2024-03-28 22:35:58, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_000321 4772 bp mRNA linear PRI 15-JUL-2013 DEFINITION Homo sapiens retinoblastoma 1 (RB1), mRNA. ACCESSION NM_000321 VERSION NM_000321.2 GI:108773786 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 4772) AUTHORS Hilgendorf,K.I., Leshchiner,E.S., Nedelcu,S., Maynard,M.A., Calo,E., Ianari,A., Walensky,L.D. and Lees,J.A. TITLE The retinoblastoma protein induces apoptosis directly at the mitochondria JOURNAL Genes Dev. 27 (9), 1003-1015 (2013) PUBMED 23618872 REMARK GeneRIF: pRB potentiated TNFalpha-induced apoptosis even when translation was blocked. REFERENCE 2 (bases 1 to 4772) AUTHORS Reim,N.I., Kamil,J.P., Wang,D., Lin,A., Sharma,M., Ericsson,M., Pesola,J.M., Golan,D.E. and Coen,D.M. TITLE Inactivation of retinoblastoma protein does not overcome the requirement for human cytomegalovirus UL97 in lamina disruption and nuclear egress JOURNAL J. Virol. 87 (9), 5019-5027 (2013) PUBMED 23427156 REMARK GeneRIF: pRb inactivation is insufficient to restore efficient viral nuclear egress of human cytomegalovirus in the absence of UL97. REFERENCE 3 (bases 1 to 4772) AUTHORS Rushlow,D.E., Mol,B.M., Kennett,J.Y., Yee,S., Pajovic,S., Theriault,B.L., Prigoda-Lee,N.L., Spencer,C., Dimaras,H., Corson,T.W., Pang,R., Massey,C., Godbout,R., Jiang,Z., Zacksenhaus,E., Paton,K., Moll,A.C., Houdayer,C., Raizis,A., Halliday,W., Lam,W.L., Boutros,P.C., Lohmann,D., Dorsman,J.C. and Gallie,B.L. TITLE Characterisation of retinoblastomas without RB1 mutations: genomic, gene expression, and clinical studies JOURNAL Lancet Oncol. 14 (4), 327-334 (2013) PUBMED 23498719 REMARK GeneRIF: Amplification of the MYCN oncogene might initiate retinoblastoma in the presence of non-mutated RB1 genes. These unilateral RB1(+/+)MYCN(A) retinoblastomas are characterised by distinct histological features. REFERENCE 4 (bases 1 to 4772) AUTHORS Winkler,L.L., Hwang,J. and Kalejta,R.F. TITLE Ubiquitin-independent proteasomal degradation of tumor suppressors by human cytomegalovirus pp71 requires the 19S regulatory particle JOURNAL J. Virol. 87 (8), 4665-4671 (2013) PUBMED 23408605 REMARK GeneRIF: Authors show that only the proteasome 19S regulatory particle that normally participates in ubiquitin-dependent protein degradation, is required for human herpesvirus 5 pp71-mediated degradation of Rb and Daxx. REFERENCE 5 (bases 1 to 4772) AUTHORS Barbosa,R.H., Aguiar,F.C., Silva,M.F., Costa,R.A., Vargas,F.R., Lucena,E., Carvalho de Souza,M., de Almeida,L.M., Bittar,C., Ashton Prolla,P., Bonvicino,C.R. and Seuanez,H.N. TITLE Screening of RB1 alterations in Brazilian patients with retinoblastoma and relatives with retinoma: phenotypic and genotypic associations JOURNAL Invest. Ophthalmol. Vis. Sci. 54 (5), 3184-3194 (2013) PUBMED 23532519 REMARK GeneRIF: Fifteen substitutions (4 intronic and 11 exonic) were identified as probably or likely pathogenic. Four of these 11 exonic substitutions were novel. Publication Status: Online-Only REFERENCE 6 (bases 1 to 4772) AUTHORS Huang,S., Shin,E., Sheppard,K.A., Chokroverty,L., Shan,B., Qian,Y.W., Lee,E.Y. and Yee,A.S. TITLE The retinoblastoma protein region required for interaction with the E2F transcription factor includes the T/E1A binding and carboxy-terminal sequences JOURNAL DNA Cell Biol. 11 (7), 539-548 (1992) PUBMED 1388726 REFERENCE 7 (bases 1 to 4772) AUTHORS Kim,S.J., Wagner,S., Liu,F., O'Reilly,M.A., Robbins,P.D. and Green,M.R. TITLE Retinoblastoma gene product activates expression of the human TGF-beta 2 gene through transcription factor ATF-2 JOURNAL Nature 358 (6384), 331-334 (1992) PUBMED 1641004 REFERENCE 8 (bases 1 to 4772) AUTHORS Onadim,Z., Hogg,A., Baird,P.N. and Cowell,J.K. TITLE Oncogenic point mutations in exon 20 of the RB1 gene in families showing incomplete penetrance and mild expression of the retinoblastoma phenotype JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (13), 6177-6181 (1992) PUBMED 1352883 REFERENCE 9 (bases 1 to 4772) AUTHORS Hogg,A., Onadim,Z., Baird,P.N. and Cowell,J.K. TITLE Detection of heterozygous mutations in the RB1 gene in retinoblastoma patients using single-strand conformation polymorphism analysis and polymerase chain reaction sequencing JOURNAL Oncogene 7 (7), 1445-1451 (1992) PUBMED 1352398 REFERENCE 10 (bases 1 to 4772) AUTHORS Faha,B., Ewen,M.E., Tsai,L.H., Livingston,D.M. and Harlow,E. TITLE Interaction between human cyclin A and adenovirus E1A-associated p107 protein JOURNAL Science 255 (5040), 87-90 (1992) PUBMED 1532458 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL392048.9, BC040540.1 and L41870.1. This sequence is a reference standard in the RefSeqGene project. On Jun 9, 2006 this sequence version replaced gi:4506434. Summary: The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC040540.1, L41870.1, BC040540.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025081, ERS025082 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-5 AL392048.9 15305-15309 6-4769 BC040540.1 2-4765 4770-4772 L41870.1 4741-4743 FEATURES Location/Qualifiers source 1..4772 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="13" /map="13q14.2" gene 1..4772 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /note="retinoblastoma 1" /db_xref="GeneID:5925" /db_xref="HGNC:9884" /db_xref="MIM:614041" exon 1..303 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" misc_feature 65..67 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /note="upstream in-frame stop codon" CDS 167..2953 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /note="retinoblastoma suspectibility protein" /codon_start=1 /product="retinoblastoma-associated protein" /protein_id="NP_000312.2" /db_xref="GI:108773787" /db_xref="CCDS:CCDS31973.1" /db_xref="GeneID:5925" /db_xref="HGNC:9884" /db_xref="MIM:614041" /translation="
MPPKTPRKTAATAAAAAAEPPAPPPPPPPEEDPEQDSGPEDLPLVRLEFEETEEPDFTALCQKLKIPDHVRERAWLTWEKVSSVDGVLGGYIQKKKELWGICIFIAAVDLDEMSFTFTELQKNIEISVHKFFNLLKEIDTSTKVDNAMSRLLKKYDVLFALFSKLERTCELIYLTQPSSSISTEINSALVLKVSWITFLLAKGEVLQMEDDLVISFQLMLCVLDYFIKLSPPMLLKEPYKTAVIPINGSPRTPRRGQNRSARIAKQLENDTRIIEVLCKEHECNIDEVKNVYFKNFIPFMNSLGLVTSNGLPEVENLSKRYEEIYLKNKDLDARLFLDHDKTLQTDSIDSFETQRTPRKSNLDEEVNVIPPHTPVRTVMNTIQQLMMILNSASDQPSENLISYFNNCTVNPKESILKRVKDIGYIFKEKFAKAVGQGCVEIGSQRYKLGVRLYYRVMESMLKSEEERLSIQNFSKLLNDNIFHMSLLACALEVVMATYSRSTSQNLDSGTDLSFPWILNVLNLKAFDFYKVIESFIKAEGNLTREMIKHLERCEHRIMESLAWLSDSPLFDLIKQSKDREGPTDHLESACPLNLPLQNNHTAADMYLSPVRSPKKKGSTTRVNSTANAETQATSAFQTQKPLKSTSLSLFYKKVYRLAYLRLNTLCERLLSEHPELEHIIWTLFQHTLQNEYELMRDRHLDQIMMCSMYGICKVKNIDLKFKIIVTAYKDLPHAVQETFKRVLIKEEEYDSIIVFYNSVFMQRLKTNILQYASTRPPTLSPIPHIPRSPYKFPSSPLRIPGGNIYISPLKSPYKISEGLPTPTKMTPRSRILVSIGESFGTSEKFQKINQMVCNSDRVLKRSAEGSNPPKPLKKLRFDIEGSDEADGSKHLPGESKFQQKLAEMTSTRTRMQKQKMNDSMDTSNKEEK
" misc_feature 179..181 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00447" misc_feature 275..277 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (P06400.2); phosphorylation site" misc_feature 509..850 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /note="Domain of unknown function (DUF3452); Region: DUF3452; pfam11934" /db_xref="CDD:152369" misc_feature 854..856 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00310" misc_feature 911..913 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine, by CDK1; propagated from UniProtKB/Swiss-Prot (P06400.2); phosphorylation site" misc_feature 911..913 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00302" misc_feature 920..922 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine, by CDK1; propagated from UniProtKB/Swiss-Prot (P06400.2); phosphorylation site" misc_feature 920..922 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00302" misc_feature 1211..1213 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="proteolytic cleavage site; modified site" /db_xref="HPRD:02799" misc_feature 1211..1213 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="proteolytic cleavage site; modified site" /db_xref="HPRD:03457" misc_feature 1232..1234 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine; propagated from UniProtKB/Swiss-Prot (P06400.2); phosphorylation site" misc_feature 1232..1234 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00447" misc_feature 1283..2479 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P06400.2); Region: Pocket, binds T and E1A" misc_feature 1283..1903 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P06400.2); Region: Domain A" misc_feature 1283..1885 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /note="Retinoblastoma-associated protein A domain; Region: RB_A; pfam01858" /db_xref="CDD:202014" misc_feature 1283..1285 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine, by CDK1; propagated from UniProtKB/Swiss-Prot (P06400.2); phosphorylation site" misc_feature 1283..1285 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00302" misc_feature 1865..1867 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine, by CDK2; propagated from UniProtKB/Swiss-Prot (P06400.2); phosphorylation site" misc_feature 1865..1867 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00310" misc_feature 1904..2083 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P06400.2); Region: Spacer" misc_feature 1988..1990 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00310" misc_feature 2000..2002 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine, by CHEK2 and CHEK1; propagated from UniProtKB/Swiss-Prot (P06400.2); phosphorylation site" misc_feature 2000..2002 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00310" misc_feature 2084..2479 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P06400.2); Region: Domain B" misc_feature 2099..2464 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /note="Retinoblastoma-associated protein B domain; Region: RB_B; pfam01857" /db_xref="CDD:202013" misc_feature 2453..2950 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P06400.2); Region: Interaction with LIMD1" misc_feature 2468..2947 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /note="Rb C-terminal domain; Region: Rb_C; pfam08934" /db_xref="CDD:149868" misc_feature 2477..2950 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P06400.2); Region: Domain C, mediates interaction with E4F1" misc_feature 2504..2506 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00447" misc_feature 2504..2506 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00451" misc_feature 2504..2506 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 2528..2530 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00447" misc_feature 2549..2551 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00447" misc_feature 2549..2551 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 2585..2587 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine, by CDK1 and CDK3; propagated from UniProtKB/Swiss-Prot (P06400.2); phosphorylation site" misc_feature 2585..2587 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00302" misc_feature 2585..2587 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00310" misc_feature 2594..2596 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="N6-methyllysine, by SMYD2; propagated from UniProtKB/Swiss-Prot (P06400.2); methylation site" misc_feature 2597..2599 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine, by CDK1 and CDK3; propagated from UniProtKB/Swiss-Prot (P06400.2); phosphorylation site" misc_feature 2597..2599 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00302" misc_feature 2597..2599 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00310" misc_feature 2627..2629 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine, by CDK6; propagated from UniProtKB/Swiss-Prot (P06400.2); phosphorylation site" misc_feature 2627..2629 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00310" misc_feature 2633..2635 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine; propagated from UniProtKB/Swiss-Prot (P06400.2); phosphorylation site" misc_feature 2642..2644 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine, by CDK4; propagated from UniProtKB/Swiss-Prot (P06400.2); phosphorylation site" misc_feature 2642..2644 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00447" misc_feature 2687..2689 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine; propagated from UniProtKB/Swiss-Prot (P06400.2); phosphorylation site" misc_feature 2744..2746 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="N6-methyllysine, by SMYD2; propagated from UniProtKB/Swiss-Prot (P06400.2); methylation site" misc_feature 2774..2794 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P06400.2); Region: Nuclear localization signal (Probable)" misc_feature 2783..2785 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="N6-acetyllysine, by PCAF; propagated from UniProtKB/Swiss-Prot (P06400.2); acetylation site" misc_feature 2783..2785 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="acetylation site" /db_xref="HPRD:04078" misc_feature 2786..2788 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="N6-acetyllysine, by PCAF; propagated from UniProtKB/Swiss-Prot (P06400.2); acetylation site" misc_feature 2786..2788 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /experiment="experimental evidence, no additional details recorded" /note="acetylation site" /db_xref="HPRD:04078" variation 208 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:148980395" variation 228..229 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="g" /db_xref="dbSNP:34437965" exon 304..430 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 339 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:138574644" variation 341 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="g" /db_xref="dbSNP:184754468" variation 343 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="t" /db_xref="dbSNP:189574280" variation 380 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:369833913" exon 431..546 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 432 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:371655281" variation 489 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:376408183" variation 507 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:139673557" variation 530..531 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="a" /db_xref="dbSNP:67045046" variation 533 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:149800437" exon 547..666 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 563 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="c" /db_xref="dbSNP:3092900" variation 575 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="g" /replace="t" /db_xref="dbSNP:121913296" variation 576..577 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="a" /db_xref="dbSNP:66936947" variation 577 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="t" /db_xref="dbSNP:3092902" variation 628 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:369830657" variation 659 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="t" /db_xref="dbSNP:66624868" exon 667..705 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 705 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:367654488" exon 706..773 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 715 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="g" /replace="t" /db_xref="dbSNP:147793910" variation 735 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="g" /replace="t" /db_xref="dbSNP:141366046" variation 762 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="t" /db_xref="dbSNP:121913298" exon 774..884 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 794 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="g" /replace="t" /db_xref="dbSNP:148992508" variation 800 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:147085238" variation 824 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:367960214" exon 885..1027 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 897 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:147754935" variation 927 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:200674097" variation 998..999 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="t" /db_xref="dbSNP:121908691" exon 1028..1105 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 1042..1043 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="t" /db_xref="dbSNP:67246835" variation 1046..1047 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="a" /db_xref="dbSNP:66519118" variation 1086 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:183898408" variation 1095 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:200844292" exon 1106..1215 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 1124 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:121913300" variation 1129 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:377235036" variation 1131 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:142620145" exon 1216..1293 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 1238 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:121913301" variation 1268 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:1049721" exon 1294..1381 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 1295 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="t" /db_xref="dbSNP:146897002" variation 1306 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:117865557" variation 1325 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="t" /db_xref="dbSNP:190689977" variation 1329 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="g" /replace="t" /db_xref="dbSNP:373623059" variation 1330 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:375239544" variation 1333..1334 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="t" /db_xref="dbSNP:67850338" variation 1339 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="t" /db_xref="dbSNP:1049722" variation 1340 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:181988132" exon 1382..1498 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 1390 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:371805499" variation 1472 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="c" /db_xref="dbSNP:4151534" variation 1485..1486 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="a" /db_xref="dbSNP:66805009" exon 1499..1555 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 1499 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:3092891" variation 1522 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:201285819" variation 1529 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:121913302" exon 1556..1587 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 1574 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="c" /db_xref="dbSNP:139960834" exon 1588..1664 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 1613..1614 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="a" /db_xref="dbSNP:34873197" variation 1614..1615 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="a" /db_xref="dbSNP:5803433" variation 1615 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:367661403" variation 1633 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:141608408" variation 1634 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:201458896" variation 1657 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="t" /db_xref="dbSNP:150115447" exon 1665..1861 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 1677 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="t" /db_xref="dbSNP:146801558" variation 1678 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:140500741" variation 1697 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:145729675" variation 1712 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="g" /replace="t" /db_xref="dbSNP:138201027" variation 1723 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="g" /replace="t" /db_xref="dbSNP:149620934" variation 1740 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="g" /db_xref="dbSNP:4151539" variation 1758 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="g" /replace="t" /db_xref="dbSNP:143324585" variation 1781 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:148379933" variation 1783 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="c" /db_xref="dbSNP:371031574" variation 1797 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:143269980" variation 1798 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:143948310" variation 1817 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:147534828" variation 1820 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:121913303" variation 1821 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:146236493" variation 1832 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:121913304" variation 1839 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="g" /replace="t" /db_xref="dbSNP:139494954" variation 1848 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:143400770" variation 1849 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:150542946" variation 1853 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="g" /replace="t" /db_xref="dbSNP:139500527" exon 1862..1980 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 1866 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:137853292" variation 1873 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:3092895" variation 1901 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:121913305" variation 1907 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:375645171" variation 1936 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:145310579" variation 1944 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:138033832" variation 1962 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:3092896" exon 1981..2126 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 1984 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="t" /db_xref="dbSNP:137853297" variation 2027 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="c" /db_xref="dbSNP:367578442" variation 2028 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:373601944" variation 2053 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="g" /db_xref="dbSNP:367668687" variation 2109 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="c" /db_xref="dbSNP:121908692" exon 2127..2272 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 2132 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:142509759" variation 2133 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:202031219" STS 2134..2221 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /standard_name="PMC193706P1" /db_xref="UniSTS:271756" variation 2138 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:202119986" variation 2146..2149 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="ccgg" /db_xref="dbSNP:121913299" variation 2147 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:137853294" variation 2168 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:369755801" variation 2183 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="g" /db_xref="dbSNP:79200171" variation 2189 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="g" /replace="t" /db_xref="dbSNP:137853295" variation 2199 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="t" /db_xref="dbSNP:201046651" variation 2227 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:113432974" variation 2257 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="g" /db_xref="dbSNP:3092903" exon 2273..2377 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 2283 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="g" /replace="t" /db_xref="dbSNP:121913295" variation 2300 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:137853296" variation 2352 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:150600740" variation 2375 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="g" /db_xref="dbSNP:66644190" exon 2378..2491 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 2403 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:3092905" variation 2408 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="g" /replace="t" /db_xref="dbSNP:121913297" variation 2419 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="t" /db_xref="dbSNP:373070661" variation 2456 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="g" /db_xref="dbSNP:138637932" exon 2492..2655 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 2525 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:137853293" variation 2535..2536 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="t" /db_xref="dbSNP:67412362" variation 2554 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="c" /db_xref="dbSNP:66482475" variation 2558 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:187912365" variation 2559 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:374523971" variation 2621 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:375751988" variation 2629 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:370088029" variation 2630 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="g" /db_xref="dbSNP:368413787" exon 2656..2686 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 2684 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:374157786" exon 2687..2829 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 2725 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:148327780" variation 2732 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:149359120" variation 2734..2735 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="c" /db_xref="dbSNP:66961080" variation 2736 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:144668210" variation 2749 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:377205343" variation 2792 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:143105337" exon 2830..2879 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" STS 2878..3207 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /standard_name="RB1-3UUTF" /db_xref="UniSTS:43719" exon 2880..4772 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /inference="alignment:Splign:1.39.8" variation 2925 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:148501460" variation 2982 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="g" /replace="t" /db_xref="dbSNP:372459968" variation 2984 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:377188800" variation 2985 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="t" /db_xref="dbSNP:370626097" variation 2988 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:376192929" variation 2989 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="g" /db_xref="dbSNP:368462035" variation 2996 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:371663196" variation 3004 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="c" /db_xref="dbSNP:76558254" variation 3069..3070 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="t" /db_xref="dbSNP:66652813" variation 3080 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:182470177" STS 3090..3435 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /standard_name="D10S2288" /db_xref="UniSTS:25849" STS 3104..3268 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /standard_name="RH17613" /db_xref="UniSTS:73965" variation 3111 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="g" /replace="t" /db_xref="dbSNP:1049723" variation 3125 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:143536240" variation 3137 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="t" /db_xref="dbSNP:4151630" variation 3195 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:148064671" variation 3269 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="t" /db_xref="dbSNP:187845274" variation 3416 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="t" /db_xref="dbSNP:4151631" variation 3527 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:150194261" variation 3656 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="g" /replace="t" /db_xref="dbSNP:139023385" variation 3750 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="t" /db_xref="dbSNP:143145266" variation 3808 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:4151632" variation 3917 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="g" /db_xref="dbSNP:4151633" variation 3989 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="g" /replace="t" /db_xref="dbSNP:192758219" variation 4061..4062 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="t" /db_xref="dbSNP:200353673" variation 4213 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="a" /replace="g" /db_xref="dbSNP:143174150" variation 4232 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:182363120" variation 4278 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="g" /db_xref="dbSNP:371878105" variation 4419 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:1804280" variation 4500 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:4151634" variation 4631 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:1804276" variation 4640 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:4151635" variation 4669 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="" /replace="t" /db_xref="dbSNP:371337708" variation 4708 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" /replace="c" /replace="t" /db_xref="dbSNP:376808474" polyA_signal 4747..4752 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" polyA_site 4768 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" polyA_site 4772 /gene="RB1" /gene_synonym="OSRC; p105-Rb; pp110; pRb; RB" ORIGIN
gctcagttgccgggcgggggagggcgcgtccggtttttctcaggggacgttgaaattatttttgtaacgggagtcgggagaggacggggcgtgccccgacgtgcgcgcgcgtcgtcctccccggcgctcctccacagctcgctggctcccgccgcggaaaggcgtcatgccgcccaaaaccccccgaaaaacggccgccaccgccgccgctgccgccgcggaacccccggcaccgccgccgccgccccctcctgaggaggacccagagcaggacagcggcccggaggacctgcctctcgtcaggcttgagtttgaagaaacagaagaacctgattttactgcattatgtcagaaattaaagataccagatcatgtcagagagagagcttggttaacttgggagaaagtttcatctgtggatggagtattgggaggttatattcaaaagaaaaaggaactgtggggaatctgtatctttattgcagcagttgacctagatgagatgtcgttcacttttactgagctacagaaaaacatagaaatcagtgtccataaattctttaacttactaaaagaaattgataccagtaccaaagttgataatgctatgtcaagactgttgaagaagtatgatgtattgtttgcactcttcagcaaattggaaaggacatgtgaacttatatatttgacacaacccagcagttcgatatctactgaaataaattctgcattggtgctaaaagtttcttggatcacatttttattagctaaaggggaagtattacaaatggaagatgatctggtgatttcatttcagttaatgctatgtgtccttgactattttattaaactctcacctcccatgttgctcaaagaaccatataaaacagctgttatacccattaatggttcacctcgaacacccaggcgaggtcagaacaggagtgcacggatagcaaaacaactagaaaatgatacaagaattattgaagttctctgtaaagaacatgaatgtaatatagatgaggtgaaaaatgtttatttcaaaaattttataccttttatgaattctcttggacttgtaacatctaatggacttccagaggttgaaaatctttctaaacgatacgaagaaatttatcttaaaaataaagatctagatgcaagattatttttggatcatgataaaactcttcagactgattctatagacagttttgaaacacagagaacaccacgaaaaagtaaccttgatgaagaggtgaatgtaattcctccacacactccagttaggactgttatgaacactatccaacaattaatgatgattttaaattcagcaagtgatcaaccttcagaaaatctgatttcctattttaacaactgcacagtgaatccaaaagaaagtatactgaaaagagtgaaggatataggatacatctttaaagagaaatttgctaaagctgtgggacagggttgtgtcgaaattggatcacagcgatacaaacttggagttcgcttgtattaccgagtaatggaatccatgcttaaatcagaagaagaacgattatccattcaaaattttagcaaacttctgaatgacaacatttttcatatgtctttattggcgtgcgctcttgaggttgtaatggccacatatagcagaagtacatctcagaatcttgattctggaacagatttgtctttcccatggattctgaatgtgcttaatttaaaagcctttgatttttacaaagtgatcgaaagttttatcaaagcagaaggcaacttgacaagagaaatgataaaacatttagaacgatgtgaacatcgaatcatggaatcccttgcatggctctcagattcacctttatttgatcttattaaacaatcaaaggaccgagaaggaccaactgatcaccttgaatctgcttgtcctcttaatcttcctctccagaataatcacactgcagcagatatgtatctttctcctgtaagatctccaaagaaaaaaggttcaactacgcgtgtaaattctactgcaaatgcagagacacaagcaacctcagccttccagacccagaagccattgaaatctacctctctttcactgttttataaaaaagtgtatcggctagcctatctccggctaaatacactttgtgaacgccttctgtctgagcacccagaattagaacatatcatctggacccttttccagcacaccctgcagaatgagtatgaactcatgagagacaggcatttggaccaaattatgatgtgttccatgtatggcatatgcaaagtgaagaatatagaccttaaattcaaaatcattgtaacagcatacaaggatcttcctcatgctgttcaggagacattcaaacgtgttttgatcaaagaagaggagtatgattctattatagtattctataactcggtcttcatgcagagactgaaaacaaatattttgcagtatgcttccaccaggccccctaccttgtcaccaatacctcacattcctcgaagcccttacaagtttcctagttcacccttacggattcctggagggaacatctatatttcacccctgaagagtccatataaaatttcagaaggtctgccaacaccaacaaaaatgactccaagatcaagaatcttagtatcaattggtgaatcattcgggacttctgagaagttccagaaaataaatcagatggtatgtaacagcgaccgtgtgctcaaaagaagtgctgaaggaagcaaccctcctaaaccactgaaaaaactacgctttgatattgaaggatcagatgaagcagatggaagtaaacatctcccaggagagtccaaatttcagcagaaactggcagaaatgacttctactcgaacacgaatgcaaaagcagaaaatgaatgatagcatggatacctcaaacaaggaagagaaatgaggatctcaggaccttggtggacactgtgtacacctctggattcattgtctctcacagatgtgactgtataactttcccaggttctgtttatggccacatttaatatcttcagctctttttgtggatataaaatgtgcagatgcaattgtttgggtgattcctaagccacttgaaatgttagtcattgttatttatacaagattgaaaatcttgtgtaaatcctgccatttaaaaagttgtagcagattgtttcctcttccaaagtaaaattgctgtgctttatggatagtaagaatggccctagagtgggagtcctgataacccaggcctgtctgactactttgccttcttttgtagcatataggtgatgtttgctcttgtttttattaatttatatgtatatttttttaatttaacatgaacacccttagaaaatgtgtcctatctatcttccaaatgcaatttgattgactgcccattcaccaaaattatcctgaactcttctgcaaaaatggatattattagaaattagaaaaaaattactaattttacacattagattttattttactattggaatctgatatactgtgtgcttgttttataaaattttgcttttaattaaataaaagctggaagcaaagtataaccatatgatactatcatactactgaaacagatttcatacctcagaatgtaaaagaacttactgattattttcttcatccaacttatgtttttaaatgaggattattgatagtactcttggtttttataccattcagatcactgaatttataaagtacccatctagtacttgaaaaagtaaagtgttctgccagatcttaggtatagaggaccctaacacagtatatcccaagtgcactttctaatgtttctgggtcctgaagaattaagatacaaattaattttactccataaacagactgttaattataggagccttaatttttttttcatagagatttgtctaattgcatctcaaaattattctgccctccttaatttgggaaggtttgtgttttctctggaatggtacatgtcttccatgtatcttttgaactggcaattgtctatttatcttttatttttttaagtcagtatggtctaacactggcatgttcaaagccacattatttctagtccaaaattacaagtaatcaagggtcattatgggttaggcattaatgtttctatctgattttgtgcaaaagcttcaaattaaaacagctgcattagaaaaagaggcgcttctcccctcccctacacctaaaggtgtatttaaactatcttgtgtgattaacttatttagagatgctgtaacttaaaataggggatatttaaggtagcttcagctagcttttaggaaaatcactttgtctaactcagaattatttttaaaaagaaatctggtcttgttagaaaacaaaattttattttgtgctcatttaagtttcaaacttactattttgacagttattttgataacaatgacactagaaaacttgactccatttcatcattgtttctgcatgaatatcatacaaatcagttagtttttaggtcaagggcttactatttctgggtcttttgctactaagttcacattagaattagtgccagaattttaggaacttcagagatcgtgtattgagatttcttaaataatgcttcagatattattgctttattgcttttttgtattggttaaaactgtacatttaaaattgctatgttactattttctacaattaatagtttgtctattttaaaataaattagttgttaagagtcttaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:5925 -> Molecular function: GO:0001047 [core promoter binding] evidence: IDA GeneID:5925 -> Molecular function: GO:0001102 [RNA polymerase II activating transcription factor binding] evidence: IEA GeneID:5925 -> Molecular function: GO:0003677 [DNA binding] evidence: TAS GeneID:5925 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: TAS GeneID:5925 -> Molecular function: GO:0003713 [transcription coactivator activity] evidence: NAS GeneID:5925 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:5925 -> Molecular function: GO:0008134 [transcription factor binding] evidence: IPI GeneID:5925 -> Molecular function: GO:0019900 [kinase binding] evidence: IDA GeneID:5925 -> Molecular function: GO:0031625 [ubiquitin protein ligase binding] evidence: IPI GeneID:5925 -> Molecular function: GO:0050681 [androgen receptor binding] evidence: NAS GeneID:5925 -> Molecular function: GO:0051219 [phosphoprotein binding] evidence: IPI GeneID:5925 -> Biological process: GO:0000075 [cell cycle checkpoint] evidence: TAS GeneID:5925 -> Biological process: GO:0000082 [G1/S transition of mitotic cell cycle] evidence: TAS GeneID:5925 -> Biological process: GO:0000083 [regulation of transcription involved in G1/S phase of mitotic cell cycle] evidence: TAS GeneID:5925 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS GeneID:5925 -> Biological process: GO:0006338 [chromatin remodeling] evidence: TAS GeneID:5925 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:5925 -> Biological process: GO:0006469 [negative regulation of protein kinase activity] evidence: IPI GeneID:5925 -> Biological process: GO:0007050 [cell cycle arrest] evidence: TAS GeneID:5925 -> Biological process: GO:0007070 [negative regulation of transcription from RNA polymerase II promoter during mitosis] evidence: TAS GeneID:5925 -> Biological process: GO:0007093 [mitotic cell cycle checkpoint] evidence: TAS GeneID:5925 -> Biological process: GO:0007265 [Ras protein signal transduction] evidence: IEP GeneID:5925 -> Biological process: GO:0007346 [regulation of mitotic cell cycle] evidence: IMP GeneID:5925 -> Biological process: GO:0019048 [modulation by virus of host morphology or physiology] evidence: IEA GeneID:5925 -> Biological process: GO:0030521 [androgen receptor signaling pathway] evidence: NAS GeneID:5925 -> Biological process: GO:0031134 [sister chromatid biorientation] evidence: IMP GeneID:5925 -> Biological process: GO:0031175 [neuron projection development] evidence: IEA GeneID:5925 -> Biological process: GO:0034088 [maintenance of mitotic sister chromatid cohesion] evidence: IMP GeneID:5925 -> Biological process: GO:0035914 [skeletal muscle cell differentiation] evidence: IEA GeneID:5925 -> Biological process: GO:0042551 [neuron maturation] evidence: IEA GeneID:5925 -> Biological process: GO:0043353 [enucleate erythrocyte differentiation] evidence: IEA GeneID:5925 -> Biological process: GO:0043433 [negative regulation of sequence-specific DNA binding transcription factor activity] evidence: TAS GeneID:5925 -> Biological process: GO:0043550 [regulation of lipid kinase activity] evidence: IDA GeneID:5925 -> Biological process: GO:0045445 [myoblast differentiation] evidence: IMP GeneID:5925 -> Biological process: GO:0045651 [positive regulation of macrophage differentiation] evidence: IEA GeneID:5925 -> Biological process: GO:0045842 [positive regulation of mitotic metaphase/anaphase transition] evidence: IMP GeneID:5925 -> Biological process: GO:0045879 [negative regulation of smoothened signaling pathway] evidence: IEA GeneID:5925 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IDA GeneID:5925 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: TAS GeneID:5925 -> Biological process: GO:0045893 [positive regulation of transcription, DNA-dependent] evidence: NAS GeneID:5925 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IEA GeneID:5925 -> Biological process: GO:0048565 [digestive tract development] evidence: IEA GeneID:5925 -> Biological process: GO:0048667 [cell morphogenesis involved in neuron differentiation] evidence: IEA GeneID:5925 -> Biological process: GO:0050680 [negative regulation of epithelial cell proliferation] evidence: IEA GeneID:5925 -> Biological process: GO:0051301 [cell division] evidence: IEA GeneID:5925 -> Biological process: GO:0051402 [neuron apoptotic process] evidence: IEA GeneID:5925 -> Biological process: GO:0071459 [protein localization to chromosome, centromeric region] evidence: IMP GeneID:5925 -> Biological process: GO:0071922 [regulation of cohesin localization to chromatin] evidence: IMP GeneID:5925 -> Biological process: GO:0071930 [negative regulation of transcription involved in G1/S phase of mitotic cell cycle] evidence: IEA GeneID:5925 -> Biological process: GO:0090230 [regulation of centromere complex assembly] evidence: TAS GeneID:5925 -> Biological process: GO:2000134 [negative regulation of G1/S transition of mitotic cell cycle] evidence: TAS GeneID:5925 -> Cellular component: GO:0000785 [chromatin] evidence: TAS GeneID:5925 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:5925 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS GeneID:5925 -> Cellular component: GO:0005819 [spindle] evidence: IEA GeneID:5925 -> Cellular component: GO:0016514 [SWI/SNF complex] evidence: TAS GeneID:5925 -> Cellular component: GO:0016605 [PML body] evidence: IDA GeneID:5925 -> Cellular component: GO:0035189 [Rb-E2F complex] evidence: TAS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.