell homeostatic proliferation] evidence: IEA
GeneID:3559 -> Biological process: GO:0050687 [negative regulation of defense response to virus] evidence: IEA
GeneID:3559 -> Biological process: GO:0050728 [negative regulation of inflammatory response] evidence: IEA
GeneID:3559 -> Biological process: GO:0050777 [negative regulation of immune response] evidence: IEA
GeneID:3559 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
GeneID:3559 -> Cellular component: GO:0009897 [external side of plasma membrane] evidence: IEA
GeneID:3559 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.