2024-04-25 10:31:25, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_000400 2568 bp mRNA linear PRI 07-JUL-2013 DEFINITION Homo sapiens excision repair cross-complementing rodent repair deficiency, complementation group 2 (ERCC2), transcript variant 1, mRNA. ACCESSION NM_000400 VERSION NM_000400.3 GI:195947405 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2568) AUTHORS Dong,Y., Zhuang,L. and Ma,W. TITLE Comprehensive assessment of the association of ERCC2 Lys751Gln polymorphism with susceptibility to cutaneous melanoma JOURNAL Tumour Biol. 34 (2), 1155-1160 (2013) PUBMED 23494240 REMARK GeneRIF: ERCC2 Lys751Gln polymorphism is associated with susceptibility to cutaneous melanoma. REFERENCE 2 (bases 1 to 2568) AUTHORS Zhang,R.C. and Mou,S.H. TITLE Polymorphisms of excision repair gene XPD Lys751Gln and hOGG1 Ser326Cys might not be associated with hepatocellular carcinoma risk: a meta-analysis JOURNAL Tumour Biol. 34 (2), 901-907 (2013) PUBMED 23271362 REMARK GeneRIF: Polymorphisms of excision repair gene XPD Lys751Gln is not associated with hepatocellular carcinoma risk. REFERENCE 3 (bases 1 to 2568) AUTHORS Abdulrahman,W., Iltis,I., Radu,L., Braun,C., Maglott-Roth,A., Giraudon,C., Egly,J.M. and Poterszman,A. TITLE ARCH domain of XPD, an anchoring platform for CAK that conditions TFIIH DNA repair and transcription activities JOURNAL Proc. Natl. Acad. Sci. U.S.A. 110 (8), E633-E642 (2013) PUBMED 23382212 REMARK GeneRIF: results identify the ARCH domain of XPD as a platform for the recruitment of CAK and as a molecular switch that might control TFIIH composition and play a role in conversion of TFIIH from a factor active in transcription to a factor involved in DNA repair REFERENCE 4 (bases 1 to 2568) AUTHORS Yang,L.M., Li,X.H. and Bao,C.F. TITLE Glutathione S-transferase P1 and DNA polymorphisms influence response to chemotherapy and prognosis of bone tumors JOURNAL Asian Pac. J. Cancer Prev. 13 (11), 5883-5886 (2012) PUBMED 23317281 REMARK GeneRIF: ERCC2 polymorphisms influence response to chemotherapy in bone tumors REFERENCE 5 (bases 1 to 2568) AUTHORS Gan,Y., Li,X.R., Chen,D.J. and Wu,J.H. TITLE Association between polymorphisms of XRCC1 Arg399Gln and XPD Lys751Gln genes and prognosis of colorectal cancer in a Chinese population JOURNAL Asian Pac. J. Cancer Prev. 13 (11), 5721-5724 (2012) PUBMED 23317245 REMARK GeneRIF: Polymorphisms of XPD Lys751Gln are associated with colorectal cancer. REFERENCE 6 (bases 1 to 2568) AUTHORS Flejter,W.L., McDaniel,L.D., Johns,D., Friedberg,E.C. and Schultz,R.A. TITLE Correction of xeroderma pigmentosum complementation group D mutant cell phenotypes by chromosome and gene transfer: involvement of the human ERCC2 DNA repair gene JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (1), 261-265 (1992) PUBMED 1729695 REFERENCE 7 (bases 1 to 2568) AUTHORS Jacob,G.A., Luse,S.W. and Luse,D.S. TITLE Abortive initiation is increased only for the weakest members of a set of down mutants of the adenovirus 2 major late promoter JOURNAL J. Biol. Chem. 266 (33), 22537-22544 (1991) PUBMED 1939271 REFERENCE 8 (bases 1 to 2568) AUTHORS Weber,C.A., Salazar,E.P., Stewart,S.A. and Thompson,L.H. TITLE ERCC2: cDNA cloning and molecular characterization of a human nucleotide excision repair gene with high homology to yeast RAD3 JOURNAL EMBO J. 9 (5), 1437-1447 (1990) PUBMED 2184031 REFERENCE 9 (bases 1 to 2568) AUTHORS Weber,C.A., Salazar,E.P., Stewart,S.A. and Thompson,L.H. TITLE Molecular cloning and biological characterization of a human gene, ERCC2, that corrects the nucleotide excision repair defect in CHO UV5 cells JOURNAL Mol. Cell. Biol. 8 (3), 1137-1146 (1988) PUBMED 2835663 REFERENCE 10 (bases 1 to 2568) AUTHORS Conaway,R.C. and Conaway,J.W. TITLE ATP activates transcription initiation from promoters by RNA polymerase II in a reversible step prior to RNA synthesis JOURNAL J. Biol. Chem. 263 (6), 2962-2968 (1988) PUBMED 2449431 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA409300.1, BC108255.1 and CN388234.1. This sequence is a reference standard in the RefSeqGene project. On Aug 7, 2008 this sequence version replaced gi:40068510. Summary: The nucleotide excision repair pathway is a mechanism to repair damage to DNA. The protein encoded by this gene is involved in transcription-coupled nucleotide excision repair and is an integral member of the basal transcription factor BTF2/TFIIH complex. The gene product has ATP-dependent DNA helicase activity and belongs to the RAD3/XPD subfamily of helicases. Defects in this gene can result in three different disorders, the cancer-prone syndrome xeroderma pigmentosum complementation group D, trichothiodystrophy, and Cockayne syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]. Transcript Variant: This variant (1) encodes the longer isoform (1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC110523.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025088 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-37 DA409300.1 2-38 38-2365 BC108255.1 1-2328 2366-2568 CN388234.1 253-455 FEATURES Location/Qualifiers source 1..2568 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="19" /map="19q13.3" gene 1..2568 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /note="excision repair cross-complementing rodent repair deficiency, complementation group 2" /db_xref="GeneID:2068" /db_xref="HGNC:3434" /db_xref="HPRD:00530" /db_xref="MIM:126340" exon 1..52 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" STS 20..659 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /standard_name="GDB:364012" /db_xref="UniSTS:156797" CDS 48..2330 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /EC_number="3.6.4.12" /note="isoform 1 is encoded by transcript variant 1; xeroderma pigmentosum complementary group D; TFIIH basal transcription factor complex helicase subunit; TFIIH basal transcription factor complex helicase XPD subunit; xeroderma pigmentosum group D-complementing protein; TFIIH basal transcription factor complex 80 kDa subunit; CXPD; BTF2 p80; TFIIH p80; TFIIH 80 kDa subunit; DNA excision repair protein ERCC-2; DNA repair protein complementing XP-D cells; basic transcription factor 2 80 kDa subunit" /codon_start=1 /product="TFIIH basal transcription factor complex helicase XPD subunit isoform 1" /protein_id="NP_000391.1" /db_xref="GI:15834617" /db_xref="CCDS:CCDS33049.1" /db_xref="GeneID:2068" /db_xref="HGNC:3434" /db_xref="HPRD:00530" /db_xref="MIM:126340" /translation="
MKLNVDGLLVYFPYDYIYPEQFSYMRELKRTLDAKGHGVLEMPSGTGKTVSLLALIMAYQRAYPLEVTKLIYCSRTVPEIEKVIEELRKLLNFYEKQEGEKLPFLGLALSSRKNLCIHPEVTPLRFGKDVDGKCHSLTASYVRAQYQHDTSLPHCRFYEEFDAHGREVPLPAGIYNLDDLKALGRRQGWCPYFLARYSILHANVVVYSYHYLLDPKIADLVSKELARKAVVVFDEAHNIDNVCIDSMSVNLTRRTLDRCQGNLETLQKTVLRIKETDEQRLRDEYRRLVEGLREASAARETDAHLANPVLPDEVLQEAVPGSIRTAEHFLGFLRRLLEYVKWRLRVQHVVQESPPAFLSGLAQRVCIQRKPLRFCAERLRSLLHTLEITDLADFSPLTLLANFATLVSTYAKGFTIIIEPFDDRTPTIANPILHFSCMDASLAIKPVFERFQSVIITSGTLSPLDIYPKILDFHPVTMATFTMTLARVCLCPMIIGRGNDQVAISSKFETREDIAVIRNYGNLLLEMSAVVPDGIVAFFTSYQYMESTVASWYEQGILENIQRNKLLFIETQDGAETSVALEKYQEACENGRGAILLSVARGKVSEGIDFVHHYGRAVIMFGVPYVYTQSRILKARLEYLRDQFQIRENDFLTFDAMRHAAQCVGRAIRGKTDYGLMVFADKRFARGDKRGKLPRWIQEHLTDANLNLTVDEGVQVAKYFLRQMAQPFHREDQLGLSLLSLEQLESEETLKRIEQIAQQL
" misc_feature 66..2171 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /note="DNA repair helicase (rad3); Region: rad3; TIGR00604" /db_xref="CDD:161953" misc_feature 261..815 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /note="DEAD_2; Region: DEAD_2; pfam06733" /db_xref="CDD:191597" misc_feature 747..758 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P18074.1); Region: DEAH box" misc_feature 849..1286 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /note="Protein of unknown function (DUF1227); Region: DUF1227; pfam06777" /db_xref="CDD:191608" misc_feature 1359..1958 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P18074.1); Region: Mediates interaction with MMS19" misc_feature 1671..2105 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /note="helicase superfamily c-terminal domain; Region: HELICc2; smart00491" /db_xref="CDD:128767" misc_feature 2091..2132 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P18074.1); Region: Nuclear localization signal (Potential)" exon 53..152 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" variation 119 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /replace="c" /replace="t" /db_xref="dbSNP:41549115" exon 153..230 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" exon 231..293 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" exon 294..407 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" STS 371..1054 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /standard_name="GDB:364015" /db_xref="UniSTS:156798" exon 408..524 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" exon 525..641 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" exon 642..765 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" variation 644 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /replace="c" /replace="g" /db_xref="dbSNP:1799791" variation 648 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /replace="c" /replace="t" /db_xref="dbSNP:1799792" exon 766..862 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" exon 863..996 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" variation 981 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /replace="a" /replace="g" /db_xref="dbSNP:1799793" STS 994..1634 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /standard_name="GDB:364018" /db_xref="UniSTS:156799" STS 994..1609 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /standard_name="GDB:364021" /db_xref="UniSTS:156800" exon 997..1165 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" exon 1166..1284 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" exon 1285..1354 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" exon 1355..1424 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" STS 1370..2366 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /standard_name="GDB:364025" /db_xref="UniSTS:156801" variation 1390 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /replace="c" /replace="t" /db_xref="dbSNP:41559922" STS 1402..2366 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /standard_name="GDB:364029" /db_xref="UniSTS:156802" exon 1425..1526 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" exon 1527..1590 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" STS 1552..1667 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /standard_name="MARC_23995-23996:1029525921:1" /db_xref="UniSTS:268821" exon 1591..1712 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" exon 1713..1805 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" variation 1784 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /replace="c" /replace="t" /db_xref="dbSNP:3916876" exon 1806..1878 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" exon 1879..1949 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" variation 1913 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /replace="c" /replace="t" /db_xref="dbSNP:16979773" STS 1914..2236 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /standard_name="GDB:512988" /db_xref="UniSTS:157537" exon 1950..2093 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" exon 2094..2237 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" STS 2178..2313 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /standard_name="RH15967" /db_xref="UniSTS:68429" variation 2180 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /replace="c" /replace="t" /db_xref="dbSNP:1052555" exon 2238..2568 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /inference="alignment:Splign:1.39.8" STS 2350..2489 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /standard_name="RH80858" /db_xref="UniSTS:83698" polyA_site 2372 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" variation 2400 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /replace="c" /replace="t" /db_xref="dbSNP:3916889" variation 2449 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /replace="" /replace="c" /db_xref="dbSNP:3916890" variation 2501 /gene="ERCC2" /gene_synonym="COFS2; EM9; TTD; XPD" /replace="c" /replace="g" /db_xref="dbSNP:3916891" ORIGIN
ttcatgagggaggcgggtcgaccccgctgcacagtccggccggcgccatgaagctcaacgtggacgggctcctggtctacttcccgtacgactacatctaccccgagcagttctcctacatgcgggagctcaaacgcacgctggacgccaagggtcatggagtcctggagatgccctcaggcaccgggaagacagtatccctgttggccctgatcatggcataccagagagcatatccgctggaggtgaccaaactcatctactgctcaagaactgtgccagagattgagaaggtgattgaagagcttcgaaagttgctcaacttctatgagaagcaggagggcgagaagctgccgtttctgggactggctctgagctcccgcaaaaacttgtgtattcaccctgaggtgacacccctgcgctttgggaaggacgtcgatgggaaatgccacagcctcacagcctcctatgtgcgggcgcagtaccagcatgacaccagcctgccccactgccgattctatgaggaatttgatgcccatgggcgtgaggtgcccctccccgctggcatctacaacctggatgacctgaaggccctggggcggcgccagggctggtgcccatacttccttgctcgatactcaatcctgcatgccaatgtggtggtttatagctaccactacctcctggaccccaagattgcagacctggtgtccaaggaactggcccgcaaggccgtcgtggtcttcgacgaggcccacaacattgacaacgtctgcatcgactccatgagcgtcaacctcacccgccggacccttgaccggtgccagggcaacctggagaccctgcagaagacggtgctcaggatcaaagagacagacgagcagcgcctgcgggacgagtaccggcgtctggtggaggggctgcgggaggccagcgccgcccgggagacggacgcccacctggccaaccccgtgctgcccgacgaagtgctgcaggaggcagtgcctggctccatccgcacggccgagcatttcctgggcttcctgaggcggctgctggagtacgtgaagtggcggctgcgtgtgcagcatgtggtgcaggagagcccgcccgccttcctgagcggcctggcccagcgcgtgtgcatccagcgcaagcccctcagattctgtgctgaacgcctccggtccctgctgcatactctggagatcaccgaccttgctgacttctccccgctcaccctccttgctaactttgccacccttgtcagcacctacgccaaaggcttcaccatcatcatcgagccctttgacgacagaaccccgaccattgccaaccccatcctgcacttcagctgcatggacgcctcgctggccatcaaacccgtatttgagcgtttccagtctgtcatcatcacatctgggacactgtccccgctggacatctaccccaagatcctggacttccaccccgtcaccatggcaaccttcaccatgacgctggcacgggtctgcctctgccctatgatcatcggccgtggcaatgaccaggtggccatcagctccaaatttgagacccgggaggatattgctgtgatccggaactatgggaacctcctgctggagatgtccgctgtggtccctgatggcatcgtggccttcttcaccagctaccagtacatggagagcaccgtggcctcctggtatgagcaggggatccttgagaacatccagaggaacaagctgctctttattgagacccaggatggtgccgaaaccagtgtcgccctggagaagtaccaggaggcctgcgagaatggccgcggggccatcctgctgtcagtggcccggggcaaagtgtccgagggaatcgactttgtgcaccactacgggcgggccgtcatcatgtttggcgtcccctacgtctacacacagagccgcattctcaaggcgcggctggaatacctgcgggaccagttccagattcgtgagaatgactttcttaccttcgatgccatgcgccacgcggcccagtgtgtgggtcgggccatcaggggcaagacggactacggcctcatggtctttgccgacaagcggtttgcccgtggggacaagcgggggaagctgccccgctggatccaggagcacctcacagatgccaacctcaacctgaccgtggacgagggtgtccaggtggccaagtacttcctgcggcagatggcacagcccttccaccgggaggatcagctgggcctgtccctgctcagcctggagcagctagaatcagaggagacgctgaagaggatagagcagattgctcagcagctctgagtggggcgggtggggccataaacggttcctggtgactcctgagtcttgcctggccctggttcccagcggcggtggtgctagaaggtcttatgaagtcaggtgacatttctcactgtcacgtccacagcctttaatcgcaggagaaggcagctatccaccaggtacccagaggcaagggggggccaggagatgatagaccccctctcaccccaccagcccatccctcctgcactgttcc
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:2068 -> Molecular function: GO:0003677 [DNA binding] evidence: IEA GeneID:2068 -> Molecular function: GO:0004003 [ATP-dependent DNA helicase activity] evidence: IEA GeneID:2068 -> Molecular function: GO:0004672 [protein kinase activity] evidence: IDA GeneID:2068 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:2068 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA GeneID:2068 -> Molecular function: GO:0008022 [protein C-terminus binding] evidence: IPI GeneID:2068 -> Molecular function: GO:0008094 [DNA-dependent ATPase activity] evidence: IDA GeneID:2068 -> Molecular function: GO:0008094 [DNA-dependent ATPase activity] evidence: TAS GeneID:2068 -> Molecular function: GO:0008353 [RNA polymerase II carboxy-terminal domain kinase activity] evidence: IDA GeneID:2068 -> Molecular function: GO:0043139 [5'-3' DNA helicase activity] evidence: IDA GeneID:2068 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA GeneID:2068 -> Molecular function: GO:0047485 [protein N-terminus binding] evidence: IPI GeneID:2068 -> Molecular function: GO:0051539 [4 iron, 4 sulfur cluster binding] evidence: IEA GeneID:2068 -> Biological process: GO:0000075 [cell cycle checkpoint] evidence: IMP GeneID:2068 -> Biological process: GO:0000718 [nucleotide-excision repair, DNA damage removal] evidence: TAS GeneID:2068 -> Biological process: GO:0001666 [response to hypoxia] evidence: IEA GeneID:2068 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA GeneID:2068 -> Biological process: GO:0006281 [DNA repair] evidence: TAS GeneID:2068 -> Biological process: GO:0006283 [transcription-coupled nucleotide-excision repair] evidence: IDA GeneID:2068 -> Biological process: GO:0006283 [transcription-coupled nucleotide-excision repair] evidence: TAS GeneID:2068 -> Biological process: GO:0006289 [nucleotide-excision repair] evidence: IGI GeneID:2068 -> Biological process: GO:0006289 [nucleotide-excision repair] evidence: NAS GeneID:2068 -> Biological process: GO:0006289 [nucleotide-excision repair] evidence: TAS GeneID:2068 -> Biological process: GO:0006360 [transcription from RNA polymerase I promoter] evidence: TAS GeneID:2068 -> Biological process: GO:0006361 [transcription initiation from RNA polymerase I promoter] evidence: TAS GeneID:2068 -> Biological process: GO:0006362 [transcription elongation from RNA polymerase I promoter] evidence: TAS GeneID:2068 -> Biological process: GO:0006363 [termination of RNA polymerase I transcription] evidence: TAS GeneID:2068 -> Biological process: GO:0006366 [transcription from RNA polymerase II promoter] evidence: IDA GeneID:2068 -> Biological process: GO:0006366 [transcription from RNA polymerase II promoter] evidence: TAS GeneID:2068 -> Biological process: GO:0006367 [transcription initiation from RNA polymerase II promoter] evidence: TAS GeneID:2068 -> Biological process: GO:0006368 [transcription elongation from RNA polymerase II promoter] evidence: TAS GeneID:2068 -> Biological process: GO:0006370 [7-methylguanosine mRNA capping] evidence: TAS GeneID:2068 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA GeneID:2068 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA GeneID:2068 -> Biological process: GO:0006917 [induction of apoptosis] evidence: IMP GeneID:2068 -> Biological process: GO:0006979 [response to oxidative stress] evidence: IMP GeneID:2068 -> Biological process: GO:0007059 [chromosome segregation] evidence: IMP GeneID:2068 -> Biological process: GO:0007568 [aging] evidence: IEA GeneID:2068 -> Biological process: GO:0008283 [cell proliferation] evidence: IEA GeneID:2068 -> Biological process: GO:0009650 [UV protection] evidence: IGI GeneID:2068 -> Biological process: GO:0009791 [post-embryonic development] evidence: IEA GeneID:2068 -> Biological process: GO:0010467 [gene expression] evidence: TAS GeneID:2068 -> Biological process: GO:0016032 [viral process] evidence: TAS GeneID:2068 -> Biological process: GO:0019048 [modulation by virus of host morphology or physiology] evidence: IEA GeneID:2068 -> Biological process: GO:0021510 [spinal cord development] evidence: IEA GeneID:2068 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: IEA GeneID:2068 -> Biological process: GO:0030282 [bone mineralization] evidence: IEA GeneID:2068 -> Biological process: GO:0032289 [central nervous system myelin formation] evidence: IEA GeneID:2068 -> Biological process: GO:0033683 [nucleotide-excision repair, DNA incision] evidence: IMP GeneID:2068 -> Biological process: GO:0035264 [multicellular organism growth] evidence: IEA GeneID:2068 -> Biological process: GO:0035315 [hair cell differentiation] evidence: IMP GeneID:2068 -> Biological process: GO:0040016 [embryonic cleavage] evidence: IEA GeneID:2068 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: IEA GeneID:2068 -> Biological process: GO:0043249 [erythrocyte maturation] evidence: IEA GeneID:2068 -> Biological process: GO:0043388 [positive regulation of DNA binding] evidence: IEA GeneID:2068 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS GeneID:2068 -> Biological process: GO:0045893 [positive regulation of transcription, DNA-dependent] evidence: IDA GeneID:2068 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IDA GeneID:2068 -> Biological process: GO:0048820 [hair follicle maturation] evidence: IEA GeneID:2068 -> Biological process: GO:0050434 [positive regulation of viral transcription] evidence: TAS GeneID:2068 -> Biological process: GO:0060218 [hematopoietic stem cell differentiation] evidence: IEA GeneID:2068 -> Cellular component: GO:0000441 [SSL2-core TFIIH complex] evidence: IEA GeneID:2068 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:2068 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS GeneID:2068 -> Cellular component: GO:0005675 [holo TFIIH complex] evidence: IDA GeneID:2068 -> Cellular component: GO:0005675 [holo TFIIH complex] evidence: TAS GeneID:2068 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA GeneID:2068 -> Cellular component: GO:0005819 [spindle] evidence: IDA GeneID:2068 -> Cellular component: GO:0019907 [cyclin-dependent protein kinase activating kinase holoenzyme complex] evidence: IDA GeneID:2068 -> Cellular component: GO:0071817 [MMXD complex] evidence: IDA ANNOTATIONS from NCBI Entrez Gene (20130726): NP_000391 -> EC 3.6.4.12
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.