2024-04-20 08:29:36, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_000109 14069 bp mRNA linear PRI 26-MAY-2013 DEFINITION Homo sapiens dystrophin (DMD), transcript variant Dp427c, mRNA. ACCESSION NM_000109 VERSION NM_000109.3 GI:238018043 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 14069) AUTHORS Suzuki,H., Kameyama,T., Ohe,K., Tsukahara,T. and Mayeda,A. TITLE Nested introns in an intron: evidence of multi-step splicing in a large intron of the human dystrophin pre-mRNA JOURNAL FEBS Lett. 587 (6), 555-561 (2013) PUBMED 23395799 REMARK GeneRIF: The evidence obtained for multi-step splicing in a large intron of the human dystrophin pre-mRNA. REFERENCE 2 (bases 1 to 14069) AUTHORS Singh,S.M. and Mallela,K.M. TITLE The N-terminal actin-binding tandem calponin-homology (CH) domain of dystrophin is in a closed conformation in solution and when bound to F-actin JOURNAL Biophys. J. 103 (9), 1970-1978 (2012) PUBMED 23199925 REMARK GeneRIF: In solution, dystrophin N-terminal actin-binding domain binds to F-actin in a closed conformation. REFERENCE 3 (bases 1 to 14069) AUTHORS Bovolenta,M., Erriquez,D., Valli,E., Brioschi,S., Scotton,C., Neri,M., Falzarano,M.S., Gherardi,S., Fabris,M., Rimessi,P., Gualandi,F., Perini,G. and Ferlini,A. TITLE The DMD locus harbours multiple long non-coding RNAs which orchestrate and control transcription of muscle dystrophin mRNA isoforms JOURNAL PLoS ONE 7 (9), E45328 (2012) PUBMED 23028937 REMARK GeneRIF: Findings reveal that DMD lncRNAs may contribute to the orchestration and homeostasis of the muscle dystrophin expression pattern by either selective targeting and down-modulating the dystrophin promoter transcriptional activity. REFERENCE 4 (bases 1 to 14069) AUTHORS Brioschi,S., Gualandi,F., Scotton,C., Armaroli,A., Bovolenta,M., Falzarano,M.S., Sabatelli,P., Selvatici,R., D'Amico,A., Pane,M., Ricci,G., Siciliano,G., Tedeschi,S., Pini,A., Vercelli,L., De Grandis,D., Mercuri,E., Bertini,E., Merlini,L., Mongini,T. and Ferlini,A. TITLE Genetic characterization in symptomatic female DMD carriers: lack of relationship between X-inactivation, transcriptional DMD allele balancing and phenotype JOURNAL BMC Med. Genet. 13, 73 (2012) PUBMED 22894145 REMARK GeneRIF: No relationship between X-inactivation pattern and transcriptional behaviour of DMD gene was observed in Duchenne muscular dystrophies. Publication Status: Online-Only REFERENCE 5 (bases 1 to 14069) AUTHORS Kapoor,S., Bindu,P.S., Taly,A.B., Sinha,S., Gayathri,N., Rani,S.V., Chandak,G.R. and Kumar,A. TITLE Genetic analysis of an Indian family with members affected with Waardenburg syndrome and Duchenne muscular dystrophy JOURNAL Mol. Vis. 18, 2022-2032 (2012) PUBMED 22876130 REMARK GeneRIF: A novel missense mutation in EDN3 and a deletion mutation in DMD has been found in the same Indian family members affected with Waardenburg syndrome and Duchenne muscular dystrophy. REFERENCE 6 (bases 1 to 14069) AUTHORS Nigro,V., Politano,L., Nigro,G., Romano,S.C., Molinari,A.M. and Puca,G.A. TITLE Detection of a nonsense mutation in the dystrophin gene by multiple SSCP JOURNAL Hum. Mol. Genet. 1 (7), 517-520 (1992) PUBMED 1307253 REFERENCE 7 (bases 1 to 14069) AUTHORS Gorecki,D.C., Monaco,A.P., Derry,J.M., Walker,A.P., Barnard,E.A. and Barnard,P.J. TITLE Expression of four alternative dystrophin transcripts in brain regions regulated by different promoters JOURNAL Hum. Mol. Genet. 1 (7), 505-510 (1992) PUBMED 1307251 REFERENCE 8 (bases 1 to 14069) AUTHORS Lederfein,D., Levy,Z., Augier,N., Mornet,D., Morris,G., Fuchs,O., Yaffe,D. and Nudel,U. TITLE A 71-kilodalton protein is a major product of the Duchenne muscular dystrophy gene in brain and other nonmuscle tissues JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (12), 5346-5350 (1992) PUBMED 1319059 REFERENCE 9 (bases 1 to 14069) AUTHORS Rapaport,D., Lederfein,D., den Dunnen,J.T., Grootscholten,P.M., Van Ommen,G.J., Fuchs,O., Nudel,U. and Yaffe,D. TITLE Characterization and cell type distribution of a novel, major transcript of the Duchenne muscular dystrophy gene JOURNAL Differentiation 49 (3), 187-193 (1992) PUBMED 1377655 REFERENCE 10 (bases 1 to 14069) AUTHORS Koenig,M., Monaco,A.P. and Kunkel,L.M. TITLE The complete sequence of dystrophin predicts a rod-shaped cytoskeletal protein JOURNAL Cell 53 (2), 219-228 (1988) PUBMED 3282674 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL050305.9, BC036103.1, M18533.1, AL109609.5 and BC028720.1. On May 24, 2009 this sequence version replaced gi:5032280. Summary: The dystrophin gene is the largest gene found in nature, measuring 2.4 Mb. The gene was identified through a positional cloning approach, targeted at the isolation of the gene responsible for Duchenne (DMD) and Becker (BMD) Muscular Dystrophies. DMD is a recessive, fatal, X-linked disorder occurring at a frequency of about 1 in 3,500 new-born males. BMD is a milder allelic form. In general, DMD patients carry mutations which cause premature translation termination (nonsense or frame shift mutations), while in BMD patients dystrophin is reduced either in molecular weight (derived from in-frame deletions) or in expression level. The dystrophin gene is highly complex, containing at least eight independent, tissue-specific promoters and two polyA-addition sites. Furthermore, dystrophin RNA is differentially spliced, producing a range of different transcripts, encoding a large set of protein isoforms. Dystrophin (as encoded by the Dp427 transcripts) is a large, rod-like cytoskeletal protein which is found at the inner surface of muscle fibers. Dystrophin is part of the dystrophin-glycoprotein complex (DGC), which bridges the inner cytoskeleton (F-actin) and the extra-cellular matrix. [provided by RefSeq, Jul 2008]. Transcript Variant: transcript Dp427c is expressed predominantly in neurons of the cortex and the CA regions of the hippocampus. It uses a unique promoter/exon 1 located about 130 kb upstream of the Dp427m transcript promoter. The transcript includes the common exon 2 of transcript Dp427m and has a similar length of 14 kb. The Dp427c isoform contains a unique N-terminal MED sequence, instead of the MLWWEEVEDCY sequence of isoform Dp427m. The remainder of isoform Dp427c is identical to isoform Dp427m. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-172 AL050305.9 14862-15033 c 173-2612 BC036103.1 5-2444 2613-4725 M18533.1 2501-4613 4726-4726 AL109609.5 79506-79506 c 4727-5849 M18533.1 4615-5737 5850-5850 AL109609.5 35892-35892 c 5851-12824 M18533.1 5739-12712 12825-14069 BC028720.1 3398-4642 FEATURES Location/Qualifiers source 1..14069 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="X" /map="Xp21.2" gene 1..14069 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="dystrophin" /db_xref="GeneID:1756" /db_xref="HGNC:2928" /db_xref="HPRD:02303" /db_xref="MIM:300377" misc_feature 249..251 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="upstream in-frame stop codon" CDS 345..11378 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Dp427c isoform is encoded by transcript variant Dp427c" /codon_start=1 /product="dystrophin Dp427c isoform" /protein_id="NP_000100.2" /db_xref="GI:5032281" /db_xref="GeneID:1756" /db_xref="HGNC:2928" /db_xref="HPRD:02303" /db_xref="MIM:300377" /translation="
MEDEREDVQKKTFTKWVNAQFSKFGKQHIENLFSDLQDGRRLLDLLEGLTGQKLPKEKGSTRVHALNNVNKALRVLQNNNVDLVNIGSTDIVDGNHKLTLGLIWNIILHWQVKNVMKNIMAGLQQTNSEKILLSWVRQSTRNYPQVNVINFTTSWSDGLALNALIHSHRPDLFDWNSVVCQQSATQRLEHAFNIARYQLGIEKLLDPEDVDTTYPDKKSILMYITSLFQVLPQQVSIEAIQEVEMLPRPPKVTKEEHFQLHHQMHYSQQITVSLAQGYERTSSPKPRFKSYAYTQAAYVTTSDPTRSPFPSQHLEAPEDKSFGSSLMESEVNLDRYQTALEEVLSWLLSAEDTLQAQGEISNDVEVVKDQFHTHEGYMMDLTAHQGRVGNILQLGSKLIGTGKLSEDEETEVQEQMNLLNSRWECLRVASMEKQSNLHRVLMDLQNQKLKELNDWLTKTEERTRKMEEEPLGPDLEDLKRQVQQHKVLQEDLEQEQVRVNSLTHMVVVVDESSGDHATAALEEQLKVLGDRWANICRWTEDRWVLLQDILLKWQRLTEEQCLFSAWLSEKEDAVNKIHTTGFKDQNEMLSSLQKLAVLKADLEKKKQSMGKLYSLKQDLLSTLKNKSVTQKTEAWLDNFARCWDNLVQKLEKSTAQISQAVTTTQPSLTQTTVMETVTTVTTREQILVKHAQEELPPPPPQKKRQITVDSEIRKRLDVDITELHSWITRSEAVLQSPEFAIFRKEGNFSDLKEKVNAIEREKAEKFRKLQDASRSAQALVEQMVNEGVNADSIKQASEQLNSRWIEFCQLLSERLNWLEYQNNIIAFYNQLQQLEQMTTTAENWLKIQPTTPSEPTAIKSQLKICKDEVNRLSGLQPQIERLKIQSIALKEKGQGPMFLDADFVAFTNHFKQVFSDVQAREKELQTIFDTLPPMRYQETMSAIRTWVQQSETKLSIPQLSVTDYEIMEQRLGELQALQSSLQEQQSGLYYLSTTVKEMSKKAPSEISRKYQSEFEEIEGRWKKLSSQLVEHCQKLEEQMNKLRKIQNHIQTLKKWMAEVDVFLKEEWPALGDSEILKKQLKQCRLLVSDIQTIQPSLNSVNEGGQKIKNEAEPEFASRLETELKELNTQWDHMCQQVYARKEALKGGLEKTVSLQKDLSEMHEWMTQAEEEYLERDFEYKTPDELQKAVEEMKRAKEEAQQKEAKVKLLTESVNSVIAQAPPVAQEALKKELETLTTNYQWLCTRLNGKCKTLEEVWACWHELLSYLEKANKWLNEVEFKLKTTENIPGGAEEISEVLDSLENLMRHSEDNPNQIRILAQTLTDGGVMDELINEELETFNSRWRELHEEAVRRQKLLEQSIQSAQETEKSLHLIQESLTFIDKQLAAYIADKVDAAQMPQEAQKIQSDLTSHEISLEEMKKHNQGKEAAQRVLSQIDVAQKKLQDVSMKFRLFQKPANFEQRLQESKMILDEVKMHLPALETKSVEQEVVQSQLNHCVNLYKSLSEVKSEVEMVIKTGRQIVQKKQTENPKELDERVTALKLHYNELGAKVTERKQQLEKCLKLSRKMRKEMNVLTEWLAATDMELTKRSAVEGMPSNLDSEVAWGKATQKEIEKQKVHLKSITEVGEALKTVLGKKETLVEDKLSLLNSNWIAVTSRAEEWLNLLLEYQKHMETFDQNVDHITKWIIQADTLLDESEKKKPQQKEDVLKRLKAELNDIRPKVDSTRDQAANLMANRGDHCRKLVEPQISELNHRFAAISHRIKTGKASIPLKELEQFNSDIQKLLEPLEAEIQQGVNLKEEDFNKDMNEDNEGTVKELLQRGDNLQQRITDERKREEIKIKQQLLQTKHNALKDLRSQRRKKALEISHQWYQYKRQADDLLKCLDDIEKKLASLPEPRDERKIKEIDRELQKKKEELNAVRRQAEGLSEDGAAMAVEPTQIQLSKRWREIESKFAQFRRLNFAQIHTVREETMMVMTEDMPLEISYVPSTYLTEITHVSQALLEVEQLLNAPDLCAKDFEDLFKQEESLKNIKDSLQQSSGRIDIIHSKKTAALQSATPVERVKLQEALSQLDFQWEKVNKMYKDRQGRFDRSVEKWRRFHYDIKIFNQWLTEAEQFLRKTQIPENWEHAKYKWYLKELQDGIGQRQTVVRTLNATGEEIIQQSSKTDASILQEKLGSLNLRWQEVCKQLSDRKKRLEEQKNILSEFQRDLNEFVLWLEEADNIASIPLEPGKEQQLKEKLEQVKLLVEELPLRQGILKQLNETGGPVLVSAPISPEEQDKLENKLKQTNLQWIKVSRALPEKQGEIEAQIKDLGQLEKKLEDLEEQLNHLLLWLSPIRNQLEIYNQPNQEGPFDVQETEIAVQAKQPDVEEILSKGQHLYKEKPATQPVKRKLEDLSSEWKAVNRLLQELRAKQPDLAPGLTTIGASPTQTVTLVTQPVVTKETAISKLEMPSSLMLEVPALADFNRAWTELTDWLSLLDQVIKSQRVMVGDLEDINEMIIKQKATMQDLEQRRPQLEELITAAQNLKNKTSNQEARTIITDRIERIQNQWDEVQEHLQNRRQQLNEMLKDSTQWLEAKEEAEQVLGQARAKLESWKEGPYTVDAIQKKITETKQLAKDLRQWQTNVDVANDLALKLLRDYSADDTRKVHMITENINASWRSIHKRVSEREAALEETHRLLQQFPLDLEKFLAWLTEAETTANVLQDATRKERLLEDSKGVKELMKQWQDLQGEIEAHTDVYHNLDENSQKILRSLEGSDDAVLLQRRLDNMNFKWSELRKKSLNIRSHLEASSDQWKRLHLSLQELLVWLQLKDDELSRQAPIGGDFPAVQKQNDVHRAFKRELKTKEPVIMSTLETVRIFLTEQPLEGLEKLYQEPRELPPEERAQNVTRLLRKQAEEVNTEWEKLNLHSADWQRKIDETLERLQELQEATDELDLKLRQAEVIKGSWQPVGDLLIDSLQDHLEKVKALRGEIAPLKENVSHVNDLARQLTTLGIQLSPYNLSTLEDLNTRWKLLQVAVEDRVRQLHEAHRDFGPASQHFLSTSVQGPWERAISPNKVPYYINHETQTTCWDHPKMTELYQSLADLNNVRFSAYRTAMKLRRLQKALCLDLLSLSAACDALDQHNLKQNDQPMDILQIINCLTTIYDRLEQEHNNLVNVPLCVDMCLNWLLNVYDTGRTGRIRVLSFKTGIISLCKAHLEDKYRYLFKQVASSTGFCDQRRLGLLLHDSIQIPRQLGEVASFGGSNIEPSVRSCFQFANNKPEIEAALFLDWMRLEPQSMVWLPVLHRVAAAETAKHQAKCNICKECPIIGFRYRSLKHFNYDICQSCFFSGRVAKGHKMHYPMVEYCTPTTSGEDVRDFAKVLKNKFRTKRYFAKHPRMGYLPVQTVLEGDNMETPVTLINFWPVDSAPASSPQLSHDDTHSRIEHYASRLAEMENSNGSYLNDSISPNESIDDEHLLIQHYCQSLNQDSPLSQPRSPAQILISLESEERGELERILADLEEENRNLQAEYDRLKQQHEHKGLSPLPSPPEMMPTSPQSPRDAELIAEAKLLRQHKGRLEARMQILEDHNKQLESQLHRLRQLLEQPQAEAKVNGTTVSSPSTSLQRSDSSQPMLLRVVGSQTSDSMGEEDLLSPPQDTSTGLEEVMEQLNNSFPSSRGRNTPGKPMREDTM
" misc_feature 345..353 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: dystrophin Dp427c unique N-terminus" misc_feature 354..1040 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: Actin binding domain" misc_feature 366..677 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Calponin homology domain; actin-binding domain which may be present as a single copy or in tandem repeats (which increases binding affinity). The CH domain is found in cytoskeletal and signal transduction proteins, including actin-binding proteins like...; Region: CH; cd00014" /db_xref="CDD:28898" misc_feature order(366..371,375..383,390..392,399..401,561..566, 573..575,582..584,588..590,633..638,645..650,654..659, 666..671) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="putative actin binding surface [polypeptide binding]; other site" /db_xref="CDD:28898" misc_feature 723..1040 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Calponin homology domain; actin-binding domain which may be present as a single copy or in tandem repeats (which increases binding affinity). The CH domain is found in cytoskeletal and signal transduction proteins, including actin-binding proteins like...; Region: CH; cd00014" /db_xref="CDD:28898" misc_feature order(723..728,732..740,747..749,756..758,918..923, 930..932,942..944,948..950,996..1001,1008..1013, 1017..1022,1029..1034) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="putative actin binding surface [polypeptide binding]; other site" /db_xref="CDD:28898" misc_feature 1077..9440 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: central rod domain" misc_feature 1077..1301 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: hinge region 1" misc_feature 1329..1661 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 1" misc_feature 1341..1994 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 1662..1988 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 2" misc_feature 1662..1679 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 1779..2327 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 1989..2321 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 3" misc_feature 1992..2009 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 2322..2471 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: hinge region 2" misc_feature 2472..2804 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 4" misc_feature 2499..3119 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 2805..3122 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 5" misc_feature 2805..2822 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 3123..3455 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 6" misc_feature 3456..3782 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 7" misc_feature 3465..4109 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 3783..4109 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 8" misc_feature 3783..3800 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 4110..4421 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 9" misc_feature 4122..4742 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 4422..4709 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 10" misc_feature 4422..4439 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 4701..5024 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 11" misc_feature 4719..5348 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 5025..5348 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 12" misc_feature 5025..5042 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 5349..5654 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 13" misc_feature 5355..5648 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeat; Region: Spectrin; pfam00435" /db_xref="CDD:201223" misc_feature 5430..6257 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Uncharacterized archaeal coiled-coil protein [Function unknown]; Region: COG1340" /db_xref="CDD:31531" misc_feature 5655..5942 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 14" misc_feature 5658..6224 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 5943..6239 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 15" misc_feature 5946..5963 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 6294..6623 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 16" misc_feature 6318..6944 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 6624..6944 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 17" misc_feature 6624..6641 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 6633..7280 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 6945..7274 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 18" misc_feature order(6945..6953,6957..6965) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 7275..7589 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 19" misc_feature 7590..7730 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: hinge region 3" misc_feature 7731..8051 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 20" misc_feature 7734..8384 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 8052..8378 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 21" misc_feature 8052..8069 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 8379..8726 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 22" misc_feature 8388..9119 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 8727..9113 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 23" misc_feature 8727..8744 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 9114..9440 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 24" misc_feature 9123..>9455 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 9360..9656 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: hinge region 4" misc_feature 9441..9455 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 9486..9596 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: WW-domain" misc_feature 9495..9584 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Two conserved tryptophans domain; also known as the WWP or rsp5 domain; around 40 amino acids; functions as an interaction module in a diverse set of signalling proteins; binds specific proline-rich sequences but at low affinities compared to other...; Region: WW; cd00201" /db_xref="CDD:29258" misc_feature order(9534..9536,9567..9569) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="binding pocket" /db_xref="CDD:29258" misc_feature 9558..10544 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="dystroglycan binding site" misc_feature 9579..9941 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="EF hand; Region: efhand_1; pfam09068" /db_xref="CDD:149945" misc_feature 9618..10220 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: Cysteine-rich domain" misc_feature 9708..9791 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: EF-hand 1" misc_feature 9852..9938 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: EF-hand 2" misc_feature 9951..10226 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="EF-hand; Region: efhand_2; pfam09069" /db_xref="CDD:149946" misc_feature 10218..11375 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: Carboxy-terminal region" misc_feature 10239..10382 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: ZZ-domain" misc_feature 10251..10397 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Zinc finger, ZZ type. Zinc finger present in dystrophin and dystrobrevin. The ZZ motif coordinates two zinc ions and most likely participates in ligand binding or molecular scaffolding. Dystrophin attaches actin filaments to an integral membrane...; Region: ZZ_dystrophin; cd02334" /db_xref="CDD:30238" misc_feature order(10257..10259,10266..10268,10302..10304,10311..10313, 10329..10331,10338..10340,10368..10370,10380..10382) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Zinc-binding sites [ion binding]; other site" /db_xref="CDD:30238" misc_feature order(10257..10259,10266..10268,10329..10331,10338..10340) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="zinc cluster 1 [ion binding]; other site" /db_xref="CDD:30238" misc_feature order(10260..10262,10293..10295,10299..10301,10317..10319, 10323..10325) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="putative charged binding surface; other site" /db_xref="CDD:30238" misc_feature order(10296..10298,10341..10343,10386..10388,10395..10397) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="putative hydrophobic binding surface; other site" /db_xref="CDD:30238" misc_feature order(10302..10304,10311..10313,10368..10370,10380..10382) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="zinc cluster 2 [ion binding]; other site" /db_xref="CDD:30238" misc_feature 10593..10595 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 10650..10802 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="alpha1-syntrophin binding site" misc_feature 10803..10925 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="beta1-syntrophin binding site" misc_feature 10992..11099 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: (Leu)6-heptad repeat" variation 718 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:1800256" STS 858..966 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99269" variation 1122 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1800264" variation 1157 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800265" variation 1415 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:1800266" variation 1418 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="t" /db_xref="dbSNP:72470507" STS 1598..2172 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="MARC_84337-84338:1278013457:1" /db_xref="UniSTS:532589" variation 1657 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72468699" variation 1990 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1800257" variation 1994 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="g" /replace="t" /db_xref="dbSNP:1800258" STS 2060..2646 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="MARC_84339-84340:1278014518:1" /db_xref="UniSTS:532590" variation 2187 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:1800259" variation 2189 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1800267" variation 2208 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72468692" variation 2671 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="g" /db_xref="dbSNP:1800260" variation 2711 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="g" /replace="t" /db_xref="dbSNP:72468681" variation 2777 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:72468680" variation 2810 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72468679" variation 3291 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="g" /db_xref="dbSNP:72468667" variation 3341 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800268" variation 3350 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:72468666" variation 3440 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1800261" variation 3909 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="g" /replace="t" /db_xref="dbSNP:1800262" STS 3927..4025 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99474" variation 4054 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1800269" variation 4152 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="g" /db_xref="dbSNP:1800270" variation 4451 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1800263" variation 4595 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72468647" variation 4726 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="t" /db_xref="dbSNP:1057872" variation 4849 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72468638" STS 4852..4964 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99582" variation 5197 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="t" /db_xref="dbSNP:72468634" variation 5297 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1801185" variation 5360 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72468632" variation 5483 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="g" /db_xref="dbSNP:72468630" variation 5554 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1801187" STS 5731..6288 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="MARC_84357-84358:1278016549:1" /db_xref="UniSTS:532591" variation 5779 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800271" variation 5850 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:1064325" variation 5852 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:1801186" STS 5956..6050 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99541" variation 6095 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800272" variation 6348 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="g" /replace="t" /db_xref="dbSNP:72468613" STS 6612..6736 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99225" variation 6783 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1800273" STS 6986..7068 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99066" variation 7148 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72466595" variation 7400 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800274" variation 7416 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:1800275" variation 7503 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72466590" STS 7684..7795 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DXS7499" /db_xref="UniSTS:30753" variation 8048 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1801188" variation 8140 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="t" /db_xref="dbSNP:72466581" STS 8205..8340 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99382" variation 8375 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1801189" STS 8547..8646 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99545" variation 8642 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:72466575" variation 8816 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:72466574" variation 8891 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72466570" variation 8899 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:72466569" variation 9130 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800280" STS 9141..9243 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99400" variation 9172 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72466567" variation 9413 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72466563" variation 9414 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72466562" STS 9892..9959 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99128" variation 10940 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72466538" variation 11109 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1800281" variation 11338 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1795743" STS 11460..11653 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="PMC316713P2" /db_xref="UniSTS:273040" STS 11728..11916 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="G15848" /db_xref="UniSTS:3168" STS 11769..11901 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DXS1234" /db_xref="UniSTS:146800" variation 11858..11859 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="acac" /replace="taca" /db_xref="dbSNP:3833413" variation 12302 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="acaa" /db_xref="dbSNP:72466531" variation 12346 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="t" /db_xref="dbSNP:72466530" STS 12384..12452 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DXS503" /db_xref="UniSTS:99031" variation 12426 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="gat" /db_xref="dbSNP:72466529" variation 12623 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="cttt" /db_xref="dbSNP:72466527" STS 12690..12840 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DXS6988E" /db_xref="UniSTS:32060" variation 12825 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:3361" STS 12846..12946 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="A002S20" /db_xref="UniSTS:57879" variation 12943 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="aaag" /db_xref="dbSNP:72466526" variation 12969 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="tgtt" /db_xref="dbSNP:72466525" variation 13109 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:3198427" variation 13136 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="ttcat" /db_xref="dbSNP:72466524" variation 13417 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:72466523" variation 13531 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="atgtgacgctggacctt" /db_xref="dbSNP:72466522" variation 13563 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="t" /db_xref="dbSNP:11550191" variation 13615 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="aagt" /db_xref="dbSNP:72466521" STS 13696..13887 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:506537" variation 13805 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1057915" STS 13953..14037 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="PMC108984P1" /db_xref="UniSTS:270148" variation 13959 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="actt" /db_xref="dbSNP:72466520" polyA_signal 14047..14052 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" polyA_site 14069 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" ORIGIN
cgttaaatgcaaacgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactgacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgcataataaatgactgaaagaatcatgttaggcatgcccacctaacctaacttgaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcccagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggagaaagatgctgttttgcactatcttgatttgttacagcagccaacttattggcatgatggagtgacaggaaaaacagctggcatggaagatgaaagagaagatgttcaaaagaaaacattcacaaaatgggtaaatgcacaattttctaagtttgggaagcagcatattgagaacctcttcagtgacctacaggatgggaggcgcctcctagacctcctcgaaggcctgacagggcaaaaactgccaaaagaaaaaggatccacaagagttcatgccctgaacaatgtcaacaaggcactgcgggttttgcagaacaataatgttgatttagtgaatattggaagtactgacatcgtagatggaaatcataaactgactcttggtttgatttggaatataatcctccactggcaggtcaaaaatgtaatgaaaaatatcatggctggattgcaacaaaccaacagtgaaaagattctcctgagctgggtccgacaatcaactcgtaattatccacaggttaatgtaatcaacttcaccaccagctggtctgatggcctggctttgaatgctctcatccatagtcataggccagacctatttgactggaatagtgtggtttgccagcagtcagccacacaacgactggaacatgcattcaacatcgccagatatcaattaggcatagagaaactactcgatcctgaagatgttgataccacctatccagataagaagtccatcttaatgtacatcacatcactcttccaagttttgcctcaacaagtgagcattgaagccatccaggaagtggaaatgttgccaaggccacctaaagtgactaaagaagaacattttcagttacatcatcaaatgcactattctcaacagatcacggtcagtctagcacagggatatgagagaacttcttcccctaagcctcgattcaagagctatgcctacacacaggctgcttatgtcaccacctctgaccctacacggagcccatttccttcacagcatttggaagctcctgaagacaagtcatttggcagttcattgatggagagtgaagtaaacctggaccgttatcaaacagctttagaagaagtattatcgtggcttctttctgctgaggacacattgcaagcacaaggagagatttctaatgatgtggaagtggtgaaagaccagtttcatactcatgaggggtacatgatggatttgacagcccatcagggccgggttggtaatattctacaattgggaagtaagctgattggaacaggaaaattatcagaagatgaagaaactgaagtacaagagcagatgaatctcctaaattcaagatgggaatgcctcagggtagctagcatggaaaaacaaagcaatttacatagagttttaatggatctccagaatcagaaactgaaagagttgaatgactggctaacaaaaacagaagaaagaacaaggaaaatggaggaagagcctcttggacctgatcttgaagacctaaaacgccaagtacaacaacataaggtgcttcaagaagatctagaacaagaacaagtcagggtcaattctctcactcacatggtggtggtagttgatgaatctagtggagatcacgcaactgctgctttggaagaacaacttaaggtattgggagatcgatgggcaaacatctgtagatggacagaagaccgctgggttcttttacaagacatccttctcaaatggcaacgtcttactgaagaacagtgcctttttagtgcatggctttcagaaaaagaagatgcagtgaacaagattcacacaactggctttaaagatcaaaatgaaatgttatcaagtcttcaaaaactggccgttttaaaagcggatctagaaaagaaaaagcaatccatgggcaaactgtattcactcaaacaagatcttctttcaacactgaagaataagtcagtgacccagaagacggaagcatggctggataactttgcccggtgttgggataatttagtccaaaaacttgaaaagagtacagcacagatttcacaggctgtcaccaccactcagccatcactaacacagacaactgtaatggaaacagtaactacggtgaccacaagggaacagatcctggtaaagcatgctcaagaggaacttccaccaccacctccccaaaagaagaggcagattactgtggattctgaaattaggaaaaggttggatgttgatataactgaacttcacagctggattactcgctcagaagctgtgttgcagagtcctgaatttgcaatctttcggaaggaaggcaacttctcagacttaaaagaaaaagtcaatgccatagagcgagaaaaagctgagaagttcagaaaactgcaagatgccagcagatcagctcaggccctggtggaacagatggtgaatgagggtgttaatgcagatagcatcaaacaagcctcagaacaactgaacagccggtggatcgaattctgccagttgctaagtgagagacttaactggctggagtatcagaacaacatcatcgctttctataatcagctacaacaattggagcagatgacaactactgctgaaaactggttgaaaatccaacccaccaccccatcagagccaacagcaattaaaagtcagttaaaaatttgtaaggatgaagtcaaccggctatcaggtcttcaacctcaaattgaacgattaaaaattcaaagcatagccctgaaagagaaaggacaaggacccatgttcctggatgcagactttgtggcctttacaaatcattttaagcaagtcttttctgatgtgcaggccagagagaaagagctacagacaatttttgacactttgccaccaatgcgctatcaggagaccatgagtgccatcaggacatgggtccagcagtcagaaaccaaactctccatacctcaacttagtgtcaccgactatgaaatcatggagcagagactcggggaattgcaggctttacaaagttctctgcaagagcaacaaagtggcctatactatctcagcaccactgtgaaagagatgtcgaagaaagcgccctctgaaattagccggaaatatcaatcagaatttgaagaaattgagggacgctggaagaagctctcctcccagctggttgagcattgtcaaaagctagaggagcaaatgaataaactccgaaaaattcagaatcacatacaaaccctgaagaaatggatggctgaagttgatgtttttctgaaggaggaatggcctgcccttggggattcagaaattctaaaaaagcagctgaaacagtgcagacttttagtcagtgatattcagacaattcagcccagtctaaacagtgtcaatgaaggtgggcagaagataaagaatgaagcagagccagagtttgcttcgagacttgagacagaactcaaagaacttaacactcagtgggatcacatgtgccaacaggtctatgccagaaaggaggccttgaagggaggtttggagaaaactgtaagcctccagaaagatctatcagagatgcacgaatggatgacacaagctgaagaagagtatcttgagagagattttgaatataaaactccagatgaattacagaaagcagttgaagagatgaagagagctaaagaagaggcccaacaaaaagaagcgaaagtgaaactccttactgagtctgtaaatagtgtcatagctcaagctccacctgtagcacaagaggccttaaaaaaggaacttgaaactctaaccaccaactaccagtggctctgcactaggctgaatgggaaatgcaagactttggaagaagtttgggcatgttggcatgagttattgtcatacttggagaaagcaaacaagtggctaaatgaagtagaatttaaacttaaaaccactgaaaacattcctggcggagctgaggaaatctctgaggtgctagattcacttgaaaatttgatgcgacattcagaggataacccaaatcagattcgcatattggcacagaccctaacagatggcggagtcatggatgagctaatcaatgaggaacttgagacatttaattctcgttggagggaactacatgaagaggctgtaaggaggcaaaagttgcttgaacagagcatccagtctgcccaggagactgaaaaatccttacacttaatccaggagtccctcacattcattgacaagcagttggcagcttatattgcagacaaggtggacgcagctcaaatgcctcaggaagcccagaaaatccaatctgatttgacaagtcatgagatcagtttagaagaaatgaagaaacataatcaggggaaggaggctgcccaaagagtcctgtctcagattgatgttgcacagaaaaaattacaagatgtctccatgaagtttcgattattccagaaaccagccaattttgagcagcgtctacaagaaagtaagatgattttagatgaagtgaagatgcacttgcctgcattggaaacaaagagtgtggaacaggaagtagtacagtcacagctaaatcattgtgtgaacttgtataaaagtctgagtgaagtgaagtctgaagtggaaatggtgataaagactggacgtcagattgtacagaaaaagcagacggaaaatcccaaagaacttgatgaaagagtaacagctttgaaattgcattataatgagctgggagcaaaggtaacagaaagaaagcaacagttggagaaatgcttgaaattgtcccgtaagatgcgaaaggaaatgaatgtcttgacagaatggctggcagctacagatatggaattgacaaagagatcagcagttgaaggaatgcctagtaatttggattctgaagttgcctggggaaaggctactcaaaaagagattgagaaacagaaggtgcacctgaagagtatcacagaggtaggagaggccttgaaaacagttttgggcaagaaggagacgttggtggaagataaactcagtcttctgaatagtaactggatagctgtcacctcccgagcagaagagtggttaaatcttttgttggaataccagaaacacatggaaacttttgaccagaatgtggaccacatcacaaagtggatcattcaggctgacacacttttggatgaatcagagaaaaagaaaccccagcaaaaagaagacgtgcttaagcgtttaaaggcagaactgaatgacatacgcccaaaggtggactctacacgtgaccaagcagcaaacttgatggcaaaccgcggtgaccactgcaggaaattagtagagccccaaatctcagagctcaaccatcgatttgcagccatttcacacagaattaagactggaaaggcctccattcctttgaaggaattggagcagtttaactcagatatacaaaaattgcttgaaccactggaggctgaaattcagcagggggtgaatctgaaagaggaagacttcaataaagatatgaatgaagacaatgagggtactgtaaaagaattgttgcaaagaggagacaacttacaacaaagaatcacagatgagagaaagcgagaggaaataaagataaaacagcagctgttacagacaaaacataatgctctcaaggatttgaggtctcaaagaagaaaaaaggctctagaaatttctcatcagtggtatcagtacaagaggcaggctgatgatctcctgaaatgcttggatgacattgaaaaaaaattagccagcctacctgagcccagagatgaaaggaaaataaaggaaattgatcgggaattgcagaagaagaaagaggagctgaatgcagtgcgtaggcaagctgagggcttgtctgaggatggggccgcaatggcagtggagccaactcagatccagctcagcaagcgctggcgggaaattgagagcaaatttgctcagtttcgaagactcaactttgcacaaattcacactgtccgtgaagaaacgatgatggtgatgactgaagacatgcctttggaaatttcttatgtgccttctacttatttgactgaaatcactcatgtctcacaagccctattagaagtggaacaacttctcaatgctcctgacctctgtgctaaggactttgaagatctctttaagcaagaggagtctctgaagaatataaaagatagtctacaacaaagctcaggtcggattgacattattcatagcaagaagacagcagcattgcaaagtgcaacgcctgtggaaagggtgaagctacaggaagctctctcccagcttgatttccaatgggaaaaagttaacaaaatgtacaaggaccgacaagggcgatttgacagatctgttgagaaatggcggcgttttcattatgatataaagatatttaatcagtggctaacagaagctgaacagtttctcagaaagacacaaattcctgagaattgggaacatgctaaatacaaatggtatcttaaggaactccaggatggcattgggcagcggcaaactgttgtcagaacattgaatgcaactggggaagaaataattcagcaatcctcaaaaacagatgccagtattctacaggaaaaattgggaagcctgaatctgcggtggcaggaggtctgcaaacagctgtcagacagaaaaaagaggctagaagaacaaaagaatatcttgtcagaatttcaaagagatttaaatgaatttgttttatggttggaggaagcagataacattgctagtatcccacttgaacctggaaaagagcagcaactaaaagaaaagcttgagcaagtcaagttactggtggaagagttgcccctgcgccagggaattctcaaacaattaaatgaaactggaggacccgtgcttgtaagtgctcccataagcccagaagagcaagataaacttgaaaataagctcaagcagacaaatctccagtggataaaggtttccagagctttacctgagaaacaaggagaaattgaagctcaaataaaagaccttgggcagcttgaaaaaaagcttgaagaccttgaagagcagttaaatcatctgctgctgtggttatctcctattaggaatcagttggaaatttataaccaaccaaaccaagaaggaccatttgacgttcaggaaactgaaatagcagttcaagctaaacaaccggatgtggaagagattttgtctaaagggcagcatttgtacaaggaaaaaccagccactcagccagtgaagaggaagttagaagatctgagctctgagtggaaggcggtaaaccgtttacttcaagagctgagggcaaagcagcctgacctagctcctggactgaccactattggagcctctcctactcagactgttactctggtgacacaacctgtggttactaaggaaactgccatctccaaactagaaatgccatcttccttgatgttggaggtacctgctctggcagatttcaaccgggcttggacagaacttaccgactggctttctctgcttgatcaagttataaaatcacagagggtgatggtgggtgaccttgaggatatcaacgagatgatcatcaagcagaaggcaacaatgcaggatttggaacagaggcgtccccagttggaagaactcattaccgctgcccaaaatttgaaaaacaagaccagcaatcaagaggctagaacaatcattacggatcgaattgaaagaattcagaatcagtgggatgaagtacaagaacaccttcagaaccggaggcaacagttgaatgaaatgttaaaggattcaacacaatggctggaagctaaggaagaagctgagcaggtcttaggacaggccagagccaagcttgagtcatggaaggagggtccctatacagtagatgcaatccaaaagaaaatcacagaaaccaagcagttggccaaagacctccgccagtggcagacaaatgtagatgtggcaaatgacttggccctgaaacttctccgggattattctgcagatgataccagaaaagtccacatgataacagagaatatcaatgcctcttggagaagcattcataaaagggtgagtgagcgagaggctgctttggaagaaactcatagattactgcaacagttccccctggacctggaaaagtttcttgcctggcttacagaagctgaaacaactgccaatgtcctacaggatgctacccgtaaggaaaggctcctagaagactccaagggagtaaaagagctgatgaaacaatggcaagacctccaaggtgaaattgaagctcacacagatgtttatcacaacctggatgaaaacagccaaaaaatcctgagatccctggaaggttccgatgatgcagtcctgttacaaagacgtttggataacatgaacttcaagtggagtgaacttcggaaaaagtctctcaacattaggtcccatttggaagccagttctgaccagtggaagcgtctgcacctttctctgcaggaacttctggtgtggctacagctgaaagatgatgaattaagccggcaggcacctattggaggcgactttccagcagttcagaagcagaacgatgtacatagggccttcaagagggaattgaaaactaaagaacctgtaatcatgagtactcttgagactgtacgaatatttctgacagagcagcctttggaaggactagagaaactctaccaggagcccagagagctgcctcctgaggagagagcccagaatgtcactcggcttctacgaaagcaggctgaggaggtcaatactgagtgggaaaaattgaacctgcactccgctgactggcagagaaaaatagatgagacccttgaaagactccaggaacttcaagaggccacggatgagctggacctcaagctgcgccaagctgaggtgatcaagggatcctggcagcccgtgggcgatctcctcattgactctctccaagatcacctcgagaaagtcaaggcacttcgaggagaaattgcgcctctgaaagagaacgtgagccacgtcaatgaccttgctcgccagcttaccactttgggcattcagctctcaccgtataacctcagcactctggaagacctgaacaccagatggaagcttctgcaggtggccgtcgaggaccgagtcaggcagctgcatgaagcccacagggactttggtccagcatctcagcactttctttccacgtctgtccagggtccctgggagagagccatctcgccaaacaaagtgccctactatatcaaccacgagactcaaacaacttgctgggaccatcccaaaatgacagagctctaccagtctttagctgacctgaataatgtcagattctcagcttataggactgccatgaaactccgaagactgcagaaggccctttgcttggatctcttgagcctgtcagctgcatgtgatgccttggaccagcacaacctcaagcaaaatgaccagcccatggatatcctgcagattattaattgtttgaccactatttatgaccgcctggagcaagagcacaacaatttggtcaacgtccctctctgcgtggatatgtgtctgaactggctgctgaatgtttatgatacgggacgaacagggaggatccgtgtcctgtcttttaaaactggcatcatttccctgtgtaaagcacatttggaagacaagtacagataccttttcaagcaagtggcaagttcaacaggattttgtgaccagcgcaggctgggcctccttctgcatgattctatccaaattccaagacagttgggtgaagttgcatcctttgggggcagtaacattgagccaagtgtccggagctgcttccaatttgctaataataagccagagatcgaagcggccctcttcctagactggatgagactggaaccccagtccatggtgtggctgcccgtcctgcacagagtggctgctgcagaaactgccaagcatcaggccaaatgtaacatctgcaaagagtgtccaatcattggattcaggtacaggagtctaaagcactttaattatgacatctgccaaagctgctttttttctggtcgagttgcaaaaggccataaaatgcactatcccatggtggaatattgcactccgactacatcaggagaagatgttcgagactttgccaaggtactaaaaaacaaatttcgaaccaaaaggtattttgcgaagcatccccgaatgggctacctgccagtgcagactgtcttagagggggacaacatggaaactcccgttactctgatcaacttctggccagtagattctgcgcctgcctcgtcccctcagctttcacacgatgatactcattcacgcattgaacattatgctagcaggctagcagaaatggaaaacagcaatggatcttatctaaatgatagcatctctcctaatgagagcatagatgatgaacatttgttaatccagcattactgccaaagtttgaaccaggactcccccctgagccagcctcgtagtcctgcccagatcttgatttccttagagagtgaggaaagaggggagctagagagaatcctagcagatcttgaggaagaaaacaggaatctgcaagcagaatatgaccgtctaaagcagcagcacgaacataaaggcctgtccccactgccgtcccctcctgaaatgatgcccacctctccccagagtccccgggatgctgagctcattgctgaggccaagctactgcgtcaacacaaaggccgcctggaagccaggatgcaaatcctggaagaccacaataaacagctggagtcacagttacacaggctaaggcagctgctggagcaaccccaggcagaggccaaagtgaatggcacaacggtgtcctctccttctacctctctacagaggtccgacagcagtcagcctatgctgctccgagtggttggcagtcaaacttcggactccatgggtgaggaagatcttctcagtcctccccaggacacaagcacagggttagaggaggtgatggagcaactcaacaactccttccctagttcaagaggaagaaatacccctggaaagccaatgagagaggacacaatgtaggaagtcttttccacatggcagatgatttgggcagagcgatggagtccttagtatcagtcatgacagatgaagaaggagcagaataaatgttttacaactcctgattcccgcatggtttttataatattcatacaacaaagaggattagacagtaagagtttacaagaaataaatctatatttttgtgaagggtagtggtattatactgtagatttcagtagtttctaagtctgttattgttttgttaacaatggcaggttttacacgtctatgcaattgtacaaaaaagttataagaaaactacatgtaaaatcttgatagctaaataacttgccatttctttatatggaacgcattttgggttgtttaaaaatttataacagttataaagaaagattgtaaactaaagtgtgctttataaaaaaaagttgtttataaaaacccctaaaaacaaaacaaacacacacacacacacatacacacacacacacaaaactttgaggcagcgcattgttttgcatccttttggcgtgatatccatatgaaattcatggctttttctttttttgcatattaaagataagacttcctctaccaccacaccaaatgactactacacactgctcatttgagaactgtcagctgagtggggcaggcttgagttttcatttcatatatctatatgtctataagtatataaatactatagttatatagataaagagatacgaatttctatagactgactttttccattttttaaatgttcatgtcacatcctaatagaaagaaattacttctagtcagtcatccaggcttacctgcttggtctagaatggatttttcccggagccggaagccaggaggaaactacaccacactaaaacattgtctacagctccagatgtttctcattttaaacaactttccactgacaacgaaagtaaagtaaagtattggatttttttaaagggaacatgtgaatgaatacacaggacttattatatcagagtgagtaatcggttggttggttgattgattgattgattgatacattcagcttcctgctgctagcaatgccacgatttagatttaatgatgcttcagtggaaatcaatcagaaggtattctgaccttgtgaacatcagaaggtattttttaactcccaagcagtagcaggacgatgatagggctggagggctatggattcccagcccatccctgtgaaggagtaggccactctttaagtgaaggattggatgattgttcataatacataaagttctctgtaattacaactaaattattatgccctcttctcacagtcaaaaggaactgggtggtttggtttttgttgcttttttagatttattgtcccatgtgggatgagtttttaaatgccacaagacataatttaaaataaataaactttgggaaaaggtgtaaaacagtagccccatcacatttgtgatactgacaggtatcaacccagaagcccatgaactgtgtttccatcctttgcatttctctgcgagtagttccacacaggtttgtaagtaagtaagaaagaaggcaaattgattcaaatgttacaaaaaaacccttcttggtggattagacaggttaaatatataaacaaacaaacaaaaattgctcaaaaaagaggagaaaagctcaagaggaaaagctaaggactggtaggaaaaagctttactctttcatgccattttatttctttttgatttttaaatcattcattcaatagataccaccgtgtgacctataattttgcaaatctgttacctctgacatcaagtgtaattagcttttggagagtgggctgacatcaagtgtaattagcttttggagagtgggttttgtccattattaataattaattaattaacatcaaacacggcttctcatgctatttctacctcactttggttttggggtgttcctgataattgtgcacacctgagttcacagcttcaccacttgtccattgcgttattttctttttcctttataattctttctttttccttcataattttcaaaagaaaacccaaagctctaaggtaacaaattaccaaattacatgaagatttggtttttgtcttgcatttttttcctttatgtgacgctggaccttttctttacccaaggatttttaaaactcagatttaaaacaaggggttactttacatcctactaagaagtttaagtaagtaagtttcattctaaaatcagaggtaaatagagtgcataaataattttgttttaatctttttgtttttcttttagacacattagctctggagtgagtctgtcataatatttgaacaaaaattgagagctttattgctgcattttaagcataattaatttggacattatttcgtgttgtgttctttataaccaccaagtattaaactgtaaatcataatgtaactgaagcataaacatcacatggcatgttttgtcattgttttcaggtactgagttcttacttgagtatcataatatattgtgttttaacaccaacactgtaacatttacgaattatttttttaaacttcagttttactgcattttcacaacatatcagacttcaccaaatatatgccttactattgtattatagtactgctttactgtgtatctcaataaagcacgcagttatgttac
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:1756 -> Molecular function: GO:0002162 [dystroglycan binding] evidence: IPI GeneID:1756 -> Molecular function: GO:0003779 [actin binding] evidence: IDA GeneID:1756 -> Molecular function: GO:0003779 [actin binding] evidence: TAS GeneID:1756 -> Molecular function: GO:0005200 [structural constituent of cytoskeleton] evidence: TAS GeneID:1756 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA GeneID:1756 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:1756 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA GeneID:1756 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: IDA GeneID:1756 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: TAS GeneID:1756 -> Molecular function: GO:0017022 [myosin binding] evidence: IDA GeneID:1756 -> Molecular function: GO:0017166 [vinculin binding] evidence: IPI GeneID:1756 -> Molecular function: GO:0050998 [nitric-oxide synthase binding] evidence: ISS GeneID:1756 -> Biological process: GO:0001954 [positive regulation of cell-matrix adhesion] evidence: IEA GeneID:1756 -> Biological process: GO:0002027 [regulation of heart rate] evidence: IMP GeneID:1756 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA GeneID:1756 -> Biological process: GO:0007517 [muscle organ development] evidence: NAS GeneID:1756 -> Biological process: GO:0008065 [establishment of blood-nerve barrier] evidence: IEA GeneID:1756 -> Biological process: GO:0010880 [regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum] evidence: ISS GeneID:1756 -> Biological process: GO:0010881 [regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion] evidence: ISS GeneID:1756 -> Biological process: GO:0010976 [positive regulation of neuron projection development] evidence: IMP GeneID:1756 -> Biological process: GO:0014809 [regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion] evidence: ISS GeneID:1756 -> Biological process: GO:0014819 [regulation of skeletal muscle contraction] evidence: ISS GeneID:1756 -> Biological process: GO:0014904 [myotube cell development] evidence: IEA GeneID:1756 -> Biological process: GO:0021629 [olfactory nerve structural organization] evidence: IEA GeneID:1756 -> Biological process: GO:0030049 [muscle filament sliding] evidence: TAS GeneID:1756 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS GeneID:1756 -> Biological process: GO:0033137 [negative regulation of peptidyl-serine phosphorylation] evidence: ISS GeneID:1756 -> Biological process: GO:0034613 [cellular protein localization] evidence: IMP GeneID:1756 -> Biological process: GO:0043043 [peptide biosynthetic process] evidence: IDA GeneID:1756 -> Biological process: GO:0043623 [cellular protein complex assembly] evidence: ISS GeneID:1756 -> Biological process: GO:0044458 [motile cilium assembly] evidence: TAS GeneID:1756 -> Biological process: GO:0045213 [neurotransmitter receptor metabolic process] evidence: IEA GeneID:1756 -> Biological process: GO:0045666 [positive regulation of neuron differentiation] evidence: IMP GeneID:1756 -> Biological process: GO:0046716 [muscle cell homeostasis] evidence: IEA GeneID:1756 -> Biological process: GO:0048747 [muscle fiber development] evidence: IEA GeneID:1756 -> Biological process: GO:0051647 [nucleus localization] evidence: IEA GeneID:1756 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP GeneID:1756 -> Biological process: GO:0060314 [regulation of ryanodine-sensitive calcium-release channel activity] evidence: ISS GeneID:1756 -> Biological process: GO:0060857 [establishment of glial blood-brain barrier] evidence: IEA GeneID:1756 -> Biological process: GO:0086001 [regulation of cardiac muscle cell action potential] evidence: ISS GeneID:1756 -> Biological process: GO:0090287 [regulation of cellular response to growth factor stimulus] evidence: IMP GeneID:1756 -> Biological process: GO:1901385 [regulation of voltage-gated calcium channel activity] evidence: ISS GeneID:1756 -> Biological process: GO:2000169 [regulation of peptidyl-cysteine S-nitrosylation] evidence: ISS GeneID:1756 -> Biological process: GO:2000651 [positive regulation of sodium ion transmembrane transporter activity] evidence: ISS GeneID:1756 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:1756 -> Cellular component: GO:0005634 [nucleus] evidence: TAS GeneID:1756 -> Cellular component: GO:0005829 [cytosol] evidence: TAS GeneID:1756 -> Cellular component: GO:0005856 [cytoskeleton] evidence: IEA GeneID:1756 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA GeneID:1756 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS GeneID:1756 -> Cellular component: GO:0009986 [cell surface] evidence: IDA GeneID:1756 -> Cellular component: GO:0015629 [actin cytoskeleton] evidence: TAS GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: IDA GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: NAS GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: TAS GeneID:1756 -> Cellular component: GO:0030018 [Z disc] evidence: IEA GeneID:1756 -> Cellular component: GO:0030055 [cell-substrate junction] evidence: IEA GeneID:1756 -> Cellular component: GO:0030175 [filopodium] evidence: IDA GeneID:1756 -> Cellular component: GO:0042383 [sarcolemma] evidence: IDA GeneID:1756 -> Cellular component: GO:0043034 [costamere] evidence: IDA GeneID:1756 -> Cellular component: GO:0043234 [protein complex] evidence: IDA GeneID:1756 -> Cellular component: GO:0044306 [neuron projection terminus] evidence: IEA GeneID:1756 -> Cellular component: GO:0045121 [membrane raft] evidence: IEA GeneID:1756 -> Cellular component: GO:0045121 [membrane raft] evidence: TAS GeneID:1756 -> Cellular component: GO:0045211 [postsynaptic membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.