GGRNA Home | Help | Advanced search

2024-03-28 22:35:58, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_000321               4772 bp    mRNA    linear   PRI 15-JUL-2013
DEFINITION  Homo sapiens retinoblastoma 1 (RB1), mRNA.
ACCESSION   NM_000321
VERSION     NM_000321.2  GI:108773786
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4772)
  AUTHORS   Hilgendorf,K.I., Leshchiner,E.S., Nedelcu,S., Maynard,M.A.,
            Calo,E., Ianari,A., Walensky,L.D. and Lees,J.A.
  TITLE     The retinoblastoma protein induces apoptosis directly at the
            mitochondria
  JOURNAL   Genes Dev. 27 (9), 1003-1015 (2013)
   PUBMED   23618872
  REMARK    GeneRIF: pRB potentiated TNFalpha-induced apoptosis even when
            translation was blocked.
REFERENCE   2  (bases 1 to 4772)
  AUTHORS   Reim,N.I., Kamil,J.P., Wang,D., Lin,A., Sharma,M., Ericsson,M.,
            Pesola,J.M., Golan,D.E. and Coen,D.M.
  TITLE     Inactivation of retinoblastoma protein does not overcome the
            requirement for human cytomegalovirus UL97 in lamina disruption and
            nuclear egress
  JOURNAL   J. Virol. 87 (9), 5019-5027 (2013)
   PUBMED   23427156
  REMARK    GeneRIF: pRb inactivation is insufficient to restore efficient
            viral nuclear egress of human cytomegalovirus in the absence of
            UL97.
REFERENCE   3  (bases 1 to 4772)
  AUTHORS   Rushlow,D.E., Mol,B.M., Kennett,J.Y., Yee,S., Pajovic,S.,
            Theriault,B.L., Prigoda-Lee,N.L., Spencer,C., Dimaras,H.,
            Corson,T.W., Pang,R., Massey,C., Godbout,R., Jiang,Z.,
            Zacksenhaus,E., Paton,K., Moll,A.C., Houdayer,C., Raizis,A.,
            Halliday,W., Lam,W.L., Boutros,P.C., Lohmann,D., Dorsman,J.C. and
            Gallie,B.L.
  TITLE     Characterisation of retinoblastomas without RB1 mutations: genomic,
            gene expression, and clinical studies
  JOURNAL   Lancet Oncol. 14 (4), 327-334 (2013)
   PUBMED   23498719
  REMARK    GeneRIF: Amplification of the MYCN oncogene might initiate
            retinoblastoma in the presence of non-mutated RB1 genes. These
            unilateral RB1(+/+)MYCN(A) retinoblastomas are characterised by
            distinct histological features.
REFERENCE   4  (bases 1 to 4772)
  AUTHORS   Winkler,L.L., Hwang,J. and Kalejta,R.F.
  TITLE     Ubiquitin-independent proteasomal degradation of tumor suppressors
            by human cytomegalovirus pp71 requires the 19S regulatory particle
  JOURNAL   J. Virol. 87 (8), 4665-4671 (2013)
   PUBMED   23408605
  REMARK    GeneRIF: Authors show that only the proteasome 19S regulatory
            particle that normally participates in ubiquitin-dependent protein
            degradation, is required for human herpesvirus 5 pp71-mediated
            degradation of Rb and Daxx.
REFERENCE   5  (bases 1 to 4772)
  AUTHORS   Barbosa,R.H., Aguiar,F.C., Silva,M.F., Costa,R.A., Vargas,F.R.,
            Lucena,E., Carvalho de Souza,M., de Almeida,L.M., Bittar,C., Ashton
            Prolla,P., Bonvicino,C.R. and Seuanez,H.N.
  TITLE     Screening of RB1 alterations in Brazilian patients with
            retinoblastoma and relatives with retinoma: phenotypic and
            genotypic associations
  JOURNAL   Invest. Ophthalmol. Vis. Sci. 54 (5), 3184-3194 (2013)
   PUBMED   23532519
  REMARK    GeneRIF: Fifteen substitutions (4 intronic and 11 exonic) were
            identified as probably or likely pathogenic. Four of these 11
            exonic substitutions were novel.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 4772)
  AUTHORS   Huang,S., Shin,E., Sheppard,K.A., Chokroverty,L., Shan,B.,
            Qian,Y.W., Lee,E.Y. and Yee,A.S.
  TITLE     The retinoblastoma protein region required for interaction with the
            E2F transcription factor includes the T/E1A binding and
            carboxy-terminal sequences
  JOURNAL   DNA Cell Biol. 11 (7), 539-548 (1992)
   PUBMED   1388726
REFERENCE   7  (bases 1 to 4772)
  AUTHORS   Kim,S.J., Wagner,S., Liu,F., O'Reilly,M.A., Robbins,P.D. and
            Green,M.R.
  TITLE     Retinoblastoma gene product activates expression of the human
            TGF-beta 2 gene through transcription factor ATF-2
  JOURNAL   Nature 358 (6384), 331-334 (1992)
   PUBMED   1641004
REFERENCE   8  (bases 1 to 4772)
  AUTHORS   Onadim,Z., Hogg,A., Baird,P.N. and Cowell,J.K.
  TITLE     Oncogenic point mutations in exon 20 of the RB1 gene in families
            showing incomplete penetrance and mild expression of the
            retinoblastoma phenotype
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 89 (13), 6177-6181 (1992)
   PUBMED   1352883
REFERENCE   9  (bases 1 to 4772)
  AUTHORS   Hogg,A., Onadim,Z., Baird,P.N. and Cowell,J.K.
  TITLE     Detection of heterozygous mutations in the RB1 gene in
            retinoblastoma patients using single-strand conformation
            polymorphism analysis and polymerase chain reaction sequencing
  JOURNAL   Oncogene 7 (7), 1445-1451 (1992)
   PUBMED   1352398
REFERENCE   10 (bases 1 to 4772)
  AUTHORS   Faha,B., Ewen,M.E., Tsai,L.H., Livingston,D.M. and Harlow,E.
  TITLE     Interaction between human cyclin A and adenovirus E1A-associated
            p107 protein
  JOURNAL   Science 255 (5040), 87-90 (1992)
   PUBMED   1532458
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AL392048.9, BC040540.1 and
            L41870.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Jun 9, 2006 this sequence version replaced gi:4506434.
            
            Summary: The protein encoded by this gene is a negative regulator
            of the cell cycle and was the first tumor suppressor gene found.
            The encoded protein also stabilizes constitutive heterochromatin to
            maintain the overall chromatin structure. The active,
            hypophosphorylated form of the protein binds transcription factor
            E2F1. Defects in this gene are a cause of childhood cancer
            retinoblastoma (RB), bladder cancer, and osteogenic sarcoma.
            [provided by RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC040540.1, L41870.1, BC040540.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025081, ERS025082 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-5                 AL392048.9         15305-15309
            6-4769              BC040540.1         2-4765
            4770-4772           L41870.1           4741-4743
FEATURES             Location/Qualifiers
     source          1..4772
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="13"
                     /map="13q14.2"
     gene            1..4772
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /note="retinoblastoma 1"
                     /db_xref="GeneID:5925"
                     /db_xref="HGNC:9884"
                     /db_xref="MIM:614041"
     exon            1..303
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    65..67
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /note="upstream in-frame stop codon"
     CDS             167..2953
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /note="retinoblastoma suspectibility protein"
                     /codon_start=1
                     /product="retinoblastoma-associated protein"
                     /protein_id="NP_000312.2"
                     /db_xref="GI:108773787"
                     /db_xref="CCDS:CCDS31973.1"
                     /db_xref="GeneID:5925"
                     /db_xref="HGNC:9884"
                     /db_xref="MIM:614041"
                     /translation="
MPPKTPRKTAATAAAAAAEPPAPPPPPPPEEDPEQDSGPEDLPLVRLEFEETEEPDFTALCQKLKIPDHVRERAWLTWEKVSSVDGVLGGYIQKKKELWGICIFIAAVDLDEMSFTFTELQKNIEISVHKFFNLLKEIDTSTKVDNAMSRLLKKYDVLFALFSKLERTCELIYLTQPSSSISTEINSALVLKVSWITFLLAKGEVLQMEDDLVISFQLMLCVLDYFIKLSPPMLLKEPYKTAVIPINGSPRTPRRGQNRSARIAKQLENDTRIIEVLCKEHECNIDEVKNVYFKNFIPFMNSLGLVTSNGLPEVENLSKRYEEIYLKNKDLDARLFLDHDKTLQTDSIDSFETQRTPRKSNLDEEVNVIPPHTPVRTVMNTIQQLMMILNSASDQPSENLISYFNNCTVNPKESILKRVKDIGYIFKEKFAKAVGQGCVEIGSQRYKLGVRLYYRVMESMLKSEEERLSIQNFSKLLNDNIFHMSLLACALEVVMATYSRSTSQNLDSGTDLSFPWILNVLNLKAFDFYKVIESFIKAEGNLTREMIKHLERCEHRIMESLAWLSDSPLFDLIKQSKDREGPTDHLESACPLNLPLQNNHTAADMYLSPVRSPKKKGSTTRVNSTANAETQATSAFQTQKPLKSTSLSLFYKKVYRLAYLRLNTLCERLLSEHPELEHIIWTLFQHTLQNEYELMRDRHLDQIMMCSMYGICKVKNIDLKFKIIVTAYKDLPHAVQETFKRVLIKEEEYDSIIVFYNSVFMQRLKTNILQYASTRPPTLSPIPHIPRSPYKFPSSPLRIPGGNIYISPLKSPYKISEGLPTPTKMTPRSRILVSIGESFGTSEKFQKINQMVCNSDRVLKRSAEGSNPPKPLKKLRFDIEGSDEADGSKHLPGESKFQQKLAEMTSTRTRMQKQKMNDSMDTSNKEEK
"
     misc_feature    179..181
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00447"
     misc_feature    275..277
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P06400.2); phosphorylation site"
     misc_feature    509..850
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /note="Domain of unknown function (DUF3452); Region:
                     DUF3452; pfam11934"
                     /db_xref="CDD:152369"
     misc_feature    854..856
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00310"
     misc_feature    911..913
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by CDK1; propagated from
                     UniProtKB/Swiss-Prot (P06400.2); phosphorylation site"
     misc_feature    911..913
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00302"
     misc_feature    920..922
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine, by CDK1; propagated from
                     UniProtKB/Swiss-Prot (P06400.2); phosphorylation site"
     misc_feature    920..922
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00302"
     misc_feature    1211..1213
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="proteolytic cleavage site; modified site"
                     /db_xref="HPRD:02799"
     misc_feature    1211..1213
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="proteolytic cleavage site; modified site"
                     /db_xref="HPRD:03457"
     misc_feature    1232..1234
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (P06400.2); phosphorylation site"
     misc_feature    1232..1234
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00447"
     misc_feature    1283..2479
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P06400.2);
                     Region: Pocket, binds T and E1A"
     misc_feature    1283..1903
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P06400.2);
                     Region: Domain A"
     misc_feature    1283..1885
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /note="Retinoblastoma-associated protein A domain; Region:
                     RB_A; pfam01858"
                     /db_xref="CDD:202014"
     misc_feature    1283..1285
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine, by CDK1; propagated from
                     UniProtKB/Swiss-Prot (P06400.2); phosphorylation site"
     misc_feature    1283..1285
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00302"
     misc_feature    1865..1867
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by CDK2; propagated from
                     UniProtKB/Swiss-Prot (P06400.2); phosphorylation site"
     misc_feature    1865..1867
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00310"
     misc_feature    1904..2083
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P06400.2);
                     Region: Spacer"
     misc_feature    1988..1990
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00310"
     misc_feature    2000..2002
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by CHEK2 and CHEK1; propagated from
                     UniProtKB/Swiss-Prot (P06400.2); phosphorylation site"
     misc_feature    2000..2002
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00310"
     misc_feature    2084..2479
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P06400.2);
                     Region: Domain B"
     misc_feature    2099..2464
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /note="Retinoblastoma-associated protein B domain; Region:
                     RB_B; pfam01857"
                     /db_xref="CDD:202013"
     misc_feature    2453..2950
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P06400.2);
                     Region: Interaction with LIMD1"
     misc_feature    2468..2947
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /note="Rb C-terminal domain; Region: Rb_C; pfam08934"
                     /db_xref="CDD:149868"
     misc_feature    2477..2950
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P06400.2);
                     Region: Domain C, mediates interaction with E4F1"
     misc_feature    2504..2506
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00447"
     misc_feature    2504..2506
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00451"
     misc_feature    2504..2506
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    2528..2530
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00447"
     misc_feature    2549..2551
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00447"
     misc_feature    2549..2551
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    2585..2587
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by CDK1 and CDK3; propagated from
                     UniProtKB/Swiss-Prot (P06400.2); phosphorylation site"
     misc_feature    2585..2587
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00302"
     misc_feature    2585..2587
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00310"
     misc_feature    2594..2596
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-methyllysine, by SMYD2; propagated from
                     UniProtKB/Swiss-Prot (P06400.2); methylation site"
     misc_feature    2597..2599
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by CDK1 and CDK3; propagated from
                     UniProtKB/Swiss-Prot (P06400.2); phosphorylation site"
     misc_feature    2597..2599
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00302"
     misc_feature    2597..2599
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00310"
     misc_feature    2627..2629
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine, by CDK6; propagated from
                     UniProtKB/Swiss-Prot (P06400.2); phosphorylation site"
     misc_feature    2627..2629
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00310"
     misc_feature    2633..2635
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (P06400.2); phosphorylation site"
     misc_feature    2642..2644
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine, by CDK4; propagated from
                     UniProtKB/Swiss-Prot (P06400.2); phosphorylation site"
     misc_feature    2642..2644
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00447"
     misc_feature    2687..2689
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (P06400.2); phosphorylation site"
     misc_feature    2744..2746
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-methyllysine, by SMYD2; propagated from
                     UniProtKB/Swiss-Prot (P06400.2); methylation site"
     misc_feature    2774..2794
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P06400.2);
                     Region: Nuclear localization signal (Probable)"
     misc_feature    2783..2785
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine, by PCAF; propagated from
                     UniProtKB/Swiss-Prot (P06400.2); acetylation site"
     misc_feature    2783..2785
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="acetylation site"
                     /db_xref="HPRD:04078"
     misc_feature    2786..2788
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine, by PCAF; propagated from
                     UniProtKB/Swiss-Prot (P06400.2); acetylation site"
     misc_feature    2786..2788
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="acetylation site"
                     /db_xref="HPRD:04078"
     variation       208
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148980395"
     variation       228..229
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34437965"
     exon            304..430
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       339
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138574644"
     variation       341
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:184754468"
     variation       343
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:189574280"
     variation       380
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369833913"
     exon            431..546
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       432
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371655281"
     variation       489
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376408183"
     variation       507
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139673557"
     variation       530..531
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:67045046"
     variation       533
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149800437"
     exon            547..666
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       563
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3092900"
     variation       575
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:121913296"
     variation       576..577
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:66936947"
     variation       577
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:3092902"
     variation       628
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369830657"
     variation       659
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:66624868"
     exon            667..705
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       705
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367654488"
     exon            706..773
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       715
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147793910"
     variation       735
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141366046"
     variation       762
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:121913298"
     exon            774..884
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       794
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148992508"
     variation       800
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147085238"
     variation       824
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367960214"
     exon            885..1027
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       897
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147754935"
     variation       927
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200674097"
     variation       998..999
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:121908691"
     exon            1028..1105
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       1042..1043
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:67246835"
     variation       1046..1047
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:66519118"
     variation       1086
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183898408"
     variation       1095
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200844292"
     exon            1106..1215
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       1124
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121913300"
     variation       1129
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377235036"
     variation       1131
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142620145"
     exon            1216..1293
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       1238
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121913301"
     variation       1268
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049721"
     exon            1294..1381
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       1295
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:146897002"
     variation       1306
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117865557"
     variation       1325
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:190689977"
     variation       1329
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373623059"
     variation       1330
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375239544"
     variation       1333..1334
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:67850338"
     variation       1339
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1049722"
     variation       1340
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181988132"
     exon            1382..1498
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       1390
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371805499"
     variation       1472
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:4151534"
     variation       1485..1486
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:66805009"
     exon            1499..1555
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       1499
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3092891"
     variation       1522
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201285819"
     variation       1529
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121913302"
     exon            1556..1587
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       1574
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139960834"
     exon            1588..1664
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       1613..1614
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34873197"
     variation       1614..1615
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:5803433"
     variation       1615
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367661403"
     variation       1633
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141608408"
     variation       1634
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201458896"
     variation       1657
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150115447"
     exon            1665..1861
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       1677
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:146801558"
     variation       1678
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140500741"
     variation       1697
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145729675"
     variation       1712
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138201027"
     variation       1723
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149620934"
     variation       1740
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:4151539"
     variation       1758
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143324585"
     variation       1781
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148379933"
     variation       1783
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371031574"
     variation       1797
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143269980"
     variation       1798
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143948310"
     variation       1817
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147534828"
     variation       1820
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121913303"
     variation       1821
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146236493"
     variation       1832
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121913304"
     variation       1839
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139494954"
     variation       1848
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143400770"
     variation       1849
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150542946"
     variation       1853
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139500527"
     exon            1862..1980
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       1866
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137853292"
     variation       1873
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3092895"
     variation       1901
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121913305"
     variation       1907
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375645171"
     variation       1936
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145310579"
     variation       1944
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138033832"
     variation       1962
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3092896"
     exon            1981..2126
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       1984
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:137853297"
     variation       2027
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367578442"
     variation       2028
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373601944"
     variation       2053
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367668687"
     variation       2109
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:121908692"
     exon            2127..2272
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       2132
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142509759"
     variation       2133
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202031219"
     STS             2134..2221
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /standard_name="PMC193706P1"
                     /db_xref="UniSTS:271756"
     variation       2138
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202119986"
     variation       2146..2149
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="ccgg"
                     /db_xref="dbSNP:121913299"
     variation       2147
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137853294"
     variation       2168
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369755801"
     variation       2183
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:79200171"
     variation       2189
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:137853295"
     variation       2199
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201046651"
     variation       2227
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113432974"
     variation       2257
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3092903"
     exon            2273..2377
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       2283
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:121913295"
     variation       2300
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137853296"
     variation       2352
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150600740"
     variation       2375
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:66644190"
     exon            2378..2491
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       2403
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3092905"
     variation       2408
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:121913297"
     variation       2419
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:373070661"
     variation       2456
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138637932"
     exon            2492..2655
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       2525
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137853293"
     variation       2535..2536
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:67412362"
     variation       2554
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:66482475"
     variation       2558
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187912365"
     variation       2559
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374523971"
     variation       2621
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375751988"
     variation       2629
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370088029"
     variation       2630
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368413787"
     exon            2656..2686
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       2684
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374157786"
     exon            2687..2829
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       2725
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148327780"
     variation       2732
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149359120"
     variation       2734..2735
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:66961080"
     variation       2736
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144668210"
     variation       2749
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377205343"
     variation       2792
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143105337"
     exon            2830..2879
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     STS             2878..3207
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /standard_name="RB1-3UUTF"
                     /db_xref="UniSTS:43719"
     exon            2880..4772
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /inference="alignment:Splign:1.39.8"
     variation       2925
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148501460"
     variation       2982
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372459968"
     variation       2984
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377188800"
     variation       2985
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370626097"
     variation       2988
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376192929"
     variation       2989
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368462035"
     variation       2996
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371663196"
     variation       3004
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:76558254"
     variation       3069..3070
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:66652813"
     variation       3080
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182470177"
     STS             3090..3435
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /standard_name="D10S2288"
                     /db_xref="UniSTS:25849"
     STS             3104..3268
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /standard_name="RH17613"
                     /db_xref="UniSTS:73965"
     variation       3111
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1049723"
     variation       3125
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143536240"
     variation       3137
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:4151630"
     variation       3195
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148064671"
     variation       3269
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:187845274"
     variation       3416
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:4151631"
     variation       3527
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150194261"
     variation       3656
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139023385"
     variation       3750
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:143145266"
     variation       3808
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4151632"
     variation       3917
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:4151633"
     variation       3989
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192758219"
     variation       4061..4062
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:200353673"
     variation       4213
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143174150"
     variation       4232
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182363120"
     variation       4278
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371878105"
     variation       4419
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1804280"
     variation       4500
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4151634"
     variation       4631
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1804276"
     variation       4640
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4151635"
     variation       4669
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:371337708"
     variation       4708
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376808474"
     polyA_signal    4747..4752
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
     polyA_site      4768
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
     polyA_site      4772
                     /gene="RB1"
                     /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB"
ORIGIN      
gctcagttgccgggcgggggagggcgcgtccggtttttctcaggggacgttgaaattatttttgtaacgggagtcgggagaggacggggcgtgccccgacgtgcgcgcgcgtcgtcctccccggcgctcctccacagctcgctggctcccgccgcggaaaggcgtcatgccgcccaaaaccccccgaaaaacggccgccaccgccgccgctgccgccgcggaacccccggcaccgccgccgccgccccctcctgaggaggacccagagcaggacagcggcccggaggacctgcctctcgtcaggcttgagtttgaagaaacagaagaacctgattttactgcattatgtcagaaattaaagataccagatcatgtcagagagagagcttggttaacttgggagaaagtttcatctgtggatggagtattgggaggttatattcaaaagaaaaaggaactgtggggaatctgtatctttattgcagcagttgacctagatgagatgtcgttcacttttactgagctacagaaaaacatagaaatcagtgtccataaattctttaacttactaaaagaaattgataccagtaccaaagttgataatgctatgtcaagactgttgaagaagtatgatgtattgtttgcactcttcagcaaattggaaaggacatgtgaacttatatatttgacacaacccagcagttcgatatctactgaaataaattctgcattggtgctaaaagtttcttggatcacatttttattagctaaaggggaagtattacaaatggaagatgatctggtgatttcatttcagttaatgctatgtgtccttgactattttattaaactctcacctcccatgttgctcaaagaaccatataaaacagctgttatacccattaatggttcacctcgaacacccaggcgaggtcagaacaggagtgcacggatagcaaaacaactagaaaatgatacaagaattattgaagttctctgtaaagaacatgaatgtaatatagatgaggtgaaaaatgtttatttcaaaaattttataccttttatgaattctcttggacttgtaacatctaatggacttccagaggttgaaaatctttctaaacgatacgaagaaatttatcttaaaaataaagatctagatgcaagattatttttggatcatgataaaactcttcagactgattctatagacagttttgaaacacagagaacaccacgaaaaagtaaccttgatgaagaggtgaatgtaattcctccacacactccagttaggactgttatgaacactatccaacaattaatgatgattttaaattcagcaagtgatcaaccttcagaaaatctgatttcctattttaacaactgcacagtgaatccaaaagaaagtatactgaaaagagtgaaggatataggatacatctttaaagagaaatttgctaaagctgtgggacagggttgtgtcgaaattggatcacagcgatacaaacttggagttcgcttgtattaccgagtaatggaatccatgcttaaatcagaagaagaacgattatccattcaaaattttagcaaacttctgaatgacaacatttttcatatgtctttattggcgtgcgctcttgaggttgtaatggccacatatagcagaagtacatctcagaatcttgattctggaacagatttgtctttcccatggattctgaatgtgcttaatttaaaagcctttgatttttacaaagtgatcgaaagttttatcaaagcagaaggcaacttgacaagagaaatgataaaacatttagaacgatgtgaacatcgaatcatggaatcccttgcatggctctcagattcacctttatttgatcttattaaacaatcaaaggaccgagaaggaccaactgatcaccttgaatctgcttgtcctcttaatcttcctctccagaataatcacactgcagcagatatgtatctttctcctgtaagatctccaaagaaaaaaggttcaactacgcgtgtaaattctactgcaaatgcagagacacaagcaacctcagccttccagacccagaagccattgaaatctacctctctttcactgttttataaaaaagtgtatcggctagcctatctccggctaaatacactttgtgaacgccttctgtctgagcacccagaattagaacatatcatctggacccttttccagcacaccctgcagaatgagtatgaactcatgagagacaggcatttggaccaaattatgatgtgttccatgtatggcatatgcaaagtgaagaatatagaccttaaattcaaaatcattgtaacagcatacaaggatcttcctcatgctgttcaggagacattcaaacgtgttttgatcaaagaagaggagtatgattctattatagtattctataactcggtcttcatgcagagactgaaaacaaatattttgcagtatgcttccaccaggccccctaccttgtcaccaatacctcacattcctcgaagcccttacaagtttcctagttcacccttacggattcctggagggaacatctatatttcacccctgaagagtccatataaaatttcagaaggtctgccaacaccaacaaaaatgactccaagatcaagaatcttagtatcaattggtgaatcattcgggacttctgagaagttccagaaaataaatcagatggtatgtaacagcgaccgtgtgctcaaaagaagtgctgaaggaagcaaccctcctaaaccactgaaaaaactacgctttgatattgaaggatcagatgaagcagatggaagtaaacatctcccaggagagtccaaatttcagcagaaactggcagaaatgacttctactcgaacacgaatgcaaaagcagaaaatgaatgatagcatggatacctcaaacaaggaagagaaatgaggatctcaggaccttggtggacactgtgtacacctctggattcattgtctctcacagatgtgactgtataactttcccaggttctgtttatggccacatttaatatcttcagctctttttgtggatataaaatgtgcagatgcaattgtttgggtgattcctaagccacttgaaatgttagtcattgttatttatacaagattgaaaatcttgtgtaaatcctgccatttaaaaagttgtagcagattgtttcctcttccaaagtaaaattgctgtgctttatggatagtaagaatggccctagagtgggagtcctgataacccaggcctgtctgactactttgccttcttttgtagcatataggtgatgtttgctcttgtttttattaatttatatgtatatttttttaatttaacatgaacacccttagaaaatgtgtcctatctatcttccaaatgcaatttgattgactgcccattcaccaaaattatcctgaactcttctgcaaaaatggatattattagaaattagaaaaaaattactaattttacacattagattttattttactattggaatctgatatactgtgtgcttgttttataaaattttgcttttaattaaataaaagctggaagcaaagtataaccatatgatactatcatactactgaaacagatttcatacctcagaatgtaaaagaacttactgattattttcttcatccaacttatgtttttaaatgaggattattgatagtactcttggtttttataccattcagatcactgaatttataaagtacccatctagtacttgaaaaagtaaagtgttctgccagatcttaggtatagaggaccctaacacagtatatcccaagtgcactttctaatgtttctgggtcctgaagaattaagatacaaattaattttactccataaacagactgttaattataggagccttaatttttttttcatagagatttgtctaattgcatctcaaaattattctgccctccttaatttgggaaggtttgtgttttctctggaatggtacatgtcttccatgtatcttttgaactggcaattgtctatttatcttttatttttttaagtcagtatggtctaacactggcatgttcaaagccacattatttctagtccaaaattacaagtaatcaagggtcattatgggttaggcattaatgtttctatctgattttgtgcaaaagcttcaaattaaaacagctgcattagaaaaagaggcgcttctcccctcccctacacctaaaggtgtatttaaactatcttgtgtgattaacttatttagagatgctgtaacttaaaataggggatatttaaggtagcttcagctagcttttaggaaaatcactttgtctaactcagaattatttttaaaaagaaatctggtcttgttagaaaacaaaattttattttgtgctcatttaagtttcaaacttactattttgacagttattttgataacaatgacactagaaaacttgactccatttcatcattgtttctgcatgaatatcatacaaatcagttagtttttaggtcaagggcttactatttctgggtcttttgctactaagttcacattagaattagtgccagaattttaggaacttcagagatcgtgtattgagatttcttaaataatgcttcagatattattgctttattgcttttttgtattggttaaaactgtacatttaaaattgctatgttactattttctacaattaatagtttgtctattttaaaataaattagttgttaagagtcttaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:5925 -> Molecular function: GO:0001047 [core promoter binding] evidence: IDA
            GeneID:5925 -> Molecular function: GO:0001102 [RNA polymerase II activating transcription factor binding] evidence: IEA
            GeneID:5925 -> Molecular function: GO:0003677 [DNA binding] evidence: TAS
            GeneID:5925 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: TAS
            GeneID:5925 -> Molecular function: GO:0003713 [transcription coactivator activity] evidence: NAS
            GeneID:5925 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:5925 -> Molecular function: GO:0008134 [transcription factor binding] evidence: IPI
            GeneID:5925 -> Molecular function: GO:0019900 [kinase binding] evidence: IDA
            GeneID:5925 -> Molecular function: GO:0031625 [ubiquitin protein ligase binding] evidence: IPI
            GeneID:5925 -> Molecular function: GO:0050681 [androgen receptor binding] evidence: NAS
            GeneID:5925 -> Molecular function: GO:0051219 [phosphoprotein binding] evidence: IPI
            GeneID:5925 -> Biological process: GO:0000075 [cell cycle checkpoint] evidence: TAS
            GeneID:5925 -> Biological process: GO:0000082 [G1/S transition of mitotic cell cycle] evidence: TAS
            GeneID:5925 -> Biological process: GO:0000083 [regulation of transcription involved in G1/S phase of mitotic cell cycle] evidence: TAS
            GeneID:5925 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
            GeneID:5925 -> Biological process: GO:0006338 [chromatin remodeling] evidence: TAS
            GeneID:5925 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:5925 -> Biological process: GO:0006469 [negative regulation of protein kinase activity] evidence: IPI
            GeneID:5925 -> Biological process: GO:0007050 [cell cycle arrest] evidence: TAS
            GeneID:5925 -> Biological process: GO:0007070 [negative regulation of transcription from RNA polymerase II promoter during mitosis] evidence: TAS
            GeneID:5925 -> Biological process: GO:0007093 [mitotic cell cycle checkpoint] evidence: TAS
            GeneID:5925 -> Biological process: GO:0007265 [Ras protein signal transduction] evidence: IEP
            GeneID:5925 -> Biological process: GO:0007346 [regulation of mitotic cell cycle] evidence: IMP
            GeneID:5925 -> Biological process: GO:0019048 [modulation by virus of host morphology or physiology] evidence: IEA
            GeneID:5925 -> Biological process: GO:0030521 [androgen receptor signaling pathway] evidence: NAS
            GeneID:5925 -> Biological process: GO:0031134 [sister chromatid biorientation] evidence: IMP
            GeneID:5925 -> Biological process: GO:0031175 [neuron projection development] evidence: IEA
            GeneID:5925 -> Biological process: GO:0034088 [maintenance of mitotic sister chromatid cohesion] evidence: IMP
            GeneID:5925 -> Biological process: GO:0035914 [skeletal muscle cell differentiation] evidence: IEA
            GeneID:5925 -> Biological process: GO:0042551 [neuron maturation] evidence: IEA
            GeneID:5925 -> Biological process: GO:0043353 [enucleate erythrocyte differentiation] evidence: IEA
            GeneID:5925 -> Biological process: GO:0043433 [negative regulation of sequence-specific DNA binding transcription factor activity] evidence: TAS
            GeneID:5925 -> Biological process: GO:0043550 [regulation of lipid kinase activity] evidence: IDA
            GeneID:5925 -> Biological process: GO:0045445 [myoblast differentiation] evidence: IMP
            GeneID:5925 -> Biological process: GO:0045651 [positive regulation of macrophage differentiation] evidence: IEA
            GeneID:5925 -> Biological process: GO:0045842 [positive regulation of mitotic metaphase/anaphase transition] evidence: IMP
            GeneID:5925 -> Biological process: GO:0045879 [negative regulation of smoothened signaling pathway] evidence: IEA
            GeneID:5925 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IDA
            GeneID:5925 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: TAS
            GeneID:5925 -> Biological process: GO:0045893 [positive regulation of transcription, DNA-dependent] evidence: NAS
            GeneID:5925 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IEA
            GeneID:5925 -> Biological process: GO:0048565 [digestive tract development] evidence: IEA
            GeneID:5925 -> Biological process: GO:0048667 [cell morphogenesis involved in neuron differentiation] evidence: IEA
            GeneID:5925 -> Biological process: GO:0050680 [negative regulation of epithelial cell proliferation] evidence: IEA
            GeneID:5925 -> Biological process: GO:0051301 [cell division] evidence: IEA
            GeneID:5925 -> Biological process: GO:0051402 [neuron apoptotic process] evidence: IEA
            GeneID:5925 -> Biological process: GO:0071459 [protein localization to chromosome, centromeric region] evidence: IMP
            GeneID:5925 -> Biological process: GO:0071922 [regulation of cohesin localization to chromatin] evidence: IMP
            GeneID:5925 -> Biological process: GO:0071930 [negative regulation of transcription involved in G1/S phase of mitotic cell cycle] evidence: IEA
            GeneID:5925 -> Biological process: GO:0090230 [regulation of centromere complex assembly] evidence: TAS
            GeneID:5925 -> Biological process: GO:2000134 [negative regulation of G1/S transition of mitotic cell cycle] evidence: TAS
            GeneID:5925 -> Cellular component: GO:0000785 [chromatin] evidence: TAS
            GeneID:5925 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:5925 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
            GeneID:5925 -> Cellular component: GO:0005819 [spindle] evidence: IEA
            GeneID:5925 -> Cellular component: GO:0016514 [SWI/SNF complex] evidence: TAS
            GeneID:5925 -> Cellular component: GO:0016605 [PML body] evidence: IDA
            GeneID:5925 -> Cellular component: GO:0035189 [Rb-E2F complex] evidence: TAS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.