Home |
Help |
Advanced search
2024-04-17 00:41:36, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_000122 2751 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens excision repair cross-complementing rodent repair
deficiency, complementation group 3 (ERCC3), mRNA.
ACCESSION NM_000122
VERSION NM_000122.1 GI:4557562
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2751)
AUTHORS Abdulrahman,W., Iltis,I., Radu,L., Braun,C., Maglott-Roth,A.,
Giraudon,C., Egly,J.M. and Poterszman,A.
TITLE ARCH domain of XPD, an anchoring platform for CAK that conditions
TFIIH DNA repair and transcription activities
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 110 (8), E633-E642 (2013)
PUBMED 23382212
REMARK GeneRIF: results identify the ARCH domain of XPD as a platform for
the recruitment of CAK and as a molecular switch that might control
TFIIH composition and play a role in conversion of TFIIH from a
factor active in transcription to a factor involved in DNA repair
REFERENCE 2 (bases 1 to 2751)
AUTHORS Hilario,E., Li,Y., Nobumori,Y., Liu,X. and Fan,L.
TITLE Structure of the C-terminal half of human XPB helicase and the
impact of the disease-causing mutation XP11BE
JOURNAL Acta Crystallogr. D Biol. Crystallogr. 69 (PT 2), 237-246 (2013)
PUBMED 23385459
REMARK GeneRIF: The crystal structure of the C-terminal half of the XPB
subunit of TFIIH (residues 494-782) is reported, containing XPB
helicase domain (HD)2 and a C-terminal extension which shares
structural similarity with RIG-I.
REFERENCE 3 (bases 1 to 2751)
AUTHORS Zhu,Q., Wani,G., Sharma,N. and Wani,A.
TITLE Lack of CAK complex accumulation at DNA damage sites in XP-B and
XP-B/CS fibroblasts reveals differential regulation of CAK
anchoring to core TFIIH by XPB and XPD helicases during nucleotide
excision repair
JOURNAL DNA Repair (Amst.) 11 (12), 942-950 (2012)
PUBMED 23083890
REMARK GeneRIF: XPB and XPD helicases differentially regulate TFIIH
compositional change during nucleotide excision repair.
REFERENCE 4 (bases 1 to 2751)
AUTHORS Moslehi,R., Kumar,A., Mills,J.L., Ambroggio,X., Signore,C. and
Dzutsev,A.
TITLE Phenotype-specific adverse effects of XPD mutations on human
prenatal development implicate impairment of TFIIH-mediated
functions in placenta
JOURNAL Eur. J. Hum. Genet. 20 (6), 626-631 (2012)
PUBMED 22234153
REMARK GeneRIF: Phenotype-specific adverse effects of XPD mutations on
human prenatal development implicate impairment of TFIIH-mediated
functions in placenta.
REFERENCE 5 (bases 1 to 2751)
AUTHORS Yu,M., Bell,R.H., Ho,M.M., Leung,G., Haegert,A., Carr,N.,
Shapiro,J. and McElwee,K.J.
TITLE Deficiency in nucleotide excision repair family gene activity,
especially ERCC3, is associated with non-pigmented hair fiber
growth
JOURNAL PLoS ONE 7 (5), E34185 (2012)
PUBMED 22615732
REMARK GeneRIF: reduction in ERCC3 by siRNA interference in human
melanocytes in vitro reduced their tyrosinase production ability
REFERENCE 6 (bases 1 to 2751)
AUTHORS Ma,L., Weeda,G., Jochemsen,A.G., Bootsma,D., Hoeijmakers,J.H. and
van der Eb,A.J.
TITLE Molecular and functional analysis of the XPBC/ERCC-3 promoter:
transcription activity is dependent on the integrity of an
Sp1-binding site
JOURNAL Nucleic Acids Res. 20 (2), 217-224 (1992)
PUBMED 1741247
REFERENCE 7 (bases 1 to 2751)
AUTHORS Weeda,G., Ma,L.B., van Ham,R.C., van der Eb,A.J. and
Hoeijmakers,J.H.
TITLE Structure and expression of the human XPBC/ERCC-3 gene involved in
DNA repair disorders xeroderma pigmentosum and Cockayne's syndrome
JOURNAL Nucleic Acids Res. 19 (22), 6301-6308 (1991)
PUBMED 1956789
REFERENCE 8 (bases 1 to 2751)
AUTHORS Jacob,G.A., Luse,S.W. and Luse,D.S.
TITLE Abortive initiation is increased only for the weakest members of a
set of down mutants of the adenovirus 2 major late promoter
JOURNAL J. Biol. Chem. 266 (33), 22537-22544 (1991)
PUBMED 1939271
REFERENCE 9 (bases 1 to 2751)
AUTHORS Weeda,G., Wiegant,J., van der Ploeg,M., Geurts van Kessel,A.H., van
der Eb,A.J. and Hoeijmakers,J.H.
TITLE Localization of the xeroderma pigmentosum group B-correcting gene
ERCC3 to human chromosome 2q21
JOURNAL Genomics 10 (4), 1035-1040 (1991)
PUBMED 1916809
REFERENCE 10 (bases 1 to 2751)
AUTHORS Weeda,G., van Ham,R.C., Masurel,R., Westerveld,A., Odijk,H., de
Wit,J., Bootsma,D., van der Eb,A.J. and Hoeijmakers,J.H.
TITLE Molecular cloning and biological characterization of the human
excision repair gene ERCC-3
JOURNAL Mol. Cell. Biol. 10 (6), 2570-2581 (1990)
PUBMED 2111438
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from M31899.1.
This sequence is a reference standard in the RefSeqGene project.
Summary: ERCC3 is an ATP-dependent DNA helicase that functions in
nucleotide excision repair and complements xeroderma pigmentosum
group B mutations. It also is the 89 kDa subunit of basal
transcription factor 2 (TFIIH) and thus functions in class II
transcription. [provided by RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: M31899.1, AK222465.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084 [ECO:0000348]
##Evidence-Data-END##
FEATURES Location/Qualifiers
source 1..2751
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="2"
/map="2q21"
gene 1..2751
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/note="excision repair cross-complementing rodent repair
deficiency, complementation group 3"
/db_xref="GeneID:2071"
/db_xref="HGNC:3435"
/db_xref="HPRD:00593"
/db_xref="MIM:133510"
exon 1..123
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/inference="alignment:Splign:1.39.8"
misc_feature 15..17
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/note="upstream in-frame stop codon"
variation 27
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/replace="c"
/replace="t"
/db_xref="dbSNP:9282675"
misc_feature 41
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/note="major transcription start point; other site"
CDS 96..2444
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/EC_number="3.6.4.12"
/note="xeroderma pigmentosum, complementation group B;
TFIIH p89; TFIIH 89 kDa subunit; DNA excision repair
protein ERCC-3; DNA repair protein complementing XP-B
cells; basic transcription factor 2 89 kDa subunit;
xeroderma pigmentosum group B-complementing protein; TFIIH
basal transcription factor complex 89 kDa subunit; BTF2
p89"
/codon_start=1
/product="TFIIH basal transcription factor complex
helicase XPB subunit"
/protein_id="NP_000113.1"
/db_xref="GI:4557563"
/db_xref="CCDS:CCDS2144.1"
/db_xref="GeneID:2071"
/db_xref="HGNC:3435"
/db_xref="HPRD:00593"
/db_xref="MIM:133510"
/translation="
MGKRDRADRDKKKSRKRHYEDEEDDEEDAPGNDPQEAVPSAAGKQVDESGTKVDEYGAKDYRLQMPLKDDHTSRPLWVAPDGHIFLEAFSPVYKYAQDFLVAIAEPVCRPTHVHEYKLTAYSLYAAVSVGLQTSDITEYLRKLSKTGVPDGIMQFIKLCTVSYGKVKLVLKHNRYFVESCHPDVIQHLLQDPVIRECRLRNSEGEATELITETFTSKSAISKTAESSGGPSTSRVTDPQGKSDIPMDLFDFYEQMDKDEEEEEETQTVSFEVKQEMIEELQKRCIHLEYPLLAEYDFRNDSVNPDINIDLKPTAVLRPYQEKSLRKMFGNGRARSGVIVLPCGAGKSLVGVTAACTVRKRCLVLGNSAVSVEQWKAQFKMWSTIDDSQICRFTSDAKDKPIGCSVAISTYSMLGHTTKRSWEAERVMEWLKTQEWGLMILDEVHTIPAKMFRRVLTIVQAHCKLGLTATLVREDDKIVDLNFLIGPKLYEANWMELQNNGYIAKVQCAEVWCPMSPEFYREYVAIKTKKRILLYTMNPNKFRACQFLIKFHERRNDKIIVFADNVFALKEYAIRLNKPYIYGPTSQGERMQILQNFKHNPKINTIFISKVGDTSFDLPEANVLIQISSHGGSRRQEAQRLGRVLRAKKGMVAEEYNAFFYSLVSQDTQEMAYSTKRQRFLVDQGYSFKVITKLAGMEEEDLAFSTKEEQQQLLQKVLAATDLDAEEEVVAGEFGSRSSQASRRFGTMSSMSGADDTVYMEYHSSRSKAPSKHVHPLFKRFRK
"
misc_feature 111..149
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (P19447.1);
Region: Nuclear localization signal (Potential)"
misc_feature 273..2432
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/note="DNA repair helicase rad25; Region: rad25;
TIGR00603"
/db_xref="CDD:161952"
misc_feature 318..695
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/note="Helicase conserved C-terminal domain; Region:
Helicase_C_3; pfam13625"
/db_xref="CDD:205803"
misc_feature 1095..1505
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/note="DEAD-like helicases superfamily. A diverse family
of proteins involved in ATP-dependent RNA or DNA
unwinding. This domain contains the ATP-binding region;
Region: DEXDc; cd00046"
/db_xref="CDD:28927"
misc_feature 1122..1136
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:28927"
misc_feature 1203..1205
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1416..1427
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P19447.1);
Region: DEVH box"
misc_feature 1416..1427
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/note="putative Mg++ binding site [ion binding]; other
site"
/db_xref="CDD:28927"
misc_feature 1692..2039
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/note="Helicase superfamily c-terminal domain; associated
with DEXDc-, DEAD-, and DEAH-box proteins, yeast
initiation factor 4A, Ski2p, and Hepatitis C virus NS3
helicases; this domain is found in a wide variety of
helicases and helicase related proteins; may...; Region:
HELICc; cd00079"
/db_xref="CDD:28960"
misc_feature order(1782..1793,1836..1841,1917..1925)
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/note="nucleotide binding region [chemical binding]; other
site"
/db_xref="CDD:28960"
misc_feature order(1941..1943,2007..2009,2019..2021,2028..2030)
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/note="ATP-binding site [chemical binding]; other site"
/db_xref="CDD:28960"
misc_feature 2346..2348
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
exon 124..329
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/inference="alignment:Splign:1.39.8"
exon 330..566
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/inference="alignment:Splign:1.39.8"
variation 445
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/replace="a"
/replace="g"
/db_xref="dbSNP:1805161"
exon 567..616
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/inference="alignment:Splign:1.39.8"
exon 617..752
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/inference="alignment:Splign:1.39.8"
exon 753..917
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/inference="alignment:Splign:1.39.8"
exon 918..1122
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/inference="alignment:Splign:1.39.8"
exon 1123..1437
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/inference="alignment:Splign:1.39.8"
variation 1214
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/replace="a"
/replace="g"
/db_xref="dbSNP:2228544"
STS 1237..1380
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/standard_name="RH48443"
/db_xref="UniSTS:84780"
variation 1299
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1805162"
variation 1430
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/replace="c"
/replace="t"
/db_xref="dbSNP:4150422"
exon 1438..1622
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/inference="alignment:Splign:1.39.8"
variation 1580
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/replace="a"
/replace="g"
/db_xref="dbSNP:4150456"
exon 1623..1825
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/inference="alignment:Splign:1.39.8"
exon 1826..1922
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/inference="alignment:Splign:1.39.8"
exon 1923..2040
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/inference="alignment:Splign:1.39.8"
exon 2041..2159
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/inference="alignment:Splign:1.39.8"
variation 2123
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/replace="a"
/replace="g"
/db_xref="dbSNP:41553418"
exon 2160..2312
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/inference="alignment:Splign:1.39.8"
variation 2206
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/replace="c"
/replace="t"
/db_xref="dbSNP:4150521"
variation 2298
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/replace="c"
/replace="t"
/db_xref="dbSNP:4150522"
exon 2313..2750
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/inference="alignment:Splign:1.39.8"
STS 2333..2496
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/standard_name="RH69120"
/db_xref="UniSTS:28135"
variation 2473
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/replace="c"
/replace="t"
/db_xref="dbSNP:4150523"
variation 2550
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/replace="c"
/replace="t"
/db_xref="dbSNP:4150524"
STS 2560..2664
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/standard_name="D2S2558"
/db_xref="UniSTS:75353"
variation 2621
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/replace="a"
/replace="g"
/db_xref="dbSNP:4150525"
variation 2703
/gene="ERCC3"
/gene_synonym="BTF2; GTF2H; RAD25; TFIIH; XPB"
/replace="a"
/replace="g"
/db_xref="dbSNP:1803541"
ORIGIN
gggagcttccggattgagccggaagtccccccagagcggatgccgcggcgggcctgtgggagcggggtcatcttctctctgctgctgtagctgccatgggcaaaagagaccgagcggaccgcgacaagaagaaatccaggaagcggcactatgaggatgaagaggatgatgaagaggacgccccggggaacgaccctcaggaagcggttccctcggcggcggggaagcaggtggatgagtcaggcaccaaagtggatgaatatggagccaaggactacaggctgcaaatgccgctgaaggacgaccacacctccaggcccctctgggtggctcccgatggccatatcttcttggaagccttctctccagtttacaaatatgcccaagacttcttggtggctattgcagagccagtgtgccgaccaacccatgtgcatgagtacaaactaactgcctactccttgtatgcagctgtcagcgttgggctgcaaaccagtgacatcaccgagtacctcaggaagctcagcaagactggagtccctgatggaattatgcagtttattaagttgtgtactgtcagctatggaaaagtcaagctggtcttgaagcacaacagatacttcgttgaaagttgccaccctgatgtaatccagcatcttctccaggaccccgtgatccgagaatgccgcttaagaaactctgaaggggaggccactgagctcatcacagagactttcacaagcaaatctgccatttctaagactgctgaaagcagtggtgggccctccacttcccgagtgacagatccacagggtaaatctgacatccccatggacctgtttgacttctatgagcaaatggacaaggatgaagaagaagaagaagagacacagacagtgtcttttgaagtcaagcaggaaatgattgaggaactccagaaacgttgcatccacctggagtaccctctgttggcagaatatgacttccggaatgattctgtcaaccctgatatcaacattgacctaaagcccacagctgtcctcagaccctatcaggagaagagcttgcgaaagatgtttggaaacgggcgtgcacgttcgggggtcattgttcttccctgcggtgctggaaagtccctggttggtgtgactgctgcatgcactgtcagaaaacgctgtctggtgctgggcaactcagctgtttctgtggagcagtggaaagcccagttcaagatgtggtccaccattgacgacagccagatctgccggttcacctccgatgccaaggacaagcccatcggctgctccgttgccattagcacctactccatgctgggccacaccaccaaaaggtcctgggaggccgagcgagtcatggagtggctcaagacccaggagtggggcctcatgatcctggatgaagtgcacaccataccagccaagatgttccgaagggtgctcaccatcgtgcaggcccactgtaagctgggtttgactgcgaccctcgtccgcgaagatgacaaaattgtggatttaaattttctgattgggcctaagctctacgaagccaactggatggagctgcagaataatggctacatcgccaaagtccagtgtgctgaggtctggtgccctatgtctcctgaattttaccgggaatatgtggcaatcaaaaccaagaaacgaatcttgctgtacaccatgaaccccaacaaatttagagcttgccagtttctgatcaagtttcatgaaaggaggaatgacaagattattgtctttgctgacaatgtgtttgccctaaaggaatatgccattcgactgaacaaaccctatatctacggacctacgtctcagggggaaaggatgcaaattctccagaatttcaagcacaaccccaaaattaacaccatcttcatatccaaggtaggtgacacttcgtttgatctgccggaagcaaatgtcctcattcagatctcatcccatggtggctccaggcgtcaggaagcccaaaggctagggcgggtgcttcgagctaaaaaagggatggttgcagaagagtacaatgcctttttctactcactggtatcccaggacacacaggaaatggcttactcaaccaagcggcagagattcttggtagatcaaggttatagcttcaaggtgatcacgaaactcgctggcatggaggaggaagacttggcgttttcgacaaaagaagagcaacagcagctcttacagaaagtcctggcagccactgacctggatgccgaggaggaggtggtggctggggaatttggctccagatccagccaggcatctcggcgctttggcaccatgagttctatgtctggggccgacgacactgtgtacatggagtaccactcatcgcggagcaaggcgcccagcaaacatgtacacccgctcttcaagcgctttaggaaatgatgcttaggcagggtacttcgttcaagaccggcgcttggcacccttgttggaaagggattttcagcataacattttccttccacctctttgaccttccctccagcgttggccaaattgtgctgaggaagatgcatcaagggcttggctgtgccttcataggtcatctagggttttataaaggaggaggagacaatattttttcaaactttttggggagtggggtcatttctgtatataaaaaatgttaatatttaaggtgtatttatgttaccgttctgaataaacagaatggaccattgaaccagta
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:2071 -> Molecular function: GO:0003677 [DNA binding] evidence: TAS
GeneID:2071 -> Molecular function: GO:0003684 [damaged DNA binding] evidence: NAS
GeneID:2071 -> Molecular function: GO:0004003 [ATP-dependent DNA helicase activity] evidence: IEA
GeneID:2071 -> Molecular function: GO:0004672 [protein kinase activity] evidence: IDA
GeneID:2071 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:2071 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:2071 -> Molecular function: GO:0005525 [GTP binding] evidence: IEA
GeneID:2071 -> Molecular function: GO:0008022 [protein C-terminus binding] evidence: IPI
GeneID:2071 -> Molecular function: GO:0008094 [DNA-dependent ATPase activity] evidence: IDA
GeneID:2071 -> Molecular function: GO:0008094 [DNA-dependent ATPase activity] evidence: IMP
GeneID:2071 -> Molecular function: GO:0008134 [transcription factor binding] evidence: IDA
GeneID:2071 -> Molecular function: GO:0008353 [RNA polymerase II carboxy-terminal domain kinase activity] evidence: IDA
GeneID:2071 -> Molecular function: GO:0016887 [ATPase activity] evidence: IDA
GeneID:2071 -> Molecular function: GO:0032564 [dATP binding] evidence: IEA
GeneID:2071 -> Molecular function: GO:0042277 [peptide binding] evidence: IEA
GeneID:2071 -> Molecular function: GO:0043138 [3'-5' DNA helicase activity] evidence: IDA
GeneID:2071 -> Molecular function: GO:0043138 [3'-5' DNA helicase activity] evidence: IMP
GeneID:2071 -> Molecular function: GO:0047485 [protein N-terminus binding] evidence: IPI
GeneID:2071 -> Biological process: GO:0000075 [cell cycle checkpoint] evidence: IMP
GeneID:2071 -> Biological process: GO:0000717 [nucleotide-excision repair, DNA duplex unwinding] evidence: IMP
GeneID:2071 -> Biological process: GO:0000718 [nucleotide-excision repair, DNA damage removal] evidence: TAS
GeneID:2071 -> Biological process: GO:0001666 [response to hypoxia] evidence: IEA
GeneID:2071 -> Biological process: GO:0006265 [DNA topological change] evidence: IMP
GeneID:2071 -> Biological process: GO:0006281 [DNA repair] evidence: IMP
GeneID:2071 -> Biological process: GO:0006281 [DNA repair] evidence: TAS
GeneID:2071 -> Biological process: GO:0006283 [transcription-coupled nucleotide-excision repair] evidence: IDA
GeneID:2071 -> Biological process: GO:0006283 [transcription-coupled nucleotide-excision repair] evidence: TAS
GeneID:2071 -> Biological process: GO:0006289 [nucleotide-excision repair] evidence: IMP
GeneID:2071 -> Biological process: GO:0006289 [nucleotide-excision repair] evidence: TAS
GeneID:2071 -> Biological process: GO:0006360 [transcription from RNA polymerase I promoter] evidence: TAS
GeneID:2071 -> Biological process: GO:0006361 [transcription initiation from RNA polymerase I promoter] evidence: TAS
GeneID:2071 -> Biological process: GO:0006362 [transcription elongation from RNA polymerase I promoter] evidence: TAS
GeneID:2071 -> Biological process: GO:0006363 [termination of RNA polymerase I transcription] evidence: TAS
GeneID:2071 -> Biological process: GO:0006366 [transcription from RNA polymerase II promoter] evidence: IDA
GeneID:2071 -> Biological process: GO:0006366 [transcription from RNA polymerase II promoter] evidence: IMP
GeneID:2071 -> Biological process: GO:0006366 [transcription from RNA polymerase II promoter] evidence: TAS
GeneID:2071 -> Biological process: GO:0006367 [transcription initiation from RNA polymerase II promoter] evidence: TAS
GeneID:2071 -> Biological process: GO:0006368 [transcription elongation from RNA polymerase II promoter] evidence: TAS
GeneID:2071 -> Biological process: GO:0006370 [7-methylguanosine mRNA capping] evidence: TAS
GeneID:2071 -> Biological process: GO:0006917 [induction of apoptosis] evidence: IDA
GeneID:2071 -> Biological process: GO:0006917 [induction of apoptosis] evidence: IMP
GeneID:2071 -> Biological process: GO:0006979 [response to oxidative stress] evidence: IMP
GeneID:2071 -> Biological process: GO:0008104 [protein localization] evidence: IMP
GeneID:2071 -> Biological process: GO:0009411 [response to UV] evidence: IMP
GeneID:2071 -> Biological process: GO:0009650 [UV protection] evidence: IEA
GeneID:2071 -> Biological process: GO:0010467 [gene expression] evidence: TAS
GeneID:2071 -> Biological process: GO:0016032 [viral process] evidence: TAS
GeneID:2071 -> Biological process: GO:0019048 [modulation by virus of host morphology or physiology] evidence: IEA
GeneID:2071 -> Biological process: GO:0033683 [nucleotide-excision repair, DNA incision] evidence: IMP
GeneID:2071 -> Biological process: GO:0035315 [hair cell differentiation] evidence: IMP
GeneID:2071 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IDA
GeneID:2071 -> Biological process: GO:0050434 [positive regulation of viral transcription] evidence: TAS
GeneID:2071 -> Cellular component: GO:0000441 [SSL2-core TFIIH complex] evidence: IEA
GeneID:2071 -> Cellular component: GO:0005634 [nucleus] evidence: TAS
GeneID:2071 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:2071 -> Cellular component: GO:0005675 [holo TFIIH complex] evidence: IDA
GeneID:2071 -> Cellular component: GO:0005675 [holo TFIIH complex] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_000113 -> EC 3.6.4.12
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.