2024-03-28 20:53:14, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_000165 3130 bp mRNA linear PRI 15-JUL-2013 DEFINITION Homo sapiens gap junction protein, alpha 1, 43kDa (GJA1), mRNA. ACCESSION NM_000165 VERSION NM_000165.3 GI:122939163 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3130) AUTHORS Kim,M.S., Gloor,G.B. and Bai,D. TITLE The distribution and functional properties of Pelizaeus-Merzbacher-like disease-linked Cx47 mutations on Cx47/Cx47 homotypic and Cx47/Cx43 heterotypic gap junctions JOURNAL Biochem. J. 452 (2), 249-258 (2013) PUBMED 23544880 REMARK GeneRIF: Most of the Pelizaeus-Merzbacher-like disease (PMLD)-linked Cx47 mutants disrupt Cx47/Cx47 and Cx47/Cx43 gap junction function in the glial network, which may play a role in leading to PMLD disease symptoms REFERENCE 2 (bases 1 to 3130) AUTHORS Chang,H.M., Cheng,J.C. and Leung,P.C. TITLE Theca-derived BMP4 and BMP7 down-regulate connexin43 expression and decrease gap junction intercellular communication activity in immortalized human granulosa cells JOURNAL J. Clin. Endocrinol. Metab. 98 (3), E437-E445 (2013) PUBMED 23386650 REMARK GeneRIF: Theca cell-derived BMP4 and BMP7 down-regulate Cx43 expression and decrease gap junction cell communication activity in human granulosa cells. REFERENCE 3 (bases 1 to 3130) AUTHORS Deo,R., Nalls,M.A., Avery,C.L., Smith,J.G., Evans,D.S., Keller,M.F., Butler,A.M., Buxbaum,S.G., Li,G., Miguel Quibrera,P., Smith,E.N., Tanaka,T., Akylbekova,E.L., Alonso,A., Arking,D.E., Benjamin,E.J., Berenson,G.S., Bis,J.C., Chen,L.Y., Chen,W., Cummings,S.R., Ellinor,P.T., Evans,M.K., Ferrucci,L., Fox,E.R., Heckbert,S.R., Heiss,G., Hsueh,W.C., Kerr,K.F., Limacher,M.C., Liu,Y., Lubitz,S.A., Magnani,J.W., Mehra,R., Marcus,G.M., Murray,S.S., Newman,A.B., Njajou,O., North,K.E., Paltoo,D.N., Psaty,B.M., Redline,S.S., Reiner,A.P., Robinson,J.G., Rotter,J.I., Samdarshi,T.E., Schnabel,R.B., Schork,N.J., Singleton,A.B., Siscovick,D., Soliman,E.Z., Sotoodehnia,N., Srinivasan,S.R., Taylor,H.A., Trevisan,M., Zhang,Z., Zonderman,A.B., Newton-Cheh,C. and Whitsel,E.A. TITLE Common genetic variation near the connexin-43 gene is associated with resting heart rate in African Americans: a genome-wide association study of 13,372 participants JOURNAL Heart Rhythm 10 (3), 401-408 (2013) PUBMED 23183192 REFERENCE 4 (bases 1 to 3130) AUTHORS Wang,Y., Wang,K., Li,H., Chen,L., Xu,F. and Wu,T. TITLE Effects of different sustained hydrostatic pressures on connexin 43 in human bladder smooth muscle cells JOURNAL Urol. Int. 90 (1), 75-82 (2013) PUBMED 23257890 REMARK GeneRIF: The expression of gap-junction Cx43 in bladder smooth muscle cells decreases under sustained hydrostatic pressures above the physiological level in the longer term. REFERENCE 5 (bases 1 to 3130) AUTHORS Severino,A., Narducci,M.L., Pedicino,D., Pazzano,V., Giglio,A.F., Biasucci,L.M., Liuzzo,G., Casella,M., Bartoletti,S., Dello Russo,A., Pelargonio,G., Santangeli,P., Di Biase,L., Natale,A. and Crea,F. TITLE Reversible atrial gap junction remodeling during hypoxia/reoxygenation and ischemia: a possible arrhythmogenic substrate for atrial fibrillation JOURNAL Gen. Physiol. Biophys. 31 (4), 439-448 (2012) PUBMED 23255671 REMARK GeneRIF: Hypoxia and ischemia per se downregulate Cx43 protein expression in atrial cardiomyocytes. REFERENCE 6 (bases 1 to 3130) AUTHORS Britz-Cunningham,S.H., Shah,M.M., Zuppan,C.W. and Fletcher,W.H. TITLE Mutations of the Connexin43 gap-junction gene in patients with heart malformations and defects of laterality JOURNAL N. Engl. J. Med. 332 (20), 1323-1329 (1995) PUBMED 7715640 REFERENCE 7 (bases 1 to 3130) AUTHORS De Leon,J.R., Buttrick,P.M. and Fishman,G.I. TITLE Functional analysis of the connexin43 gene promoter in vivo and in vitro JOURNAL J. Mol. Cell. Cardiol. 26 (3), 379-389 (1994) PUBMED 8028021 REFERENCE 8 (bases 1 to 3130) AUTHORS Fishman,G.I., Moreno,A.P., Spray,D.C. and Leinwand,L.A. TITLE Functional analysis of human cardiac gap junction channel mutants JOURNAL Proc. Natl. Acad. Sci. U.S.A. 88 (9), 3525-3529 (1991) PUBMED 1850831 REFERENCE 9 (bases 1 to 3130) AUTHORS Fishman,G.I., Eddy,R.L., Shows,T.B., Rosenthal,L. and Leinwand,L.A. TITLE The human connexin gene family of gap junction proteins: distinct chromosomal locations but similar structures JOURNAL Genomics 10 (1), 250-256 (1991) PUBMED 1646158 REFERENCE 10 (bases 1 to 3130) AUTHORS Fishman,G.I., Spray,D.C. and Leinwand,L.A. TITLE Molecular characterization and functional expression of the human cardiac gap junction channel JOURNAL J. Cell Biol. 111 (2), 589-598 (1990) PUBMED 1696265 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL139098.15 and X52947.1. This sequence is a reference standard in the RefSeqGene project. On Jan 18, 2007 this sequence version replaced gi:4755136. Summary: This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. The encoded protein is the major protein of gap junctions in the heart that are thought to have a crucial role in the synchronized contraction of the heart and in embryonic development. A related intronless pseudogene has been mapped to chromosome 5. Mutations in this gene have been associated with oculodentodigital dysplasia and heart malformations. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: X52947.1, BC026329.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025081, ERS025082 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-93 AL139098.15 101757-101849 94-2172 X52947.1 1-2079 2173-3130 AL139098.15 114928-115885 FEATURES Location/Qualifiers source 1..3130 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="6" /map="6q22.31" gene 1..3130 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /note="gap junction protein, alpha 1, 43kDa" /db_xref="GeneID:2697" /db_xref="HGNC:4274" /db_xref="HPRD:00414" /db_xref="MIM:121014" exon 1..234 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /inference="alignment:Splign:1.39.8" variation 85 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="" /replace="a" /db_xref="dbSNP:201864842" variation 109 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:185966088" variation 141 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:190869601" variation 180 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="g" /replace="t" /db_xref="dbSNP:200606693" variation 184 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="g" /db_xref="dbSNP:111581053" misc_feature 224..226 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /note="upstream in-frame stop codon" exon 235..3130 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /inference="alignment:Splign:1.39.8" variation 238 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:370799274" CDS 251..1399 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /note="connexin 43; gap junction 43 kDa heart protein; connexin-43" /codon_start=1 /product="gap junction alpha-1 protein" /protein_id="NP_000156.1" /db_xref="GI:4504001" /db_xref="CCDS:CCDS5123.1" /db_xref="GeneID:2697" /db_xref="HGNC:4274" /db_xref="HPRD:00414" /db_xref="MIM:121014" /translation="
MGDWSALGKLLDKVQAYSTAGGKVWLSVLFIFRILLLGTAVESAWGDEQSAFRCNTQQPGCENVCYDKSFPISHVRFWVLQIIFVSVPTLLYLAHVFYVMRKEEKLNKKEEELKVAQTDGVNVDMHLKQIEIKKFKYGIEEHGKVKMRGGLLRTYIISILFKSIFEVAFLLIQWYIYGFSLSAVYTCKRDPCPHQVDCFLSRPTEKTIFIIFMLVVSLVSLALNIIELFYVFFKGVKDRVKGKSDPYHATSGALSPAKDCGSQKYAYFNGCSSPTAPLSPMSPPGYKLVTGDRNNSSCRNYNKQASEQNWANYSAEQNRMGQAGSTISNSHAQPFDFPDDNQNSKKLAAGHELQPLAIVDQRPSSRASSRASSRPRPDDLEI
" misc_feature 257..553 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /note="Connexin; Region: Connexin; pfam00029" /db_xref="CDD:143818" misc_feature 290..358 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P17302.2); transmembrane region" misc_feature 479..547 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P17302.2); transmembrane region" misc_feature 713..781 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P17302.2); transmembrane region" misc_feature 743..943 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /note="Gap junction channel protein cysteine-rich domain; Region: Connexin_CCC; smart01089" /db_xref="CDD:198157" misc_feature 875..943 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P17302.2); transmembrane region" misc_feature 989..991 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:01819" misc_feature 1013..1015 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (P17302.2); phosphorylation site" misc_feature 1013..1015 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:01496" misc_feature 1013..1015 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:03479" misc_feature 1013..1015 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:03952" misc_feature 1034..1036 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (P17302.2); phosphorylation site" misc_feature 1043..1045 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:01819" misc_feature 1085..1087 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:03479" misc_feature 1094..1096 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:01496" misc_feature 1094..1096 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:03479" misc_feature 1094..1096 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:03952" misc_feature 1127..1186 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /note="Gap junction alpha-1 protein (Cx43); Region: Connexin43; pfam03508" /db_xref="CDD:146251" misc_feature 1166..1168 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (P17302.2); phosphorylation site" misc_feature 1187..1189 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1190..1192 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (P17302.2); phosphorylation site" misc_feature 1223..1225 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine, by CK1; propagated from UniProtKB/Swiss-Prot (P17302.2); phosphorylation site" misc_feature 1223..1225 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:02920" misc_feature 1232..1234 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine, by CK1; propagated from UniProtKB/Swiss-Prot (P17302.2); phosphorylation site" misc_feature 1232..1234 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:02920" misc_feature 1238..1240 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine, by CK1; propagated from UniProtKB/Swiss-Prot (P17302.2); phosphorylation site" misc_feature 1238..1240 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:02920" misc_feature 1280..1282 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (P17302.2); phosphorylation site" misc_feature 1343..1345 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1352..1354 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:01498" misc_feature 1352..1354 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:01499" misc_feature 1352..1354 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:01502" misc_feature 1355..1357 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1367..1369 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" variation 268 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:200520137" variation 281 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:387906616" variation 282 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:121912969" variation 300 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="c" /db_xref="dbSNP:104893961" variation 302 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:104893962" variation 311 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:104893963" variation 315 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:104893964" variation 347 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:121912970" variation 355 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="g" /db_xref="dbSNP:147811981" variation 439 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:139688042" variation 453 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:374218530" variation 476 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="c" /db_xref="dbSNP:267606845" variation 477 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:267606844" variation 517 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:72548740" variation 536 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:28931601" variation 577 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:145279962" variation 661 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:201088822" variation 677 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:28931600" variation 682 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:201994305" variation 706 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:72548741" variation 719 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:79357545" STS 750..1000 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /standard_name="PMC170950P8" /db_xref="UniSTS:271626" variation 751 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:369139298" variation 752 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:111717577" variation 758 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="g" /replace="t" /db_xref="dbSNP:377077470" variation 777 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:370071579" variation 781 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:377427187" variation 818 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="g" /db_xref="dbSNP:369064392" variation 831 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="c" /db_xref="dbSNP:104893966" variation 907 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="g" /db_xref="dbSNP:147637926" variation 956 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:148384161" variation 962 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="g" /replace="t" /db_xref="dbSNP:143026885" variation 967 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:57946868" variation 968 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:140144121" variation 969 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="t" /db_xref="dbSNP:145367364" variation 974 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:138386744" variation 983 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:367628979" variation 996 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="c" /db_xref="dbSNP:192870757" variation 1004 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:372983194" variation 1008 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:17653265" variation 1015 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="c" /db_xref="dbSNP:138941844" variation 1018 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:55796648" variation 1034 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:149442143" STS 1057..1389 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /standard_name="PMC151788P1" /db_xref="UniSTS:271174" variation 1064 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:376074787" variation 1087 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:67407537" variation 1135 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:370436837" variation 1202 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="c" /db_xref="dbSNP:143898957" variation 1241 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:66916792" variation 1282 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="t" /db_xref="dbSNP:17852395" variation 1289 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="c" /db_xref="dbSNP:184583316" variation 1300 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:147277470" variation 1335 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:2227885" variation 1348 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:372862876" variation 1377 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:104893965" variation 1378 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:145215218" variation 1401..1402 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="" /replace="a" /db_xref="dbSNP:67678923" variation 1488 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:67721882" variation 1518 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:72548742" STS 1541..1872 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /standard_name="WI-6988" /db_xref="UniSTS:20556" variation 1553 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:72548743" variation 1564 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="g" /db_xref="dbSNP:138314962" variation 1566..1567 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="" /replace="g" /db_xref="dbSNP:36054859" variation 1572 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:72548744" STS 1583..1757 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /standard_name="GJA1" /db_xref="UniSTS:479912" variation 1640 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:72548745" variation 1642 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:139128953" variation 1670 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="g" /db_xref="dbSNP:72548746" variation 1671 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:72548747" variation 1684 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="t" /db_xref="dbSNP:72548748" variation 1700 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="c" /db_xref="dbSNP:72548749" variation 1752 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:45516992" variation 1771 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="t" /db_xref="dbSNP:113758463" variation 2084 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="c" /db_xref="dbSNP:183624872" variation 2162..2163 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="" /replace="t" /db_xref="dbSNP:34370179" variation 2319 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="t" /db_xref="dbSNP:367780883" STS 2351..2411 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /standard_name="RH27497" /db_xref="UniSTS:90137" variation 2367 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:111878880" variation 2412..2413 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="" /replace="tt" /db_xref="dbSNP:375943953" variation 2420 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="c" /replace="t" /db_xref="dbSNP:74968349" variation 2721 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="t" /db_xref="dbSNP:12212865" variation 2898 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="" /replace="t" /db_xref="dbSNP:34127088" variation 2899 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="t" /db_xref="dbSNP:1049349" variation 3003 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="c" /db_xref="dbSNP:11541536" variation 3085 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="g" /db_xref="dbSNP:111485072" polyA_signal 3103..3108 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" variation 3106 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" /replace="a" /replace="t" /db_xref="dbSNP:374104162" polyA_site 3130 /gene="GJA1" /gene_synonym="AVSD3; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD" ORIGIN
gagtcagtggcttgaaacttttaaaagctctgtgctccaagttacaaaaaagcttttacgaggtatcagcacttttctttcattagggggaaggcgtgaggaaagtaccaaacagcagcggagttttaaactttaaatagacaggtctgagtgcctgaacttgccttttcattttacttcatcctccaaggagttcaatcacttggcgtgacttcactacttttaagcaaaagagtggtgcccaggcaacatgggtgactggagcgccttaggcaaactccttgacaaggttcaagcctactcaactgctggagggaaggtgtggctgtcagtacttttcattttccgaatcctgctgctggggacagcggttgagtcagcctggggagatgagcagtctgcctttcgttgtaacactcagcaacctggttgtgaaaatgtctgctatgacaagtctttcccaatctctcatgtgcgcttctgggtcctgcagatcatatttgtgtctgtacccacactcttgtacctggctcatgtgttctatgtgatgcgaaaggaagagaaactgaacaagaaagaggaagaactcaaggttgcccaaactgatggtgtcaatgtggacatgcacttgaagcagattgagataaagaagttcaagtacggtattgaagagcatggtaaggtgaaaatgcgaggggggttgctgcgaacctacatcatcagtatcctcttcaagtctatctttgaggtggccttcttgctgatccagtggtacatctatggattcagcttgagtgctgtttacacttgcaaaagagatccctgcccacatcaggtggactgtttcctctctcgccccacggagaaaaccatcttcatcatcttcatgctggtggtgtccttggtgtccctggccttgaatatcattgaactcttctatgttttcttcaagggcgttaaggatcgggttaagggaaagagcgacccttaccatgcgaccagtggtgcgctgagccctgccaaagactgtgggtctcaaaaatatgcttatttcaatggctgctcctcaccaaccgctcccctctcgcctatgtctcctcctgggtacaagctggttactggcgacagaaacaattcttcttgccgcaattacaacaagcaagcaagtgagcaaaactgggctaattacagtgcagaacaaaatcgaatggggcaggcgggaagcaccatctctaactcccatgcacagccttttgatttccccgatgataaccagaattctaaaaaactagctgctggacatgaattacagccactagccattgtggaccagcgaccttcaagcagagccagcagtcgtgccagcagcagacctcggcctgatgacctggagatctagatacaggcttgaaagcatcaagattccactcaattgtggagaagaaaaaaggtgctgtagaaagtgcaccaggtgttaattttgatccggtggaggtggtactcaacagccttattcatgaggcttagaaaacacaaagacattagaatacctaggttcactgggggtgtatggggtagatgggtggagagggaggggataagagaggtgcatgttggtatttaaagtagtggattcaaagaacttagattataaataagagttccattaggtgatacatagataagggctttttctccccgcaaacacccctaagaatggttctgtgtatgtgaatgagcgggtggtaattgtggctaaatatttttgttttaccaagaaactgaaataattctggccaggaataaatacttcctgaacatcttaggtcttttcaacaagaaaaagacagaggattgtccttaagtccctgctaaaacattccattgttaaaatttgcactttgaaggtaagctttctaggcctgaccctccaggtgtcaatggacttgtgctactatatttttttattcttggtatcagtttaaaattcagacaaggcccacagaataagattttccatgcatttgcaaatacgtatattctttttccatccacttgcacaatatcattaccatcactttttcatcattcctcagctactactcacattcatttaatggtttctgtaaacatttttaagacagttgggatgtcacttaacattttttttttgagctaaagtcagggaatcaagccatgcttaatatttaacaatcacttatatgtgtgtcgaagagtttgttttgtttgtcatgtattggtacaagcagatacagtataaactcacaaacacagatttgaaaataatgcacatatggtgttcaaatttgaacctttctcatggatttttgtggtgtgggccaatatggtgtttacattatataattcctgctgtggcaagtaaagcacactttttttttctcctaaaatgtttttccctgtgtatcctattatggatactggttttgttaattatgattctttattttctctcctttttttaggatatagcagtaatgctattactgaaatgaatttcctttttctgaaatgtaatcattgatgcttgaatgatagaattttagtactgtaaacaggctttagtcattaatgtgagagacttagaaaaaatgcttagagtggactattaaatgtgcctaaatgaattttgcagtaactggtattcttgggttttcctacttaatacacagtaattcagaacttgtattctattatgagtttagcagtcttttggagtgaccagcaactttgatgtttgcactaagattttatttggaatgcaagagaggttgaaagaggattcagtagtacacatacaactaatttatttgaactatatgttgaagacatctaccagtttctccaaatgccttttttaaaactcatcacagaagattggtgaaaatgctgagtatgacacttttcttcttgcatgcatgtcagctacataaacagttttgtacaatgaaaattactaatttgtttgacattccatgttaaactacggtcatgttcagcttcattgcatgtaatgtagacctagtccatcagatcatgtgttctggagagtgttctttattcaataaagttttaatttagtataaacata
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:2697 -> Molecular function: GO:0004871 [signal transducer activity] evidence: IMP GeneID:2697 -> Molecular function: GO:0005102 [receptor binding] evidence: IEA GeneID:2697 -> Molecular function: GO:0005243 [gap junction channel activity] evidence: IDA GeneID:2697 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:2697 -> Molecular function: GO:0015075 [ion transmembrane transporter activity] evidence: TAS GeneID:2697 -> Molecular function: GO:0017124 [SH3 domain binding] evidence: IEA GeneID:2697 -> Molecular function: GO:0030165 [PDZ domain binding] evidence: IEA GeneID:2697 -> Molecular function: GO:0048487 [beta-tubulin binding] evidence: IEA GeneID:2697 -> Molecular function: GO:0097110 [scaffold protein binding] evidence: IEA GeneID:2697 -> Biological process: GO:0001649 [osteoblast differentiation] evidence: IEA GeneID:2697 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA GeneID:2697 -> Biological process: GO:0001764 [neuron migration] evidence: IEA GeneID:2697 -> Biological process: GO:0001947 [heart looping] evidence: IEA GeneID:2697 -> Biological process: GO:0002070 [epithelial cell maturation] evidence: IEA GeneID:2697 -> Biological process: GO:0002088 [lens development in camera-type eye] evidence: IEA GeneID:2697 -> Biological process: GO:0003294 [atrial ventricular junction remodeling] evidence: IEA GeneID:2697 -> Biological process: GO:0006810 [transport] evidence: TAS GeneID:2697 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA GeneID:2697 -> Biological process: GO:0006936 [muscle contraction] evidence: TAS GeneID:2697 -> Biological process: GO:0007165 [signal transduction] evidence: IMP GeneID:2697 -> Biological process: GO:0007267 [cell-cell signaling] evidence: TAS GeneID:2697 -> Biological process: GO:0007507 [heart development] evidence: TAS GeneID:2697 -> Biological process: GO:0007512 [adult heart development] evidence: IEA GeneID:2697 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: IEA GeneID:2697 -> Biological process: GO:0009268 [response to pH] evidence: IEA GeneID:2697 -> Biological process: GO:0010232 [vascular transport] evidence: IEA GeneID:2697 -> Biological process: GO:0010628 [positive regulation of gene expression] evidence: IEA GeneID:2697 -> Biological process: GO:0010629 [negative regulation of gene expression] evidence: IEA GeneID:2697 -> Biological process: GO:0010643 [cell communication by chemical coupling] evidence: IEA GeneID:2697 -> Biological process: GO:0010644 [cell communication by electrical coupling] evidence: IDA GeneID:2697 -> Biological process: GO:0015867 [ATP transport] evidence: IEA GeneID:2697 -> Biological process: GO:0016044 [cellular membrane organization] evidence: TAS GeneID:2697 -> Biological process: GO:0016264 [gap junction assembly] evidence: TAS GeneID:2697 -> Biological process: GO:0030500 [regulation of bone mineralization] evidence: IEA GeneID:2697 -> Biological process: GO:0043123 [positive regulation of I-kappaB kinase/NF-kappaB cascade] evidence: IMP GeneID:2697 -> Biological process: GO:0043403 [skeletal muscle tissue regeneration] evidence: IEA GeneID:2697 -> Biological process: GO:0043434 [response to peptide hormone stimulus] evidence: IEA GeneID:2697 -> Biological process: GO:0045732 [positive regulation of protein catabolic process] evidence: IEA GeneID:2697 -> Biological process: GO:0045844 [positive regulation of striated muscle tissue development] evidence: IEA GeneID:2697 -> Biological process: GO:0046850 [regulation of bone remodeling] evidence: IEA GeneID:2697 -> Biological process: GO:0048514 [blood vessel morphogenesis] evidence: IEA GeneID:2697 -> Biological process: GO:0048812 [neuron projection morphogenesis] evidence: IEA GeneID:2697 -> Biological process: GO:0051259 [protein oligomerization] evidence: IEA GeneID:2697 -> Biological process: GO:0051924 [regulation of calcium ion transport] evidence: IEA GeneID:2697 -> Biological process: GO:0060156 [milk ejection] evidence: IEA GeneID:2697 -> Biological process: GO:0060174 [limb bud formation] evidence: IEA GeneID:2697 -> Biological process: GO:0060307 [regulation of ventricular cardiac muscle cell membrane repolarization] evidence: IEA GeneID:2697 -> Biological process: GO:0060371 [regulation of atrial cardiac muscle cell membrane depolarization] evidence: IEA GeneID:2697 -> Biological process: GO:0060373 [regulation of ventricular cardiac muscle cell membrane depolarization] evidence: IEA GeneID:2697 -> Biological process: GO:0086014 [regulation of atrial cardiac muscle cell action potential] evidence: TAS GeneID:2697 -> Biological process: GO:2000810 [regulation of tight junction assembly] evidence: IEA GeneID:2697 -> Cellular component: GO:0000139 [Golgi membrane] evidence: TAS GeneID:2697 -> Cellular component: GO:0005741 [mitochondrial outer membrane] evidence: IEA GeneID:2697 -> Cellular component: GO:0005764 [lysosome] evidence: IEA GeneID:2697 -> Cellular component: GO:0005769 [early endosome] evidence: IEA GeneID:2697 -> Cellular component: GO:0005771 [multivesicular body] evidence: IEA GeneID:2697 -> Cellular component: GO:0005789 [endoplasmic reticulum membrane] evidence: TAS GeneID:2697 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: ISS GeneID:2697 -> Cellular component: GO:0005829 [cytosol] evidence: IEA GeneID:2697 -> Cellular component: GO:0005882 [intermediate filament] evidence: IEA GeneID:2697 -> Cellular component: GO:0005886 [plasma membrane] evidence: ISS GeneID:2697 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS GeneID:2697 -> Cellular component: GO:0005887 [integral to plasma membrane] evidence: TAS GeneID:2697 -> Cellular component: GO:0005916 [fascia adherens] evidence: IEA GeneID:2697 -> Cellular component: GO:0005921 [gap junction] evidence: IDA GeneID:2697 -> Cellular component: GO:0005921 [gap junction] evidence: ISS GeneID:2697 -> Cellular component: GO:0005922 [connexon complex] evidence: IEA GeneID:2697 -> Cellular component: GO:0014704 [intercalated disc] evidence: IDA GeneID:2697 -> Cellular component: GO:0014704 [intercalated disc] evidence: ISS GeneID:2697 -> Cellular component: GO:0016324 [apical plasma membrane] evidence: IEA GeneID:2697 -> Cellular component: GO:0016328 [lateral plasma membrane] evidence: IEA GeneID:2697 -> Cellular component: GO:0030660 [Golgi-associated vesicle membrane] evidence: TAS GeneID:2697 -> Cellular component: GO:0043292 [contractile fiber] evidence: IEA GeneID:2697 -> Cellular component: GO:0045121 [membrane raft] evidence: ISS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.