GGRNA Home | Help | Advanced search

2024-04-20 08:29:36, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_000109              14069 bp    mRNA    linear   PRI 26-MAY-2013
DEFINITION  Homo sapiens dystrophin (DMD), transcript variant Dp427c, mRNA.
ACCESSION   NM_000109
VERSION     NM_000109.3  GI:238018043
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 14069)
  AUTHORS   Suzuki,H., Kameyama,T., Ohe,K., Tsukahara,T. and Mayeda,A.
  TITLE     Nested introns in an intron: evidence of multi-step splicing in a
            large intron of the human dystrophin pre-mRNA
  JOURNAL   FEBS Lett. 587 (6), 555-561 (2013)
   PUBMED   23395799
  REMARK    GeneRIF: The evidence obtained for multi-step splicing in a large
            intron of the human dystrophin pre-mRNA.
REFERENCE   2  (bases 1 to 14069)
  AUTHORS   Singh,S.M. and Mallela,K.M.
  TITLE     The N-terminal actin-binding tandem calponin-homology (CH) domain
            of dystrophin is in a closed conformation in solution and when
            bound to F-actin
  JOURNAL   Biophys. J. 103 (9), 1970-1978 (2012)
   PUBMED   23199925
  REMARK    GeneRIF: In solution, dystrophin N-terminal actin-binding domain
            binds to F-actin in a closed conformation.
REFERENCE   3  (bases 1 to 14069)
  AUTHORS   Bovolenta,M., Erriquez,D., Valli,E., Brioschi,S., Scotton,C.,
            Neri,M., Falzarano,M.S., Gherardi,S., Fabris,M., Rimessi,P.,
            Gualandi,F., Perini,G. and Ferlini,A.
  TITLE     The DMD locus harbours multiple long non-coding RNAs which
            orchestrate and control transcription of muscle dystrophin mRNA
            isoforms
  JOURNAL   PLoS ONE 7 (9), E45328 (2012)
   PUBMED   23028937
  REMARK    GeneRIF: Findings reveal that DMD lncRNAs may contribute to the
            orchestration and homeostasis of the muscle dystrophin expression
            pattern by either selective targeting and down-modulating the
            dystrophin promoter transcriptional activity.
REFERENCE   4  (bases 1 to 14069)
  AUTHORS   Brioschi,S., Gualandi,F., Scotton,C., Armaroli,A., Bovolenta,M.,
            Falzarano,M.S., Sabatelli,P., Selvatici,R., D'Amico,A., Pane,M.,
            Ricci,G., Siciliano,G., Tedeschi,S., Pini,A., Vercelli,L., De
            Grandis,D., Mercuri,E., Bertini,E., Merlini,L., Mongini,T. and
            Ferlini,A.
  TITLE     Genetic characterization in symptomatic female DMD carriers: lack
            of relationship between X-inactivation, transcriptional DMD allele
            balancing and phenotype
  JOURNAL   BMC Med. Genet. 13, 73 (2012)
   PUBMED   22894145
  REMARK    GeneRIF: No relationship between X-inactivation pattern and
            transcriptional behaviour of DMD gene was observed in Duchenne
            muscular dystrophies.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 14069)
  AUTHORS   Kapoor,S., Bindu,P.S., Taly,A.B., Sinha,S., Gayathri,N., Rani,S.V.,
            Chandak,G.R. and Kumar,A.
  TITLE     Genetic analysis of an Indian family with members affected with
            Waardenburg syndrome and Duchenne muscular dystrophy
  JOURNAL   Mol. Vis. 18, 2022-2032 (2012)
   PUBMED   22876130
  REMARK    GeneRIF: A novel missense mutation in EDN3 and a deletion mutation
            in DMD has been found in the same Indian family members affected
            with Waardenburg syndrome and Duchenne muscular dystrophy.
REFERENCE   6  (bases 1 to 14069)
  AUTHORS   Nigro,V., Politano,L., Nigro,G., Romano,S.C., Molinari,A.M. and
            Puca,G.A.
  TITLE     Detection of a nonsense mutation in the dystrophin gene by multiple
            SSCP
  JOURNAL   Hum. Mol. Genet. 1 (7), 517-520 (1992)
   PUBMED   1307253
REFERENCE   7  (bases 1 to 14069)
  AUTHORS   Gorecki,D.C., Monaco,A.P., Derry,J.M., Walker,A.P., Barnard,E.A.
            and Barnard,P.J.
  TITLE     Expression of four alternative dystrophin transcripts in brain
            regions regulated by different promoters
  JOURNAL   Hum. Mol. Genet. 1 (7), 505-510 (1992)
   PUBMED   1307251
REFERENCE   8  (bases 1 to 14069)
  AUTHORS   Lederfein,D., Levy,Z., Augier,N., Mornet,D., Morris,G., Fuchs,O.,
            Yaffe,D. and Nudel,U.
  TITLE     A 71-kilodalton protein is a major product of the Duchenne muscular
            dystrophy gene in brain and other nonmuscle tissues
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 89 (12), 5346-5350 (1992)
   PUBMED   1319059
REFERENCE   9  (bases 1 to 14069)
  AUTHORS   Rapaport,D., Lederfein,D., den Dunnen,J.T., Grootscholten,P.M., Van
            Ommen,G.J., Fuchs,O., Nudel,U. and Yaffe,D.
  TITLE     Characterization and cell type distribution of a novel, major
            transcript of the Duchenne muscular dystrophy gene
  JOURNAL   Differentiation 49 (3), 187-193 (1992)
   PUBMED   1377655
REFERENCE   10 (bases 1 to 14069)
  AUTHORS   Koenig,M., Monaco,A.P. and Kunkel,L.M.
  TITLE     The complete sequence of dystrophin predicts a rod-shaped
            cytoskeletal protein
  JOURNAL   Cell 53 (2), 219-228 (1988)
   PUBMED   3282674
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AL050305.9, BC036103.1,
            M18533.1, AL109609.5 and BC028720.1.
            On May 24, 2009 this sequence version replaced gi:5032280.
            
            Summary: The dystrophin gene is the largest gene found in nature,
            measuring 2.4 Mb. The gene was identified through a positional
            cloning approach, targeted at the isolation of the gene responsible
            for Duchenne (DMD) and Becker (BMD) Muscular Dystrophies. DMD is a
            recessive, fatal, X-linked disorder occurring at a frequency of
            about 1 in 3,500 new-born males. BMD is a milder allelic form. In
            general, DMD patients carry mutations which cause premature
            translation termination (nonsense or frame shift mutations), while
            in BMD patients dystrophin is reduced either in molecular weight
            (derived from in-frame deletions) or in expression level. The
            dystrophin gene is highly complex, containing at least eight
            independent, tissue-specific promoters and two polyA-addition
            sites. Furthermore, dystrophin RNA is differentially spliced,
            producing a range of different transcripts, encoding a large set of
            protein isoforms. Dystrophin (as encoded by the Dp427 transcripts)
            is a large, rod-like cytoskeletal protein which is found at the
            inner surface of muscle fibers. Dystrophin is part of the
            dystrophin-glycoprotein complex (DGC), which bridges the inner
            cytoskeleton (F-actin) and the extra-cellular matrix. [provided by
            RefSeq, Jul 2008].
            
            Transcript Variant: transcript Dp427c is expressed predominantly in
            neurons of the cortex and the CA regions of the hippocampus. It
            uses a unique promoter/exon 1 located about 130 kb upstream of the
            Dp427m transcript promoter. The transcript includes the common exon
            2 of transcript Dp427m and has a similar length of 14 kb. The
            Dp427c isoform contains a unique N-terminal MED sequence, instead
            of the MLWWEEVEDCY sequence of isoform Dp427m. The remainder of
            isoform Dp427c is identical to isoform Dp427m.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support ERS025081, ERS025082
                              [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-172               AL050305.9         14862-15033         c
            173-2612            BC036103.1         5-2444
            2613-4725           M18533.1           2501-4613
            4726-4726           AL109609.5         79506-79506         c
            4727-5849           M18533.1           4615-5737
            5850-5850           AL109609.5         35892-35892         c
            5851-12824          M18533.1           5739-12712
            12825-14069         BC028720.1         3398-4642
FEATURES             Location/Qualifiers
     source          1..14069
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
                     /map="Xp21.2"
     gene            1..14069
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="dystrophin"
                     /db_xref="GeneID:1756"
                     /db_xref="HGNC:2928"
                     /db_xref="HPRD:02303"
                     /db_xref="MIM:300377"
     misc_feature    249..251
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="upstream in-frame stop codon"
     CDS             345..11378
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Dp427c isoform is encoded by transcript variant
                     Dp427c"
                     /codon_start=1
                     /product="dystrophin Dp427c isoform"
                     /protein_id="NP_000100.2"
                     /db_xref="GI:5032281"
                     /db_xref="GeneID:1756"
                     /db_xref="HGNC:2928"
                     /db_xref="HPRD:02303"
                     /db_xref="MIM:300377"
                     /translation="
MEDEREDVQKKTFTKWVNAQFSKFGKQHIENLFSDLQDGRRLLDLLEGLTGQKLPKEKGSTRVHALNNVNKALRVLQNNNVDLVNIGSTDIVDGNHKLTLGLIWNIILHWQVKNVMKNIMAGLQQTNSEKILLSWVRQSTRNYPQVNVINFTTSWSDGLALNALIHSHRPDLFDWNSVVCQQSATQRLEHAFNIARYQLGIEKLLDPEDVDTTYPDKKSILMYITSLFQVLPQQVSIEAIQEVEMLPRPPKVTKEEHFQLHHQMHYSQQITVSLAQGYERTSSPKPRFKSYAYTQAAYVTTSDPTRSPFPSQHLEAPEDKSFGSSLMESEVNLDRYQTALEEVLSWLLSAEDTLQAQGEISNDVEVVKDQFHTHEGYMMDLTAHQGRVGNILQLGSKLIGTGKLSEDEETEVQEQMNLLNSRWECLRVASMEKQSNLHRVLMDLQNQKLKELNDWLTKTEERTRKMEEEPLGPDLEDLKRQVQQHKVLQEDLEQEQVRVNSLTHMVVVVDESSGDHATAALEEQLKVLGDRWANICRWTEDRWVLLQDILLKWQRLTEEQCLFSAWLSEKEDAVNKIHTTGFKDQNEMLSSLQKLAVLKADLEKKKQSMGKLYSLKQDLLSTLKNKSVTQKTEAWLDNFARCWDNLVQKLEKSTAQISQAVTTTQPSLTQTTVMETVTTVTTREQILVKHAQEELPPPPPQKKRQITVDSEIRKRLDVDITELHSWITRSEAVLQSPEFAIFRKEGNFSDLKEKVNAIEREKAEKFRKLQDASRSAQALVEQMVNEGVNADSIKQASEQLNSRWIEFCQLLSERLNWLEYQNNIIAFYNQLQQLEQMTTTAENWLKIQPTTPSEPTAIKSQLKICKDEVNRLSGLQPQIERLKIQSIALKEKGQGPMFLDADFVAFTNHFKQVFSDVQAREKELQTIFDTLPPMRYQETMSAIRTWVQQSETKLSIPQLSVTDYEIMEQRLGELQALQSSLQEQQSGLYYLSTTVKEMSKKAPSEISRKYQSEFEEIEGRWKKLSSQLVEHCQKLEEQMNKLRKIQNHIQTLKKWMAEVDVFLKEEWPALGDSEILKKQLKQCRLLVSDIQTIQPSLNSVNEGGQKIKNEAEPEFASRLETELKELNTQWDHMCQQVYARKEALKGGLEKTVSLQKDLSEMHEWMTQAEEEYLERDFEYKTPDELQKAVEEMKRAKEEAQQKEAKVKLLTESVNSVIAQAPPVAQEALKKELETLTTNYQWLCTRLNGKCKTLEEVWACWHELLSYLEKANKWLNEVEFKLKTTENIPGGAEEISEVLDSLENLMRHSEDNPNQIRILAQTLTDGGVMDELINEELETFNSRWRELHEEAVRRQKLLEQSIQSAQETEKSLHLIQESLTFIDKQLAAYIADKVDAAQMPQEAQKIQSDLTSHEISLEEMKKHNQGKEAAQRVLSQIDVAQKKLQDVSMKFRLFQKPANFEQRLQESKMILDEVKMHLPALETKSVEQEVVQSQLNHCVNLYKSLSEVKSEVEMVIKTGRQIVQKKQTENPKELDERVTALKLHYNELGAKVTERKQQLEKCLKLSRKMRKEMNVLTEWLAATDMELTKRSAVEGMPSNLDSEVAWGKATQKEIEKQKVHLKSITEVGEALKTVLGKKETLVEDKLSLLNSNWIAVTSRAEEWLNLLLEYQKHMETFDQNVDHITKWIIQADTLLDESEKKKPQQKEDVLKRLKAELNDIRPKVDSTRDQAANLMANRGDHCRKLVEPQISELNHRFAAISHRIKTGKASIPLKELEQFNSDIQKLLEPLEAEIQQGVNLKEEDFNKDMNEDNEGTVKELLQRGDNLQQRITDERKREEIKIKQQLLQTKHNALKDLRSQRRKKALEISHQWYQYKRQADDLLKCLDDIEKKLASLPEPRDERKIKEIDRELQKKKEELNAVRRQAEGLSEDGAAMAVEPTQIQLSKRWREIESKFAQFRRLNFAQIHTVREETMMVMTEDMPLEISYVPSTYLTEITHVSQALLEVEQLLNAPDLCAKDFEDLFKQEESLKNIKDSLQQSSGRIDIIHSKKTAALQSATPVERVKLQEALSQLDFQWEKVNKMYKDRQGRFDRSVEKWRRFHYDIKIFNQWLTEAEQFLRKTQIPENWEHAKYKWYLKELQDGIGQRQTVVRTLNATGEEIIQQSSKTDASILQEKLGSLNLRWQEVCKQLSDRKKRLEEQKNILSEFQRDLNEFVLWLEEADNIASIPLEPGKEQQLKEKLEQVKLLVEELPLRQGILKQLNETGGPVLVSAPISPEEQDKLENKLKQTNLQWIKVSRALPEKQGEIEAQIKDLGQLEKKLEDLEEQLNHLLLWLSPIRNQLEIYNQPNQEGPFDVQETEIAVQAKQPDVEEILSKGQHLYKEKPATQPVKRKLEDLSSEWKAVNRLLQELRAKQPDLAPGLTTIGASPTQTVTLVTQPVVTKETAISKLEMPSSLMLEVPALADFNRAWTELTDWLSLLDQVIKSQRVMVGDLEDINEMIIKQKATMQDLEQRRPQLEELITAAQNLKNKTSNQEARTIITDRIERIQNQWDEVQEHLQNRRQQLNEMLKDSTQWLEAKEEAEQVLGQARAKLESWKEGPYTVDAIQKKITETKQLAKDLRQWQTNVDVANDLALKLLRDYSADDTRKVHMITENINASWRSIHKRVSEREAALEETHRLLQQFPLDLEKFLAWLTEAETTANVLQDATRKERLLEDSKGVKELMKQWQDLQGEIEAHTDVYHNLDENSQKILRSLEGSDDAVLLQRRLDNMNFKWSELRKKSLNIRSHLEASSDQWKRLHLSLQELLVWLQLKDDELSRQAPIGGDFPAVQKQNDVHRAFKRELKTKEPVIMSTLETVRIFLTEQPLEGLEKLYQEPRELPPEERAQNVTRLLRKQAEEVNTEWEKLNLHSADWQRKIDETLERLQELQEATDELDLKLRQAEVIKGSWQPVGDLLIDSLQDHLEKVKALRGEIAPLKENVSHVNDLARQLTTLGIQLSPYNLSTLEDLNTRWKLLQVAVEDRVRQLHEAHRDFGPASQHFLSTSVQGPWERAISPNKVPYYINHETQTTCWDHPKMTELYQSLADLNNVRFSAYRTAMKLRRLQKALCLDLLSLSAACDALDQHNLKQNDQPMDILQIINCLTTIYDRLEQEHNNLVNVPLCVDMCLNWLLNVYDTGRTGRIRVLSFKTGIISLCKAHLEDKYRYLFKQVASSTGFCDQRRLGLLLHDSIQIPRQLGEVASFGGSNIEPSVRSCFQFANNKPEIEAALFLDWMRLEPQSMVWLPVLHRVAAAETAKHQAKCNICKECPIIGFRYRSLKHFNYDICQSCFFSGRVAKGHKMHYPMVEYCTPTTSGEDVRDFAKVLKNKFRTKRYFAKHPRMGYLPVQTVLEGDNMETPVTLINFWPVDSAPASSPQLSHDDTHSRIEHYASRLAEMENSNGSYLNDSISPNESIDDEHLLIQHYCQSLNQDSPLSQPRSPAQILISLESEERGELERILADLEEENRNLQAEYDRLKQQHEHKGLSPLPSPPEMMPTSPQSPRDAELIAEAKLLRQHKGRLEARMQILEDHNKQLESQLHRLRQLLEQPQAEAKVNGTTVSSPSTSLQRSDSSQPMLLRVVGSQTSDSMGEEDLLSPPQDTSTGLEEVMEQLNNSFPSSRGRNTPGKPMREDTM
"
     misc_feature    345..353
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: dystrophin Dp427c unique N-terminus"
     misc_feature    354..1040
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: Actin binding domain"
     misc_feature    366..677
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Calponin homology domain; actin-binding domain
                     which may be present as a single copy or in tandem repeats
                     (which increases binding affinity). The CH domain is found
                     in cytoskeletal and signal transduction proteins,
                     including actin-binding proteins like...; Region: CH;
                     cd00014"
                     /db_xref="CDD:28898"
     misc_feature    order(366..371,375..383,390..392,399..401,561..566,
                     573..575,582..584,588..590,633..638,645..650,654..659,
                     666..671)
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="putative actin binding surface [polypeptide
                     binding]; other site"
                     /db_xref="CDD:28898"
     misc_feature    723..1040
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Calponin homology domain; actin-binding domain
                     which may be present as a single copy or in tandem repeats
                     (which increases binding affinity). The CH domain is found
                     in cytoskeletal and signal transduction proteins,
                     including actin-binding proteins like...; Region: CH;
                     cd00014"
                     /db_xref="CDD:28898"
     misc_feature    order(723..728,732..740,747..749,756..758,918..923,
                     930..932,942..944,948..950,996..1001,1008..1013,
                     1017..1022,1029..1034)
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="putative actin binding surface [polypeptide
                     binding]; other site"
                     /db_xref="CDD:28898"
     misc_feature    1077..9440
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: central rod domain"
     misc_feature    1077..1301
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: hinge region 1"
     misc_feature    1329..1661
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 1"
     misc_feature    1341..1994
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    1662..1988
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 2"
     misc_feature    1662..1679
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    1779..2327
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    1989..2321
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 3"
     misc_feature    1992..2009
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    2322..2471
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: hinge region 2"
     misc_feature    2472..2804
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 4"
     misc_feature    2499..3119
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    2805..3122
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 5"
     misc_feature    2805..2822
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    3123..3455
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 6"
     misc_feature    3456..3782
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 7"
     misc_feature    3465..4109
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    3783..4109
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 8"
     misc_feature    3783..3800
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    4110..4421
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 9"
     misc_feature    4122..4742
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    4422..4709
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 10"
     misc_feature    4422..4439
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    4701..5024
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 11"
     misc_feature    4719..5348
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    5025..5348
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 12"
     misc_feature    5025..5042
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    5349..5654
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 13"
     misc_feature    5355..5648
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeat; Region: Spectrin; pfam00435"
                     /db_xref="CDD:201223"
     misc_feature    5430..6257
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Uncharacterized archaeal coiled-coil protein
                     [Function unknown]; Region: COG1340"
                     /db_xref="CDD:31531"
     misc_feature    5655..5942
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 14"
     misc_feature    5658..6224
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    5943..6239
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 15"
     misc_feature    5946..5963
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    6294..6623
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 16"
     misc_feature    6318..6944
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    6624..6944
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 17"
     misc_feature    6624..6641
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    6633..7280
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    6945..7274
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 18"
     misc_feature    order(6945..6953,6957..6965)
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    7275..7589
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 19"
     misc_feature    7590..7730
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: hinge region 3"
     misc_feature    7731..8051
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 20"
     misc_feature    7734..8384
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    8052..8378
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 21"
     misc_feature    8052..8069
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    8379..8726
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 22"
     misc_feature    8388..9119
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    8727..9113
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 23"
     misc_feature    8727..8744
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    9114..9440
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: repeat region 24"
     misc_feature    9123..>9455
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    9360..9656
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: hinge region 4"
     misc_feature    9441..9455
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    9486..9596
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: WW-domain"
     misc_feature    9495..9584
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Two conserved tryptophans domain; also known as the
                     WWP or rsp5 domain; around 40 amino acids; functions as an
                     interaction module in a diverse set of signalling
                     proteins; binds specific proline-rich sequences but at low
                     affinities compared to other...; Region: WW; cd00201"
                     /db_xref="CDD:29258"
     misc_feature    order(9534..9536,9567..9569)
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="binding pocket"
                     /db_xref="CDD:29258"
     misc_feature    9558..10544
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="dystroglycan binding site"
     misc_feature    9579..9941
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="EF hand; Region: efhand_1; pfam09068"
                     /db_xref="CDD:149945"
     misc_feature    9618..10220
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: Cysteine-rich domain"
     misc_feature    9708..9791
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: EF-hand 1"
     misc_feature    9852..9938
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: EF-hand 2"
     misc_feature    9951..10226
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="EF-hand; Region: efhand_2; pfam09069"
                     /db_xref="CDD:149946"
     misc_feature    10218..11375
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: Carboxy-terminal region"
     misc_feature    10239..10382
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: ZZ-domain"
     misc_feature    10251..10397
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Zinc finger, ZZ type. Zinc finger present in
                     dystrophin and dystrobrevin. The ZZ motif coordinates two
                     zinc ions and most likely participates in ligand binding
                     or molecular scaffolding. Dystrophin attaches actin
                     filaments to an integral membrane...; Region:
                     ZZ_dystrophin; cd02334"
                     /db_xref="CDD:30238"
     misc_feature    order(10257..10259,10266..10268,10302..10304,10311..10313,
                     10329..10331,10338..10340,10368..10370,10380..10382)
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Zinc-binding sites [ion binding]; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(10257..10259,10266..10268,10329..10331,10338..10340)
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="zinc cluster 1 [ion binding]; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(10260..10262,10293..10295,10299..10301,10317..10319,
                     10323..10325)
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="putative charged binding surface; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(10296..10298,10341..10343,10386..10388,10395..10397)
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="putative hydrophobic binding surface; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(10302..10304,10311..10313,10368..10370,10380..10382)
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="zinc cluster 2 [ion binding]; other site"
                     /db_xref="CDD:30238"
     misc_feature    10593..10595
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    10650..10802
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="alpha1-syntrophin binding site"
     misc_feature    10803..10925
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="beta1-syntrophin binding site"
     misc_feature    10992..11099
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Region: (Leu)6-heptad repeat"
     variation       718
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1800256"
     STS             858..966
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99269"
     variation       1122
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1800264"
     variation       1157
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1800265"
     variation       1415
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1800266"
     variation       1418
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72470507"
     STS             1598..2172
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="MARC_84337-84338:1278013457:1"
                     /db_xref="UniSTS:532589"
     variation       1657
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72468699"
     variation       1990
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1800257"
     variation       1994
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1800258"
     STS             2060..2646
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="MARC_84339-84340:1278014518:1"
                     /db_xref="UniSTS:532590"
     variation       2187
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1800259"
     variation       2189
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1800267"
     variation       2208
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72468692"
     variation       2671
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1800260"
     variation       2711
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72468681"
     variation       2777
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72468680"
     variation       2810
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72468679"
     variation       3291
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72468667"
     variation       3341
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1800268"
     variation       3350
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72468666"
     variation       3440
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1800261"
     variation       3909
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1800262"
     STS             3927..4025
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99474"
     variation       4054
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1800269"
     variation       4152
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1800270"
     variation       4451
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1800263"
     variation       4595
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72468647"
     variation       4726
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1057872"
     variation       4849
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72468638"
     STS             4852..4964
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99582"
     variation       5197
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72468634"
     variation       5297
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1801185"
     variation       5360
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72468632"
     variation       5483
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72468630"
     variation       5554
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1801187"
     STS             5731..6288
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="MARC_84357-84358:1278016549:1"
                     /db_xref="UniSTS:532591"
     variation       5779
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1800271"
     variation       5850
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1064325"
     variation       5852
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1801186"
     STS             5956..6050
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99541"
     variation       6095
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1800272"
     variation       6348
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72468613"
     STS             6612..6736
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99225"
     variation       6783
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1800273"
     STS             6986..7068
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99066"
     variation       7148
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72466595"
     variation       7400
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1800274"
     variation       7416
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1800275"
     variation       7503
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72466590"
     STS             7684..7795
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DXS7499"
                     /db_xref="UniSTS:30753"
     variation       8048
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1801188"
     variation       8140
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72466581"
     STS             8205..8340
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99382"
     variation       8375
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1801189"
     STS             8547..8646
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99545"
     variation       8642
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72466575"
     variation       8816
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72466574"
     variation       8891
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72466570"
     variation       8899
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72466569"
     variation       9130
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1800280"
     STS             9141..9243
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99400"
     variation       9172
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72466567"
     variation       9413
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72466563"
     variation       9414
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72466562"
     STS             9892..9959
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99128"
     variation       10940
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72466538"
     variation       11109
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1800281"
     variation       11338
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1795743"
     STS             11460..11653
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="PMC316713P2"
                     /db_xref="UniSTS:273040"
     STS             11728..11916
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="G15848"
                     /db_xref="UniSTS:3168"
     STS             11769..11901
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DXS1234"
                     /db_xref="UniSTS:146800"
     variation       11858..11859
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="acac"
                     /replace="taca"
                     /db_xref="dbSNP:3833413"
     variation       12302
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="acaa"
                     /db_xref="dbSNP:72466531"
     variation       12346
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:72466530"
     STS             12384..12452
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DXS503"
                     /db_xref="UniSTS:99031"
     variation       12426
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="gat"
                     /db_xref="dbSNP:72466529"
     variation       12623
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="cttt"
                     /db_xref="dbSNP:72466527"
     STS             12690..12840
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DXS6988E"
                     /db_xref="UniSTS:32060"
     variation       12825
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3361"
     STS             12846..12946
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="A002S20"
                     /db_xref="UniSTS:57879"
     variation       12943
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="aaag"
                     /db_xref="dbSNP:72466526"
     variation       12969
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="tgtt"
                     /db_xref="dbSNP:72466525"
     variation       13109
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3198427"
     variation       13136
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="ttcat"
                     /db_xref="dbSNP:72466524"
     variation       13417
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72466523"
     variation       13531
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="atgtgacgctggacctt"
                     /db_xref="dbSNP:72466522"
     variation       13563
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:11550191"
     variation       13615
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="aagt"
                     /db_xref="dbSNP:72466521"
     STS             13696..13887
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:506537"
     variation       13805
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1057915"
     STS             13953..14037
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="PMC108984P1"
                     /db_xref="UniSTS:270148"
     variation       13959
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="actt"
                     /db_xref="dbSNP:72466520"
     polyA_signal    14047..14052
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
     polyA_site      14069
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
ORIGIN      
cgttaaatgcaaacgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactgacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgcataataaatgactgaaagaatcatgttaggcatgcccacctaacctaacttgaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcccagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggagaaagatgctgttttgcactatcttgatttgttacagcagccaacttattggcatgatggagtgacaggaaaaacagctggcatggaagatgaaagagaagatgttcaaaagaaaacattcacaaaatgggtaaatgcacaattttctaagtttgggaagcagcatattgagaacctcttcagtgacctacaggatgggaggcgcctcctagacctcctcgaaggcctgacagggcaaaaactgccaaaagaaaaaggatccacaagagttcatgccctgaacaatgtcaacaaggcactgcgggttttgcagaacaataatgttgatttagtgaatattggaagtactgacatcgtagatggaaatcataaactgactcttggtttgatttggaatataatcctccactggcaggtcaaaaatgtaatgaaaaatatcatggctggattgcaacaaaccaacagtgaaaagattctcctgagctgggtccgacaatcaactcgtaattatccacaggttaatgtaatcaacttcaccaccagctggtctgatggcctggctttgaatgctctcatccatagtcataggccagacctatttgactggaatagtgtggtttgccagcagtcagccacacaacgactggaacatgcattcaacatcgccagatatcaattaggcatagagaaactactcgatcctgaagatgttgataccacctatccagataagaagtccatcttaatgtacatcacatcactcttccaagttttgcctcaacaagtgagcattgaagccatccaggaagtggaaatgttgccaaggccacctaaagtgactaaagaagaacattttcagttacatcatcaaatgcactattctcaacagatcacggtcagtctagcacagggatatgagagaacttcttcccctaagcctcgattcaagagctatgcctacacacaggctgcttatgtcaccacctctgaccctacacggagcccatttccttcacagcatttggaagctcctgaagacaagtcatttggcagttcattgatggagagtgaagtaaacctggaccgttatcaaacagctttagaagaagtattatcgtggcttctttctgctgaggacacattgcaagcacaaggagagatttctaatgatgtggaagtggtgaaagaccagtttcatactcatgaggggtacatgatggatttgacagcccatcagggccgggttggtaatattctacaattgggaagtaagctgattggaacaggaaaattatcagaagatgaagaaactgaagtacaagagcagatgaatctcctaaattcaagatgggaatgcctcagggtagctagcatggaaaaacaaagcaatttacatagagttttaatggatctccagaatcagaaactgaaagagttgaatgactggctaacaaaaacagaagaaagaacaaggaaaatggaggaagagcctcttggacctgatcttgaagacctaaaacgccaagtacaacaacataaggtgcttcaagaagatctagaacaagaacaagtcagggtcaattctctcactcacatggtggtggtagttgatgaatctagtggagatcacgcaactgctgctttggaagaacaacttaaggtattgggagatcgatgggcaaacatctgtagatggacagaagaccgctgggttcttttacaagacatccttctcaaatggcaacgtcttactgaagaacagtgcctttttagtgcatggctttcagaaaaagaagatgcagtgaacaagattcacacaactggctttaaagatcaaaatgaaatgttatcaagtcttcaaaaactggccgttttaaaagcggatctagaaaagaaaaagcaatccatgggcaaactgtattcactcaaacaagatcttctttcaacactgaagaataagtcagtgacccagaagacggaagcatggctggataactttgcccggtgttgggataatttagtccaaaaacttgaaaagagtacagcacagatttcacaggctgtcaccaccactcagccatcactaacacagacaactgtaatggaaacagtaactacggtgaccacaagggaacagatcctggtaaagcatgctcaagaggaacttccaccaccacctccccaaaagaagaggcagattactgtggattctgaaattaggaaaaggttggatgttgatataactgaacttcacagctggattactcgctcagaagctgtgttgcagagtcctgaatttgcaatctttcggaaggaaggcaacttctcagacttaaaagaaaaagtcaatgccatagagcgagaaaaagctgagaagttcagaaaactgcaagatgccagcagatcagctcaggccctggtggaacagatggtgaatgagggtgttaatgcagatagcatcaaacaagcctcagaacaactgaacagccggtggatcgaattctgccagttgctaagtgagagacttaactggctggagtatcagaacaacatcatcgctttctataatcagctacaacaattggagcagatgacaactactgctgaaaactggttgaaaatccaacccaccaccccatcagagccaacagcaattaaaagtcagttaaaaatttgtaaggatgaagtcaaccggctatcaggtcttcaacctcaaattgaacgattaaaaattcaaagcatagccctgaaagagaaaggacaaggacccatgttcctggatgcagactttgtggcctttacaaatcattttaagcaagtcttttctgatgtgcaggccagagagaaagagctacagacaatttttgacactttgccaccaatgcgctatcaggagaccatgagtgccatcaggacatgggtccagcagtcagaaaccaaactctccatacctcaacttagtgtcaccgactatgaaatcatggagcagagactcggggaattgcaggctttacaaagttctctgcaagagcaacaaagtggcctatactatctcagcaccactgtgaaagagatgtcgaagaaagcgccctctgaaattagccggaaatatcaatcagaatttgaagaaattgagggacgctggaagaagctctcctcccagctggttgagcattgtcaaaagctagaggagcaaatgaataaactccgaaaaattcagaatcacatacaaaccctgaagaaatggatggctgaagttgatgtttttctgaaggaggaatggcctgcccttggggattcagaaattctaaaaaagcagctgaaacagtgcagacttttagtcagtgatattcagacaattcagcccagtctaaacagtgtcaatgaaggtgggcagaagataaagaatgaagcagagccagagtttgcttcgagacttgagacagaactcaaagaacttaacactcagtgggatcacatgtgccaacaggtctatgccagaaaggaggccttgaagggaggtttggagaaaactgtaagcctccagaaagatctatcagagatgcacgaatggatgacacaagctgaagaagagtatcttgagagagattttgaatataaaactccagatgaattacagaaagcagttgaagagatgaagagagctaaagaagaggcccaacaaaaagaagcgaaagtgaaactccttactgagtctgtaaatagtgtcatagctcaagctccacctgtagcacaagaggccttaaaaaaggaacttgaaactctaaccaccaactaccagtggctctgcactaggctgaatgggaaatgcaagactttggaagaagtttgggcatgttggcatgagttattgtcatacttggagaaagcaaacaagtggctaaatgaagtagaatttaaacttaaaaccactgaaaacattcctggcggagctgaggaaatctctgaggtgctagattcacttgaaaatttgatgcgacattcagaggataacccaaatcagattcgcatattggcacagaccctaacagatggcggagtcatggatgagctaatcaatgaggaacttgagacatttaattctcgttggagggaactacatgaagaggctgtaaggaggcaaaagttgcttgaacagagcatccagtctgcccaggagactgaaaaatccttacacttaatccaggagtccctcacattcattgacaagcagttggcagcttatattgcagacaaggtggacgcagctcaaatgcctcaggaagcccagaaaatccaatctgatttgacaagtcatgagatcagtttagaagaaatgaagaaacataatcaggggaaggaggctgcccaaagagtcctgtctcagattgatgttgcacagaaaaaattacaagatgtctccatgaagtttcgattattccagaaaccagccaattttgagcagcgtctacaagaaagtaagatgattttagatgaagtgaagatgcacttgcctgcattggaaacaaagagtgtggaacaggaagtagtacagtcacagctaaatcattgtgtgaacttgtataaaagtctgagtgaagtgaagtctgaagtggaaatggtgataaagactggacgtcagattgtacagaaaaagcagacggaaaatcccaaagaacttgatgaaagagtaacagctttgaaattgcattataatgagctgggagcaaaggtaacagaaagaaagcaacagttggagaaatgcttgaaattgtcccgtaagatgcgaaaggaaatgaatgtcttgacagaatggctggcagctacagatatggaattgacaaagagatcagcagttgaaggaatgcctagtaatttggattctgaagttgcctggggaaaggctactcaaaaagagattgagaaacagaaggtgcacctgaagagtatcacagaggtaggagaggccttgaaaacagttttgggcaagaaggagacgttggtggaagataaactcagtcttctgaatagtaactggatagctgtcacctcccgagcagaagagtggttaaatcttttgttggaataccagaaacacatggaaacttttgaccagaatgtggaccacatcacaaagtggatcattcaggctgacacacttttggatgaatcagagaaaaagaaaccccagcaaaaagaagacgtgcttaagcgtttaaaggcagaactgaatgacatacgcccaaaggtggactctacacgtgaccaagcagcaaacttgatggcaaaccgcggtgaccactgcaggaaattagtagagccccaaatctcagagctcaaccatcgatttgcagccatttcacacagaattaagactggaaaggcctccattcctttgaaggaattggagcagtttaactcagatatacaaaaattgcttgaaccactggaggctgaaattcagcagggggtgaatctgaaagaggaagacttcaataaagatatgaatgaagacaatgagggtactgtaaaagaattgttgcaaagaggagacaacttacaacaaagaatcacagatgagagaaagcgagaggaaataaagataaaacagcagctgttacagacaaaacataatgctctcaaggatttgaggtctcaaagaagaaaaaaggctctagaaatttctcatcagtggtatcagtacaagaggcaggctgatgatctcctgaaatgcttggatgacattgaaaaaaaattagccagcctacctgagcccagagatgaaaggaaaataaaggaaattgatcgggaattgcagaagaagaaagaggagctgaatgcagtgcgtaggcaagctgagggcttgtctgaggatggggccgcaatggcagtggagccaactcagatccagctcagcaagcgctggcgggaaattgagagcaaatttgctcagtttcgaagactcaactttgcacaaattcacactgtccgtgaagaaacgatgatggtgatgactgaagacatgcctttggaaatttcttatgtgccttctacttatttgactgaaatcactcatgtctcacaagccctattagaagtggaacaacttctcaatgctcctgacctctgtgctaaggactttgaagatctctttaagcaagaggagtctctgaagaatataaaagatagtctacaacaaagctcaggtcggattgacattattcatagcaagaagacagcagcattgcaaagtgcaacgcctgtggaaagggtgaagctacaggaagctctctcccagcttgatttccaatgggaaaaagttaacaaaatgtacaaggaccgacaagggcgatttgacagatctgttgagaaatggcggcgttttcattatgatataaagatatttaatcagtggctaacagaagctgaacagtttctcagaaagacacaaattcctgagaattgggaacatgctaaatacaaatggtatcttaaggaactccaggatggcattgggcagcggcaaactgttgtcagaacattgaatgcaactggggaagaaataattcagcaatcctcaaaaacagatgccagtattctacaggaaaaattgggaagcctgaatctgcggtggcaggaggtctgcaaacagctgtcagacagaaaaaagaggctagaagaacaaaagaatatcttgtcagaatttcaaagagatttaaatgaatttgttttatggttggaggaagcagataacattgctagtatcccacttgaacctggaaaagagcagcaactaaaagaaaagcttgagcaagtcaagttactggtggaagagttgcccctgcgccagggaattctcaaacaattaaatgaaactggaggacccgtgcttgtaagtgctcccataagcccagaagagcaagataaacttgaaaataagctcaagcagacaaatctccagtggataaaggtttccagagctttacctgagaaacaaggagaaattgaagctcaaataaaagaccttgggcagcttgaaaaaaagcttgaagaccttgaagagcagttaaatcatctgctgctgtggttatctcctattaggaatcagttggaaatttataaccaaccaaaccaagaaggaccatttgacgttcaggaaactgaaatagcagttcaagctaaacaaccggatgtggaagagattttgtctaaagggcagcatttgtacaaggaaaaaccagccactcagccagtgaagaggaagttagaagatctgagctctgagtggaaggcggtaaaccgtttacttcaagagctgagggcaaagcagcctgacctagctcctggactgaccactattggagcctctcctactcagactgttactctggtgacacaacctgtggttactaaggaaactgccatctccaaactagaaatgccatcttccttgatgttggaggtacctgctctggcagatttcaaccgggcttggacagaacttaccgactggctttctctgcttgatcaagttataaaatcacagagggtgatggtgggtgaccttgaggatatcaacgagatgatcatcaagcagaaggcaacaatgcaggatttggaacagaggcgtccccagttggaagaactcattaccgctgcccaaaatttgaaaaacaagaccagcaatcaagaggctagaacaatcattacggatcgaattgaaagaattcagaatcagtgggatgaagtacaagaacaccttcagaaccggaggcaacagttgaatgaaatgttaaaggattcaacacaatggctggaagctaaggaagaagctgagcaggtcttaggacaggccagagccaagcttgagtcatggaaggagggtccctatacagtagatgcaatccaaaagaaaatcacagaaaccaagcagttggccaaagacctccgccagtggcagacaaatgtagatgtggcaaatgacttggccctgaaacttctccgggattattctgcagatgataccagaaaagtccacatgataacagagaatatcaatgcctcttggagaagcattcataaaagggtgagtgagcgagaggctgctttggaagaaactcatagattactgcaacagttccccctggacctggaaaagtttcttgcctggcttacagaagctgaaacaactgccaatgtcctacaggatgctacccgtaaggaaaggctcctagaagactccaagggagtaaaagagctgatgaaacaatggcaagacctccaaggtgaaattgaagctcacacagatgtttatcacaacctggatgaaaacagccaaaaaatcctgagatccctggaaggttccgatgatgcagtcctgttacaaagacgtttggataacatgaacttcaagtggagtgaacttcggaaaaagtctctcaacattaggtcccatttggaagccagttctgaccagtggaagcgtctgcacctttctctgcaggaacttctggtgtggctacagctgaaagatgatgaattaagccggcaggcacctattggaggcgactttccagcagttcagaagcagaacgatgtacatagggccttcaagagggaattgaaaactaaagaacctgtaatcatgagtactcttgagactgtacgaatatttctgacagagcagcctttggaaggactagagaaactctaccaggagcccagagagctgcctcctgaggagagagcccagaatgtcactcggcttctacgaaagcaggctgaggaggtcaatactgagtgggaaaaattgaacctgcactccgctgactggcagagaaaaatagatgagacccttgaaagactccaggaacttcaagaggccacggatgagctggacctcaagctgcgccaagctgaggtgatcaagggatcctggcagcccgtgggcgatctcctcattgactctctccaagatcacctcgagaaagtcaaggcacttcgaggagaaattgcgcctctgaaagagaacgtgagccacgtcaatgaccttgctcgccagcttaccactttgggcattcagctctcaccgtataacctcagcactctggaagacctgaacaccagatggaagcttctgcaggtggccgtcgaggaccgagtcaggcagctgcatgaagcccacagggactttggtccagcatctcagcactttctttccacgtctgtccagggtccctgggagagagccatctcgccaaacaaagtgccctactatatcaaccacgagactcaaacaacttgctgggaccatcccaaaatgacagagctctaccagtctttagctgacctgaataatgtcagattctcagcttataggactgccatgaaactccgaagactgcagaaggccctttgcttggatctcttgagcctgtcagctgcatgtgatgccttggaccagcacaacctcaagcaaaatgaccagcccatggatatcctgcagattattaattgtttgaccactatttatgaccgcctggagcaagagcacaacaatttggtcaacgtccctctctgcgtggatatgtgtctgaactggctgctgaatgtttatgatacgggacgaacagggaggatccgtgtcctgtcttttaaaactggcatcatttccctgtgtaaagcacatttggaagacaagtacagataccttttcaagcaagtggcaagttcaacaggattttgtgaccagcgcaggctgggcctccttctgcatgattctatccaaattccaagacagttgggtgaagttgcatcctttgggggcagtaacattgagccaagtgtccggagctgcttccaatttgctaataataagccagagatcgaagcggccctcttcctagactggatgagactggaaccccagtccatggtgtggctgcccgtcctgcacagagtggctgctgcagaaactgccaagcatcaggccaaatgtaacatctgcaaagagtgtccaatcattggattcaggtacaggagtctaaagcactttaattatgacatctgccaaagctgctttttttctggtcgagttgcaaaaggccataaaatgcactatcccatggtggaatattgcactccgactacatcaggagaagatgttcgagactttgccaaggtactaaaaaacaaatttcgaaccaaaaggtattttgcgaagcatccccgaatgggctacctgccagtgcagactgtcttagagggggacaacatggaaactcccgttactctgatcaacttctggccagtagattctgcgcctgcctcgtcccctcagctttcacacgatgatactcattcacgcattgaacattatgctagcaggctagcagaaatggaaaacagcaatggatcttatctaaatgatagcatctctcctaatgagagcatagatgatgaacatttgttaatccagcattactgccaaagtttgaaccaggactcccccctgagccagcctcgtagtcctgcccagatcttgatttccttagagagtgaggaaagaggggagctagagagaatcctagcagatcttgaggaagaaaacaggaatctgcaagcagaatatgaccgtctaaagcagcagcacgaacataaaggcctgtccccactgccgtcccctcctgaaatgatgcccacctctccccagagtccccgggatgctgagctcattgctgaggccaagctactgcgtcaacacaaaggccgcctggaagccaggatgcaaatcctggaagaccacaataaacagctggagtcacagttacacaggctaaggcagctgctggagcaaccccaggcagaggccaaagtgaatggcacaacggtgtcctctccttctacctctctacagaggtccgacagcagtcagcctatgctgctccgagtggttggcagtcaaacttcggactccatgggtgaggaagatcttctcagtcctccccaggacacaagcacagggttagaggaggtgatggagcaactcaacaactccttccctagttcaagaggaagaaatacccctggaaagccaatgagagaggacacaatgtaggaagtcttttccacatggcagatgatttgggcagagcgatggagtccttagtatcagtcatgacagatgaagaaggagcagaataaatgttttacaactcctgattcccgcatggtttttataatattcatacaacaaagaggattagacagtaagagtttacaagaaataaatctatatttttgtgaagggtagtggtattatactgtagatttcagtagtttctaagtctgttattgttttgttaacaatggcaggttttacacgtctatgcaattgtacaaaaaagttataagaaaactacatgtaaaatcttgatagctaaataacttgccatttctttatatggaacgcattttgggttgtttaaaaatttataacagttataaagaaagattgtaaactaaagtgtgctttataaaaaaaagttgtttataaaaacccctaaaaacaaaacaaacacacacacacacacatacacacacacacacaaaactttgaggcagcgcattgttttgcatccttttggcgtgatatccatatgaaattcatggctttttctttttttgcatattaaagataagacttcctctaccaccacaccaaatgactactacacactgctcatttgagaactgtcagctgagtggggcaggcttgagttttcatttcatatatctatatgtctataagtatataaatactatagttatatagataaagagatacgaatttctatagactgactttttccattttttaaatgttcatgtcacatcctaatagaaagaaattacttctagtcagtcatccaggcttacctgcttggtctagaatggatttttcccggagccggaagccaggaggaaactacaccacactaaaacattgtctacagctccagatgtttctcattttaaacaactttccactgacaacgaaagtaaagtaaagtattggatttttttaaagggaacatgtgaatgaatacacaggacttattatatcagagtgagtaatcggttggttggttgattgattgattgattgatacattcagcttcctgctgctagcaatgccacgatttagatttaatgatgcttcagtggaaatcaatcagaaggtattctgaccttgtgaacatcagaaggtattttttaactcccaagcagtagcaggacgatgatagggctggagggctatggattcccagcccatccctgtgaaggagtaggccactctttaagtgaaggattggatgattgttcataatacataaagttctctgtaattacaactaaattattatgccctcttctcacagtcaaaaggaactgggtggtttggtttttgttgcttttttagatttattgtcccatgtgggatgagtttttaaatgccacaagacataatttaaaataaataaactttgggaaaaggtgtaaaacagtagccccatcacatttgtgatactgacaggtatcaacccagaagcccatgaactgtgtttccatcctttgcatttctctgcgagtagttccacacaggtttgtaagtaagtaagaaagaaggcaaattgattcaaatgttacaaaaaaacccttcttggtggattagacaggttaaatatataaacaaacaaacaaaaattgctcaaaaaagaggagaaaagctcaagaggaaaagctaaggactggtaggaaaaagctttactctttcatgccattttatttctttttgatttttaaatcattcattcaatagataccaccgtgtgacctataattttgcaaatctgttacctctgacatcaagtgtaattagcttttggagagtgggctgacatcaagtgtaattagcttttggagagtgggttttgtccattattaataattaattaattaacatcaaacacggcttctcatgctatttctacctcactttggttttggggtgttcctgataattgtgcacacctgagttcacagcttcaccacttgtccattgcgttattttctttttcctttataattctttctttttccttcataattttcaaaagaaaacccaaagctctaaggtaacaaattaccaaattacatgaagatttggtttttgtcttgcatttttttcctttatgtgacgctggaccttttctttacccaaggatttttaaaactcagatttaaaacaaggggttactttacatcctactaagaagtttaagtaagtaagtttcattctaaaatcagaggtaaatagagtgcataaataattttgttttaatctttttgtttttcttttagacacattagctctggagtgagtctgtcataatatttgaacaaaaattgagagctttattgctgcattttaagcataattaatttggacattatttcgtgttgtgttctttataaccaccaagtattaaactgtaaatcataatgtaactgaagcataaacatcacatggcatgttttgtcattgttttcaggtactgagttcttacttgagtatcataatatattgtgttttaacaccaacactgtaacatttacgaattatttttttaaacttcagttttactgcattttcacaacatatcagacttcaccaaatatatgccttactattgtattatagtactgctttactgtgtatctcaataaagcacgcagttatgttac
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:1756 -> Molecular function: GO:0002162 [dystroglycan binding] evidence: IPI
            GeneID:1756 -> Molecular function: GO:0003779 [actin binding] evidence: IDA
            GeneID:1756 -> Molecular function: GO:0003779 [actin binding] evidence: TAS
            GeneID:1756 -> Molecular function: GO:0005200 [structural constituent of cytoskeleton] evidence: TAS
            GeneID:1756 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
            GeneID:1756 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:1756 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA
            GeneID:1756 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: IDA
            GeneID:1756 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: TAS
            GeneID:1756 -> Molecular function: GO:0017022 [myosin binding] evidence: IDA
            GeneID:1756 -> Molecular function: GO:0017166 [vinculin binding] evidence: IPI
            GeneID:1756 -> Molecular function: GO:0050998 [nitric-oxide synthase binding] evidence: ISS
            GeneID:1756 -> Biological process: GO:0001954 [positive regulation of cell-matrix adhesion] evidence: IEA
            GeneID:1756 -> Biological process: GO:0002027 [regulation of heart rate] evidence: IMP
            GeneID:1756 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA
            GeneID:1756 -> Biological process: GO:0007517 [muscle organ development] evidence: NAS
            GeneID:1756 -> Biological process: GO:0008065 [establishment of blood-nerve barrier] evidence: IEA
            GeneID:1756 -> Biological process: GO:0010880 [regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum] evidence: ISS
            GeneID:1756 -> Biological process: GO:0010881 [regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion] evidence: ISS
            GeneID:1756 -> Biological process: GO:0010976 [positive regulation of neuron projection development] evidence: IMP
            GeneID:1756 -> Biological process: GO:0014809 [regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion] evidence: ISS
            GeneID:1756 -> Biological process: GO:0014819 [regulation of skeletal muscle contraction] evidence: ISS
            GeneID:1756 -> Biological process: GO:0014904 [myotube cell development] evidence: IEA
            GeneID:1756 -> Biological process: GO:0021629 [olfactory nerve structural organization] evidence: IEA
            GeneID:1756 -> Biological process: GO:0030049 [muscle filament sliding] evidence: TAS
            GeneID:1756 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS
            GeneID:1756 -> Biological process: GO:0033137 [negative regulation of peptidyl-serine phosphorylation] evidence: ISS
            GeneID:1756 -> Biological process: GO:0034613 [cellular protein localization] evidence: IMP
            GeneID:1756 -> Biological process: GO:0043043 [peptide biosynthetic process] evidence: IDA
            GeneID:1756 -> Biological process: GO:0043623 [cellular protein complex assembly] evidence: ISS
            GeneID:1756 -> Biological process: GO:0044458 [motile cilium assembly] evidence: TAS
            GeneID:1756 -> Biological process: GO:0045213 [neurotransmitter receptor metabolic process] evidence: IEA
            GeneID:1756 -> Biological process: GO:0045666 [positive regulation of neuron differentiation] evidence: IMP
            GeneID:1756 -> Biological process: GO:0046716 [muscle cell homeostasis] evidence: IEA
            GeneID:1756 -> Biological process: GO:0048747 [muscle fiber development] evidence: IEA
            GeneID:1756 -> Biological process: GO:0051647 [nucleus localization] evidence: IEA
            GeneID:1756 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP
            GeneID:1756 -> Biological process: GO:0060314 [regulation of ryanodine-sensitive calcium-release channel activity] evidence: ISS
            GeneID:1756 -> Biological process: GO:0060857 [establishment of glial blood-brain barrier] evidence: IEA
            GeneID:1756 -> Biological process: GO:0086001 [regulation of cardiac muscle cell action potential] evidence: ISS
            GeneID:1756 -> Biological process: GO:0090287 [regulation of cellular response to growth factor stimulus] evidence: IMP
            GeneID:1756 -> Biological process: GO:1901385 [regulation of voltage-gated calcium channel activity] evidence: ISS
            GeneID:1756 -> Biological process: GO:2000169 [regulation of peptidyl-cysteine S-nitrosylation] evidence: ISS
            GeneID:1756 -> Biological process: GO:2000651 [positive regulation of sodium ion transmembrane transporter activity] evidence: ISS
            GeneID:1756 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:1756 -> Cellular component: GO:0005634 [nucleus] evidence: TAS
            GeneID:1756 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:1756 -> Cellular component: GO:0005856 [cytoskeleton] evidence: IEA
            GeneID:1756 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
            GeneID:1756 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
            GeneID:1756 -> Cellular component: GO:0009986 [cell surface] evidence: IDA
            GeneID:1756 -> Cellular component: GO:0015629 [actin cytoskeleton] evidence: TAS
            GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: IDA
            GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: NAS
            GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: TAS
            GeneID:1756 -> Cellular component: GO:0030018 [Z disc] evidence: IEA
            GeneID:1756 -> Cellular component: GO:0030055 [cell-substrate junction] evidence: IEA
            GeneID:1756 -> Cellular component: GO:0030175 [filopodium] evidence: IDA
            GeneID:1756 -> Cellular component: GO:0042383 [sarcolemma] evidence: IDA
            GeneID:1756 -> Cellular component: GO:0043034 [costamere] evidence: IDA
            GeneID:1756 -> Cellular component: GO:0043234 [protein complex] evidence: IDA
            GeneID:1756 -> Cellular component: GO:0044306 [neuron projection terminus] evidence: IEA
            GeneID:1756 -> Cellular component: GO:0045121 [membrane raft] evidence: IEA
            GeneID:1756 -> Cellular component: GO:0045121 [membrane raft] evidence: TAS
            GeneID:1756 -> Cellular component: GO:0045211 [postsynaptic membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.