2024-04-24 13:07:43, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_000094 9169 bp mRNA linear PRI 26-MAY-2013 DEFINITION Homo sapiens collagen, type VII, alpha 1 (COL7A1), mRNA. ACCESSION NM_000094 VERSION NM_000094.3 GI:157389010 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 9169) AUTHORS Rodriguez,F.A., Gana,M.J., Yubero,M.J., Zillmann,G., Kramer,S.M., Catalan,J., Rubio-Astudillo,J., Gonzalez,S., Liu,L., Ozoemena,L., Mellerio,J.E., McGrath,J.A., Palisson,F. and Conget,P. TITLE Novel and recurrent COL7A1 mutations in Chilean patients with dystrophic epidermolysis bullosa JOURNAL J. Dermatol. Sci. 65 (2), 149-152 (2012) PUBMED 22209565 REMARK GeneRIF: Letter: report novel and recurrent COL7A1 mutations in Chilean patients with dystrophic epidermolysis bullosa. Erratum:[J Dermatol Sci. 2012 Apr;66(1):85. Mellerio, Jemima M [corrected to Mellerio, Jemima E]] REFERENCE 2 (bases 1 to 9169) AUTHORS Wertheim-Tysarowska,K., Sobczynska-Tomaszewska,A., Kowalewski,C., Kutkowska-Kazmierczak,A., Wozniak,K., Niepokoj,K., Klausegger,A., Sypniewska-Jutkiewicz,J., Stepien,A. and Bal,J. TITLE Novel and recurrent COL7A1 mutation in a Polish population JOURNAL Eur J Dermatol 22 (1), 23-28 (2012) PUBMED 22266148 REMARK GeneRIF: We present the first COL7A1 mutation analysis in Polish dystrophic epidermolysis bullosa patients. REFERENCE 3 (bases 1 to 9169) AUTHORS Jiang,W., Sun,T.T., Lei,P.C. and Zhu,X.J. TITLE Genotype-phenotype correlation in Chinese patients with dystrophic epidermolysis bullosa pruriginosa JOURNAL Acta Derm. Venereol. 92 (1), 50-53 (2012) PUBMED 21879237 REMARK GeneRIF: we have identified three pathogenic COL7A1 mutations (G1773R, splicing site mutation of c.6900+1G>C, and G2701W) in 3 dystrophic epidermolysis bullosa pruriginosa families. REFERENCE 4 (bases 1 to 9169) AUTHORS Lin,Y., Chen,X.J., Liu,W., Gong,B., Xie,J., Xiong,J.H., Cheng,J., Duan,X.L., Lin,Z.C., Huang,L.L., Wan,H.Y., Liu,X.Q., Song,L.H. and Yang,Z.L. TITLE Two novel mutations on exon 8 and intron 65 of COL7A1 gene in two Chinese brothers result in recessive dystrophic epidermolysis bullosa JOURNAL PLoS ONE 7 (11), E50579 (2012) PUBMED 23226319 REMARK GeneRIF: novel disease-causing mutations in the COL7A1 gene REFERENCE 5 (bases 1 to 9169) AUTHORS Frew,J., Lim,S.W., Klausseger,A., Chow,C.W., Tran,K., Su,J., Orchard,D., Varigos,G., Sawamura,D., Nishie,W., Shimizu,H. and Murrell,D.F. TITLE Autosomal dominant bullous dermolysis of the newborn associated with a heterozygous missense mutation p.G1673R in type VII collagen JOURNAL Australas. J. Dermatol. 52 (4), E1-E4 (2011) PUBMED 22070715 REMARK GeneRIF: The infant's genomic DNA from blood was found to be heterozygous for a missense mutation on exon 54 of COL7A1 (c.5017G > A, p.G1673R) not previously described in bullous dermolysis of the newborn. REFERENCE 6 (bases 1 to 9169) AUTHORS Gammon,W.R., Abernethy,M.L., Padilla,K.M., Prisayanh,P.S., Cook,M.E., Wright,J., Briggaman,R.A. and Hunt,S.W. III. TITLE Noncollagenous (NC1) domain of collagen VII resembles multidomain adhesion proteins involved in tissue-specific organization of extracellular matrix JOURNAL J. Invest. Dermatol. 99 (6), 691-696 (1992) PUBMED 1469284 REFERENCE 7 (bases 1 to 9169) AUTHORS Christiano,A.M., Rosenbaum,L.M., Chung-Honet,L.C., Parente,M.G., Woodley,D.T., Pan,T.C., Zhang,R.Z., Chu,M.L., Burgeson,R.E. and Uitto,J. TITLE The large non-collagenous domain (NC-1) of type VII collagen is amino-terminal and chimeric. Homology to cartilage matrix protein, the type III domains of fibronectin and the A domains of von Willebrand factor JOURNAL Hum. Mol. Genet. 1 (7), 475-481 (1992) PUBMED 1307247 REFERENCE 8 (bases 1 to 9169) AUTHORS Tanaka,T., Takahashi,K., Furukawa,F. and Imamura,S. TITLE Molecular cloning and characterization of type VII collagen cDNA JOURNAL Biochem. Biophys. Res. Commun. 183 (3), 958-963 (1992) PUBMED 1567409 REFERENCE 9 (bases 1 to 9169) AUTHORS Parente,M.G., Chung,L.C., Ryynanen,J., Woodley,D.T., Wynn,K.C., Bauer,E.A., Mattei,M.G., Chu,M.L. and Uitto,J. TITLE Human type VII collagen: cDNA cloning and chromosomal mapping of the gene JOURNAL Proc. Natl. Acad. Sci. U.S.A. 88 (16), 6931-6935 (1991) PUBMED 1871109 REFERENCE 10 (bases 1 to 9169) AUTHORS Seltzer,J.L., Eisen,A.Z., Bauer,E.A., Morris,N.P., Glanville,R.W. and Burgeson,R.E. TITLE Cleavage of type VII collagen by interstitial collagenase and type IV collagenase (gelatinase) derived from human skin JOURNAL J. Biol. Chem. 264 (7), 3822-3826 (1989) PUBMED 2537292 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from L02870.1, BQ300155.1, S51236.1, M65158.1 and AB209645.1. This sequence is a reference standard in the RefSeqGene project. On Sep 20, 2007 this sequence version replaced gi:17738300. Summary: This gene encodes the alpha chain of type VII collagen. The type VII collagen fibril, composed of three identical alpha collagen chains, is restricted to the basement zone beneath stratified squamous epithelia. It functions as an anchoring fibril between the external epithelia and the underlying stroma. Mutations in this gene are associated with all forms of dystrophic epidermolysis bullosa. In the absence of mutations, however, an acquired form of this disease can result from an autoimmune response made to type VII collagen. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: L02870.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-570 L02870.1 113-682 571-577 BQ300155.1 95-101 c 578-1641 L02870.1 690-1753 1642-1642 S51236.1 537-537 1643-2817 L02870.1 1755-2929 2818-4318 M65158.1 375-1875 4319-5509 AB209645.1 235-1425 5510-8946 L02870.1 5622-9058 8947-9169 AB209645.1 5459-5681 FEATURES Location/Qualifiers source 1..9169 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="3" /map="3p21.1" gene 1..9169 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="collagen, type VII, alpha 1" /db_xref="GeneID:1294" /db_xref="HGNC:2214" /db_xref="HPRD:00358" /db_xref="MIM:120120" exon 1..86 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" CDS 2..8836 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="LC collagen; collagen VII, alpha-1 polypeptide; collagen alpha-1(VII) chain; long-chain collagen" /codon_start=1 /product="collagen alpha-1(VII) chain precursor" /protein_id="NP_000085.1" /db_xref="GI:4502961" /db_xref="CCDS:CCDS2773.1" /db_xref="GeneID:1294" /db_xref="HGNC:2214" /db_xref="HPRD:00358" /db_xref="MIM:120120" /translation="
MTLRLLVAALCAGILAEAPRVRAQHRERVTCTRLYAADIVFLLDGSSSIGRSNFREVRSFLEGLVLPFSGAASAQGVRFATVQYSDDPRTEFGLDALGSGGDVIRAIRELSYKGGNTRTGAAILHVADHVFLPQLARPGVPKVCILITDGKSQDLVDTAAQRLKGQGVKLFAVGIKNADPEELKRVASQPTSDFFFFVNDFSILRTLLPLVSRRVCTTAGGVPVTRPPDDSTSAPRDLVLSEPSSQSLRVQWTAASGPVTGYKVQYTPLTGLGQPLPSERQEVNVPAGETSVRLRGLRPLTEYQVTVIALYANSIGEAVSGTARTTALEGPELTIQNTTAHSLLVAWRSVPGATGYRVTWRVLSGGPTQQQELGPGQGSVLLRDLEPGTDYEVTVSTLFGRSVGPATSLMARTDASVEQTLRPVILGPTSILLSWNLVPEARGYRLEWRRETGLEPPQKVVLPSDVTRYQLDGLQPGTEYRLTLYTLLEGHEVATPATVVPTGPELPVSPVTDLQATELPGQRVRVSWSPVPGATQYRIIVRSTQGVERTLVLPGSQTAFDLDDVQAGLSYTVRVSARVGPREGSASVLTVRREPETPLAVPGLRVVVSDATRVRVAWGPVPGASGFRISWSTGSGPESSQTLPPDSTATDITGLQPGTTYQVAVSVLRGREEGPAAVIVARTDPLGPVRTVHVTQASSSSVTITWTRVPGATGYRVSWHSAHGPEKSQLVSGEATVAELDGLEPDTEYTVHVRAHVAGVDGPPASVVVRTAPEPVGRVSRLQILNASSDVLRITWVGVTGATAYRLAWGRSEGGPMRHQILPGNTDSAEIRGLEGGVSYSVRVTALVGDREGTPVSIVVTTPPEAPPALGTLHVVQRGEHSLRLRWEPVPRAQGFLLHWQPEGGQEQSRVLGPELSSYHLDGLEPATQYRVRLSVLGPAGEGPSAEVTARTESPRVPSIELRVVDTSIDSVTLAWTPVSRASSYILSWRPLRGPGQEVPGSPQTLPGISSSQRVTGLEPGVSYIFSLTPVLDGVRGPEASVTQTPVCPRGLADVVFLPHATQDNAHRAEATRRVLERLVLALGPLGPQAVQVGLLSYSHRPSPLFPLNGSHDLGIILQRIRDMPYMDPSGNNLGTAVVTAHRYMLAPDAPGRRQHVPGVMVLLVDEPLRGDIFSPIREAQASGLNVVMLGMAGADPEQLRRLAPGMDSVQTFFAVDDGPSLDQAVSGLATALCQASFTTQPRPEPCPVYCPKGQKGEPGEMGLRGQVGPPGDPGLPGRTGAPGPQGPPGSATAKGERGFPGADGRPGSPGRAGNPGTPGAPGLKGSPGLPGPRGDPGERGPRGPKGEPGAPGQVIGGEGPGLPGRKGDPGPSGPPGPRGPLGDPGPRGPPGLPGTAMKGDKGDRGERGPPGPGEGGIAPGEPGLPGLPGSPGPQGPVGPPGKKGEKGDSEDGAPGLPGQPGSPGEQGPRGPPGAIGPKGDRGFPGPLGEAGEKGERGPPGPAGSRGLPGVAGRPGAKGPEGPPGPTGRQGEKGEPGRPGDPAVVGPAVAGPKGEKGDVGPAGPRGATGVQGERGPPGLVLPGDPGPKGDPGDRGPIGLTGRAGPPGDSGPPGEKGDPGRPGPPGPVGPRGRDGEVGEKGDEGPPGDPGLPGKAGERGLRGAPGVRGPVGEKGDQGDPGEDGRNGSPGSSGPKGDRGEPGPPGPPGRLVDTGPGAREKGEPGDRGQEGPRGPKGDPGLPGAPGERGIEGFRGPPGPQGDPGVRGPAGEKGDRGPPGLDGRSGLDGKPGAAGPSGPNGAAGKAGDPGRDGLPGLRGEQGLPGPSGPPGLPGKPGEDGKPGLNGKNGEPGDPGEDGRKGEKGDSGASGREGRDGPKGERGAPGILGPQGPPGLPGPVGPPGQGFPGVPGGTGPKGDRGETGSKGEQGLPGERGLRGEPGSVPNVDRLLETAGIKASALREIVETWDESSGSFLPVPERRRGPKGDSGEQGPPGKEGPIGFPGERGLKGDRGDPGPQGPPGLALGERGPPGPSGLAGEPGKPGIPGLPGRAGGVGEAGRPGERGERGEKGERGEQGRDGPPGLPGTPGPPGPPGPKVSVDEPGPGLSGEQGPPGLKGAKGEPGSNGDQGPKGDRGVPGIKGDRGEPGPRGQDGNPGLPGERGMAGPEGKPGLQGPRGPPGPVGGHGDPGPPGAPGLAGPAGPQGPSGLKGEPGETGPPGRGLTGPTGAVGLPGPPGPSGLVGPQGSPGLPGQVGETGKPGAPGRDGASGKDGDRGSPGVPGSPGLPGPVGPKGEPGPTGAPGQAVVGLPGAKGEKGAPGGLAGDLVGEPGAKGDRGLPGPRGEKGEAGRAGEPGDPGEDGQKGAPGPKGFKGDPGVGVPGSPGPPGPPGVKGDLGLPGLPGAPGVVGFPGQTGPRGEMGQPGPSGERGLAGPPGREGIPGPLGPPGPPGSVGPPGASGLKGDKGDPGVGLPGPRGERGEPGIRGEDGRPGQEGPRGLTGPPGSRGERGEKGDVGSAGLKGDKGDSAVILGPPGPRGAKGDMGERGPRGLDGDKGPRGDNGDPGDKGSKGEPGDKGSAGLPGLRGLLGPQGQPGAAGIPGDPGSPGKDGVPGIRGEKGDVGFMGPRGLKGERGVKGACGLDGEKGDKGEAGPPGRPGLAGHKGEMGEPGVPGQSGAPGKEGLIGPKGDRGFDGQPGPKGDQGEKGERGTPGIGGFPGPSGNDGSAGPPGPPGSVGPRGPEGLQGQKGERGPPGERVVGAPGVPGAPGERGEQGRPGPAGPRGEKGEAALTEDDIRGFVRQEMSQHCACQGQFIASGSRPLPSYAADTAGSQLHAVPVLRVSHAEEEERVPPEDDEYSEYSEYSVEEYQDPEAPWDSDDPCSLPLDEGSCTAYTLRWYHRAVTGSTEACHPFVYGGCGGNANRFGTREACERRCPPRVVQSQGTGTAQD
" sig_peptide 2..49 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" mat_peptide 50..8833 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /product="collagen alpha-1(VII) chain" misc_feature 50..3760 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q02388.2); Region: Nonhelical region (NC1)" misc_feature 110..604 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Collagen: The extracellular matrix represents a complex alloy of variable members of diverse protein families defining structural integrity and various physiological functions. The most abundant family is the collagens with more than 20 different...; Region: vWA_collagen_alphaI-XII-like; cd01482" /db_xref="CDD:29255" misc_feature order(131..133,137..139,143..145,350..352,446..448) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="metal ion-dependent adhesion site (MIDAS); other site" /db_xref="CDD:29255" misc_feature order(137..145,149..151,350..352) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="integrin-collagen binding site; other site" /db_xref="CDD:29255" misc_feature 698..979 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:28945" misc_feature order(896..898,941..943) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Interdomain contacts; other site" /db_xref="CDD:28945" misc_feature order(944..949,953..958) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Cytokine receptor motif; other site" /db_xref="CDD:28945" misc_feature 998..1225 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:28945" misc_feature order(1160..1162,1205..1207) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Interdomain contacts; other site" /db_xref="CDD:28945" misc_feature order(1208..1213,1217..1222) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Cytokine receptor motif; other site" /db_xref="CDD:28945" misc_feature 1256..>1432 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:28945" misc_feature 1526..1762 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:28945" misc_feature order(1700..1702,1745..1747) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Interdomain contacts; other site" /db_xref="CDD:28945" misc_feature order(1748..1753,1757..1762) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Cytokine receptor motif; other site" /db_xref="CDD:28945" misc_feature 1793..2041 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:28945" misc_feature order(1793..1795,1970..1972,2015..2017) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Interdomain contacts; other site" /db_xref="CDD:28945" misc_feature order(2018..2023,2027..2032) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Cytokine receptor motif; other site" /db_xref="CDD:28945" misc_feature 2060..2308 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:28945" misc_feature order(2234..2236,2279..2281) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Interdomain contacts; other site" /db_xref="CDD:28945" misc_feature order(2282..2287,2291..2296) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Cytokine receptor motif; other site" /db_xref="CDD:28945" misc_feature 2330..2587 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:28945" misc_feature order(2507..2509,2552..2554) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Interdomain contacts; other site" /db_xref="CDD:28945" misc_feature order(2555..2560,2564..2569) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Cytokine receptor motif; other site" /db_xref="CDD:28945" misc_feature 2600..2857 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:28945" misc_feature order(2600..2602,2777..2779,2822..2824) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Interdomain contacts; other site" /db_xref="CDD:28945" misc_feature order(2825..2830,2831..2836) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Cytokine receptor motif; other site" /db_xref="CDD:28945" misc_feature 2873..3133 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:28945" misc_feature order(3059..3061,3104..3106) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Interdomain contacts; other site" /db_xref="CDD:28945" misc_feature order(3107..3112,3116..3121) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Cytokine receptor motif; other site" /db_xref="CDD:28945" misc_feature 3158..3613 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Von Willebrand factor type A (vWA) domain was originally found in the blood coagulation protein von Willebrand factor (vWF). Typically, the vWA domain is made up of approximately 200 amino acid residues folded into a classic a/b para-rossmann type of...; Region: vWFA_subfamily_ECM; cd01450" /db_xref="CDD:29223" misc_feature order(3158..3160,3164..3166,3224..3226,3479..3481, 3485..3487,3563..3565) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="integrin inhibitor binding pocket; other site" /db_xref="CDD:29223" misc_feature order(3179..3181,3185..3187,3191..3193,3395..3397, 3497..3499) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="metal ion-dependent adhesion site (MIDAS); other site" /db_xref="CDD:29223" misc_feature order(3185..3193,3194..3196,3395..3397) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="integrin-collagen binding site; other site" /db_xref="CDD:29223" misc_feature order(3275..3277,3320..3325,3356..3361) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="putative vWF-collagen binding site; other site" /db_xref="CDD:29223" misc_feature order(3302..3307,3311..3313,3407..3409,3416..3418, 3428..3433) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="glycoprotein Ib (GpIb) binding site [polypeptide binding]; other site" /db_xref="CDD:29223" misc_feature 3509..3517 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q02388.2); Region: Cell attachment site (Potential)" misc_feature 3761..8353 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q02388.2); Region: Triple-helical region" misc_feature 3761..4432 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q02388.2); Region: Interrupted collagenous region" misc_feature 4001..4009 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q02388.2); Region: Cell attachment site (Potential)" misc_feature 5156..5329 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Collagen triple helix repeat (20 copies); Region: Collagen; pfam01391" /db_xref="CDD:189968" misc_feature 6023..6031 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q02388.2); Region: Cell attachment site (Potential)" misc_feature 6323..6490 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Collagen triple helix repeat (20 copies); Region: Collagen; pfam01391" /db_xref="CDD:189968" misc_feature 6500..6502 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /experiment="experimental evidence, no additional details recorded" /note="4-hydroxyproline; propagated from UniProtKB/Swiss-Prot (Q02388.2); hydroxylation site" misc_feature 6527..6529 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /experiment="experimental evidence, no additional details recorded" /note="4-hydroxyproline; propagated from UniProtKB/Swiss-Prot (Q02388.2); hydroxylation site" misc_feature 6554..6556 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /experiment="experimental evidence, no additional details recorded" /note="4-hydroxyproline; propagated from UniProtKB/Swiss-Prot (Q02388.2); hydroxylation site" misc_feature 6563..6565 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /experiment="experimental evidence, no additional details recorded" /note="4-hydroxyproline; propagated from UniProtKB/Swiss-Prot (Q02388.2); hydroxylation site" misc_feature 7469..7705 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Collagen triple helix repeat (20 copies); Region: Collagen; pfam01391" /db_xref="CDD:189968" misc_feature 7658..7666 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q02388.2); Region: Cell attachment site (Potential)" misc_feature 7841..8020 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Collagen triple helix repeat (20 copies); Region: Collagen; pfam01391" /db_xref="CDD:189968" misc_feature 7874..7876 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /experiment="experimental evidence, no additional details recorded" /note="5-hydroxylysine, alternate; propagated from UniProtKB/Swiss-Prot (Q02388.2); hydroxylation site" misc_feature 7892..7894 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /experiment="experimental evidence, no additional details recorded" /note="5-hydroxylysine, alternate; propagated from UniProtKB/Swiss-Prot (Q02388.2); hydroxylation site" misc_feature 7949..8122 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="Collagen triple helix repeat (20 copies); Region: Collagen; pfam01391" /db_xref="CDD:189968" misc_feature 7991..7993 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /experiment="experimental evidence, no additional details recorded" /note="4-hydroxyproline; propagated from UniProtKB/Swiss-Prot (Q02388.2); hydroxylation site" misc_feature 8000..8002 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /experiment="experimental evidence, no additional details recorded" /note="4-hydroxyproline; propagated from UniProtKB/Swiss-Prot (Q02388.2); hydroxylation site" misc_feature 8018..8020 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /experiment="experimental evidence, no additional details recorded" /note="4-hydroxyproline; propagated from UniProtKB/Swiss-Prot (Q02388.2); hydroxylation site" misc_feature 8354..8833 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q02388.2); Region: Nonhelical region (NC2)" misc_feature 8462..8464 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /experiment="experimental evidence, no additional details recorded" /note="proteolytic cleavage site; modified site" /db_xref="HPRD:00209" misc_feature 8621..8791 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="BPTI/Kunitz family of serine protease inhibitors; Structure is a disulfide rich alpha+beta fold. BPTI (bovine pancreatic trypsin inhibitor) is an extensively studied model structure; Region: KU; cd00109" /db_xref="CDD:29009" misc_feature order(8651..8665,8669..8671) /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /note="trypsin interaction site; other site" /db_xref="CDD:29009" misc_feature 8657..8662 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="non-experimental evidence, no additional details recorded" /note="Reactive bond (By similarity); propagated from UniProtKB/Swiss-Prot (Q02388.2); other site" exon 87..267 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 268..427 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 428..521 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 522..683 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 684..847 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 848..977 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 978..1094 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 1095..1241 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 1242..1358 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 1359..1508 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 1509..1637 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 1638..1781 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" variation 1642 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /replace="g" /replace="t" /db_xref="dbSNP:2854410" exon 1782..1907 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" variation 1785 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /replace="c" /replace="t" /db_xref="dbSNP:2228561" exon 1908..2051 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 2052..2171 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 2172..2315 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 2316..2441 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 2442..2588 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 2589..2711 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" variation 2679 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /replace="a" /replace="c" /db_xref="dbSNP:2854389" exon 2712..2858 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" STS 2722..3093 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /standard_name="GDB:192955" /db_xref="UniSTS:155734" variation 2818 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /replace="a" /replace="g" /db_xref="dbSNP:1264194" exon 2859..2993 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 2994..3140 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 3141..3277 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" variation 3149 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /replace="c" /replace="t" /db_xref="dbSNP:2229818" exon 3278..3404 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" variation 3307 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /replace="c" /replace="t" /db_xref="dbSNP:2854390" variation 3360 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /replace="a" /replace="g" /db_xref="dbSNP:2228563" exon 3405..3551 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 3552..3724 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 3725..3760 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 3761..3787 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 3788..3832 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 3833..3895 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 3896..3976 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 3977..4012 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4013..4048 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4049..4120 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4121..4198 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4199..4225 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4226..4279 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4280..4342 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4343..4402 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4403..4438 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4439..4483 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4484..4519 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4520..4564 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4565..4600 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4601..4636 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" variation 4614 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /replace="a" /replace="g" /db_xref="dbSNP:2229824" exon 4637..4669 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4670..4723 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4724..4783 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4784..4819 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4820..4900 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4901..4936 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4937..4981 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 4982..5053 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 5054..5098 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" variation 5087 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /replace="c" /replace="t" /db_xref="dbSNP:2229820" exon 5099..5125 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 5126..5155 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 5156..5236 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 5237..5272 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 5273..5308 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 5309..5389 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 5390..5425 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 5426..5488 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 5489..5533 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" variation 5509 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /replace="c" /replace="g" /db_xref="dbSNP:2854404" exon 5534..5569 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 5570..5605 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 5606..5701 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 5702..5737 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 5738..5773 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 5774..5821 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 5822..5857 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 5858..5980 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" variation 5924 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /replace="a" /replace="g" /db_xref="dbSNP:2229821" exon 5981..6181 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 6182..6217 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" variation 6189 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /replace="a" /replace="g" /db_xref="dbSNP:2229825" exon 6218..6280 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 6281..6349 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 6350..6394 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 6395..6457 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 6458..6502 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 6503..6538 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 6539..6574 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 6575..6619 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 6620..6652 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 6653..6715 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 6716..6751 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 6752..6832 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 6833..6901 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 6902..6937 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 6938..6979 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 6980..7024 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 7025..7069 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" variation 7052 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /replace="a" /replace="g" /db_xref="dbSNP:1800013" exon 7070..7105 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 7106..7165 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 7166..7273 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 7274..7345 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" variation 7287 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /replace="c" /replace="t" /db_xref="dbSNP:2229822" exon 7346..7381 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 7382..7441 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 7442..7486 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 7487..7522 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 7523..7558 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 7559..7615 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 7616..7687 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 7688..7759 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 7760..7795 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 7796..7876 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 7877..7930 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 7931..7984 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 7985..8047 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 8048..8110 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 8111..8227 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 8228..8305 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 8306..8359 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 8360..8408 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 8409..8441 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 8442..8528 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 8529..8621 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" exon 8622..8819 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" STS 8721..9133 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /standard_name="GDB:384986" /db_xref="UniSTS:157129" exon 8820..9169 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /inference="alignment:Splign:1.39.8" STS 8916..9162 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /standard_name="RH80100" /db_xref="UniSTS:83603" variation 8947 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /replace="a" /replace="t" /db_xref="dbSNP:1042469" variation 9052 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" /replace="c" /replace="g" /db_xref="dbSNP:1803298" polyA_signal 9146..9151 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" polyA_site 9169 /gene="COL7A1" /gene_synonym="EBD1; EBDCT; EBR1" ORIGIN
gatgacgctgcggcttctggtggccgcgctctgcgccgggatcctggcagaggcgccccgagtgcgagcccagcacagggagagagtgacctgcacgcgcctttacgccgctgacattgtgttcttactggatggctcctcatccattggccgcagcaatttccgcgaggtccgcagctttctcgaagggctggtgctgcctttctctggagcagccagtgcacagggtgtgcgctttgccacagtgcagtacagcgatgacccacggacagagttcggcctggatgcacttggctctgggggtgatgtgatccgcgccatccgtgagcttagctacaaggggggcaacactcgcacaggggctgcaattctccatgtggctgaccatgtcttcctgccccagctggcccgacctggtgtccccaaggtctgcatcctgatcacagacgggaagtcccaggacctggtggacacagctgcccaaaggctgaaggggcagggggtcaagctatttgctgtggggatcaagaatgctgaccctgaggagctgaagcgagttgcctcacagcccaccagtgacttcttcttcttcgtcaatgacttcagcatcttgaggacactactgcccctcgtttcccggagagtgtgcacgactgctggtggcgtgcctgtgacccgacctccggatgactcgacctctgctccacgagacctggtgctgtctgagccaagcagccaatccttgagagtacagtggacagcggccagtggccctgtgactggctacaaggtccagtacactcctctgacggggctgggacagccactgccgagtgagcggcaggaggtgaacgtcccagctggtgagaccagtgtgcggctgcggggtctccggccactgaccgagtaccaagtgactgtgattgccctctacgccaacagcatcggggaggctgtgagcgggacagctcggaccactgccctagaagggccggaactgaccatccagaataccacagcccacagcctcctggtggcctggcggagtgtgccaggtgccactggctaccgtgtgacatggcgggtcctcagtggtgggcccacacagcagcaggagctgggccctgggcagggttcagtgttgctgcgtgacttggagcctggcacggactatgaggtgaccgtgagcaccctatttggccgcagtgtggggcccgccacttccctgatggctcgcactgacgcttctgttgagcagaccctgcgcccggtcatcctgggccccacatccatcctcctttcctggaacttggtgcctgaggcccgtggctaccggttggaatggcggcgtgagactggcttggagccaccgcagaaggtggtactgccctctgatgtgacccgctaccagttggatgggctgcagccgggcactgagtaccgcctcacactctacactctgctggagggccacgaggtggccacccctgcaaccgtggttcccactggaccagagctgcctgtgagccctgtaacagacctgcaagccaccgagctgcccgggcagcgggtgcgagtgtcctggagcccagtccctggtgccacccagtaccgcatcattgtgcgcagcacccagggggttgagcggaccctggtgcttcctgggagtcagacagcattcgacttggatgacgttcaggctgggcttagctacactgtgcgggtgtctgctcgagtgggtccccgtgagggcagtgccagtgtcctcactgtccgccgggagccggaaactccacttgctgttccagggctgcgggttgtggtgtcagatgcaacgcgagtgagggtggcctggggacccgtccctggagccagtggatttcggattagctggagcacaggcagtggtccggagtccagccagacactgcccccagactctactgccacagacatcacagggctgcagcctggaaccacctaccaggtggctgtgtcggtactgcgaggcagagaggagggccctgctgcagtcatcgtggctcgaacggacccactgggcccagtgaggacggtccatgtgactcaggccagcagctcatctgtcaccattacctggaccagggttcctggcgccacaggatacagggtttcctggcactcagcccacggcccagagaaatcccagttggtttctggggaggccacggtggctgagctggatggactggagccagatactgagtatacggtgcatgtgagggcccatgtggctggcgtggatgggccccctgcctctgtggttgtgaggactgcccctgagcctgtgggtcgtgtgtcgaggctgcagatcctcaatgcttccagcgacgttctacggatcacctgggtaggggtcactggagccacagcttacagactggcctggggccggagtgaaggcggccccatgaggcaccagatactcccaggaaacacagactctgcagagatccggggtctcgaaggtggagtcagctactcagtgcgagtgactgcacttgtcggggaccgcgagggcacacctgtctccattgttgtcactacgccgcctgaggctccgccagccctggggacgcttcacgtggtgcagcgcggggagcactcgctgaggctgcgctgggagccggtgcccagagcgcagggcttccttctgcactggcaacctgagggtggccaggaacagtcccgggtcctggggcccgagctcagcagctatcacctggacgggctggagccagcgacacagtaccgcgtgaggctgagtgtcctagggccagctggagaagggccctctgcagaggtgactgcgcgcactgagtcacctcgtgttccaagcattgaactacgtgtggtggacacctcgatcgactcggtgactttggcctggactccagtgtccagggcatccagctacatcctatcctggcggccactcagaggccctggccaggaagtgcctgggtccccgcagacacttccagggatctcaagctcccagcgggtgacagggctagagcctggcgtctcttacatcttctccctgacgcctgtcctggatggtgtgcggggtcctgaggcatctgtcacacagacgccagtgtgcccccgtggcctggcggatgtggtgttcctaccacatgccactcaagacaatgctcaccgtgcggaggctacgaggagggtcctggagcgtctggtgttggcacttgggcctcttgggccacaggcagttcaggttggcctgctgtcttacagtcatcggccctccccactgttcccactgaatggctcccatgaccttggcattatcttgcaaaggatccgtgacatgccctacatggacccaagtgggaacaacctgggcacagccgtggtcacagctcacagatacatgttggcaccagatgctcctgggcgccgccagcacgtaccaggggtgatggttctgctagtggatgaacccttgagaggtgacatattcagccccatccgtgaggcccaggcttctgggcttaatgtggtgatgttgggaatggctggagcggacccagagcagctgcgtcgcttggcgccgggtatggactctgtccagaccttcttcgccgtggatgatgggccaagcctggaccaggcagtcagtggtctggccacagccctgtgtcaggcatccttcactactcagccccggccagagccctgcccagtgtattgtccaaagggccagaagggggaacctggagagatgggcctgagaggacaagttgggcctcctggcgaccctggcctcccgggcaggaccggtgctcccggcccccaggggccccctggaagtgccactgccaagggcgagaggggcttccctggagcagatgggcgtccaggcagccctggccgcgccgggaatcctgggacccctggagcccctggcctaaagggctctccagggttgcctggccctcgtggggacccgggagagcgaggacctcgaggcccaaagggggagccgggggctcccggacaagtcatcggaggtgaaggacctgggcttcctgggcggaaaggggaccctggaccatcgggcccccctggacctcgtggaccactgggggacccaggaccccgtggccccccagggcttcctggaacagccatgaagggtgacaaaggcgatcgtggggagcggggtccccctggaccaggtgaaggtggcattgctcctggggagcctgggctgccgggtcttcccggaagccctggaccccaaggccccgttggcccccctggaaagaaaggagaaaaaggtgactctgaggatggagctccaggcctcccaggacaacctgggtctccgggtgagcagggcccacggggacctcctggagctattggccccaaaggtgaccggggctttccagggcccctgggtgaggctggagagaagggcgaacgtggacccccaggcccagcgggatcccgggggctgccaggggttgctggacgtcctggagccaagggtcctgaagggccaccaggacccactggccgccaaggagagaagggggagcctggtcgccctggggaccctgcagtggtgggacctgctgttgctggacccaaaggagaaaagggagatgtggggcccgctgggcccagaggagctaccggagtccaaggggaacggggcccacccggcttggttcttcctggagaccctggccccaagggagaccctggagaccggggtcccattggccttactggcagagcaggacccccaggtgactcagggcctcctggagagaagggagaccctgggcggcctggccccccaggacctgttggcccccgaggacgagatggtgaagttggagagaaaggtgacgagggtcctccgggtgacccgggtttgcctggaaaagcaggcgagcgtggccttcggggggcacctggagttcgggggcctgtgggtgaaaagggagaccagggagatcctggagaggatggacgaaatggcagccctggatcatctggacccaagggtgaccgtggggagccgggtcccccaggacccccgggacggctggtagacacaggacctggagccagagagaagggagagcctggggaccgcggacaagagggtcctcgagggcccaagggtgatcctggcctccctggagcccctggggaaaggggcattgaagggtttcggggacccccaggcccacagggggacccaggtgtccgaggcccagcaggagaaaagggtgaccggggtccccctgggctggatggccggagcggactggatgggaaaccaggagccgctgggccctctgggccgaatggtgctgcaggcaaagctggggacccagggagagacgggcttccaggcctccgtggagaacagggcctccctggcccctctggtccccctggattaccgggaaagccaggcgaggatggcaaacctggcctgaatggaaaaaacggagaacctggggaccctggagaagacgggaggaagggagagaaaggagattcaggcgcctctgggagagaaggtcgtgatggccccaagggtgagcgtggagctcctggtatccttggaccccaggggcctccaggcctcccagggccagtgggccctcctggccagggttttcctggtgtcccaggaggcacgggccccaagggtgaccgtggggagactggatccaaaggggagcagggcctccctggagagcgtggcctgcgaggagagcctggaagtgtgccgaatgtggatcggttgctggaaactgctggcatcaaggcatctgccctgcgggagatcgtggagacctgggatgagagctctggtagcttcctgcctgtgcccgaacggcgtcgaggccccaagggggactcaggcgaacagggccccccaggcaaggagggccccatcggctttcctggagaacgcgggctgaagggcgaccgtggagaccctggccctcaggggccacctggtctggcccttggggagaggggcccccccgggccttccggccttgccggggagcctggaaagcctggtattcccgggctcccaggcagggctgggggtgtgggagaggcaggaaggccaggagagaggggagaacggggagagaaaggagaacgtggagaacagggcagagatggccctcctggactccctggaacccctgggccccccggaccccctggccccaaggtgtctgtggatgagccaggtcctggactctctggagaacagggaccccctggactcaagggtgctaagggggagccgggcagcaatggtgaccaaggtcccaaaggagacaggggtgtgccaggcatcaaaggagaccggggagagcctggaccgaggggtcaggacggcaacccgggtctaccaggagagcgtggtatggctgggcctgaagggaagccgggtctgcagggtccaagaggcccccctggcccagtgggtggtcatggagaccctggaccacctggtgccccgggtcttgctggccctgcaggaccccaaggaccttctggcctgaagggggagcctggagagacaggacctccaggacggggcctgactggacctactggagctgtgggacttcctggaccccccggcccttcaggccttgtgggtccacaggggtctccaggtttgcctggacaagtgggggagacagggaagccgggagccccaggtcgagatggtgccagtggaaaagatggagacagagggagccctggtgtgccagggtcaccaggtctgcctggccctgtcggacctaaaggagaacctggccccacgggggcccctggacaggctgtggtcgggctccctggagcaaagggagagaagggagcccctggaggccttgctggagacctggtgggtgagccgggagccaaaggtgaccgaggactgccagggccgcgaggcgagaagggtgaagctggccgtgcaggggagcccggagaccctggggaagatggtcagaaaggggctccaggacccaaaggtttcaagggtgacccaggagtcggggtcccgggctcccctgggcctcctggccctccaggtgtgaagggagatctgggcctccctggcctgcccggtgctcctggtgttgttgggttcccgggtcagacaggccctcgaggagagatgggtcagccaggccctagtggagagcggggtctggcaggccccccagggagagaaggaatcccaggacccctggggccacctggaccaccggggtcagtgggaccacctggggcctctggactcaaaggagacaagggagaccctggagtagggctgcctgggccccgaggcgagcgtggggagccaggcatccggggtgaagatggccgccccggccaggagggaccccgaggactcacggggccccctggcagcaggggagagcgtggggagaagggtgatgttgggagtgcaggactaaagggtgacaagggagactcagctgtgatcctggggcctccaggcccacggggtgccaagggggacatgggtgaacgagggcctcggggcttggatggtgacaaaggacctcggggagacaatggggaccctggtgacaagggcagcaagggagagcctggtgacaagggctcagccgggttgccaggactgcgtggactcctgggaccccagggtcaacctggtgcagcagggatccctggtgacccgggatccccaggaaaggatggagtgcctggtatccgaggagaaaaaggagatgttggcttcatgggtccccggggcctcaagggtgaacggggagtgaagggagcctgtggccttgatggagagaagggagacaagggagaagctggtcccccaggccgccccgggctggcaggacacaaaggagagatgggggagcctggtgtgccgggccagtcgggggcccctggcaaggagggcctgatcggtcccaagggtgaccgaggctttgacgggcagccaggccccaagggtgaccagggcgagaaaggggagcggggaaccccaggaattgggggcttcccaggccccagtggaaatgatggctctgctggtcccccagggccacctggcagtgttggtcccagaggccccgaaggacttcagggccagaagggtgagcgaggtccccccggagagagagtggtgggggctcctggggtccctggagctcctggcgagagaggggagcaggggcggccagggcctgccggtcctcgaggcgagaagggagaagctgcactgacggaggatgacatccggggctttgtgcgccaagagatgagtcagcactgtgcctgccagggccagttcatcgcatctggatcacgacccctccctagttatgctgcagacactgccggctcccagctccatgctgtgcctgtgctccgcgtctctcatgcagaggaggaagagcgggtaccccctgaggatgatgagtactctgaatactccgagtattctgtggaggagtaccaggaccctgaagctccttgggatagtgatgacccctgttccctgccactggatgagggctcctgcactgcctacaccctgcgctggtaccatcgggctgtgacaggcagcacagaggcctgtcacccttttgtctatggtggctgtggagggaatgccaaccgttttgggacccgtgaggcctgcgagcgccgctgcccaccccgggtggtccagagccaggggacaggtactgcccaggactgaggcccagataatgagctgagattcagcatcccctggaggagtcggggtctcagcagaaccccactgtccctccccttggtgctagaggcttgtgtgcacgtgagcgtgcgtgtgcacgtccgttatttcagtgacttggtcccgtgggtctagccttcccccctgtggacaaacccccattgtggctcctgccaccctggcagatgactcactgtgggggggtggctgtgggcagtgagcggatgtgactggcgtctgacccgccccttgacccaagcctgtgatgacatggtgctgattctggggggcattaaagctgctgttttaaaaggc
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:1294 -> Molecular function: GO:0004867 [serine-type endopeptidase inhibitor activity] evidence: IEA GeneID:1294 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:1294 -> Biological process: GO:0007155 [cell adhesion] evidence: IEA GeneID:1294 -> Biological process: GO:0008544 [epidermis development] evidence: TAS GeneID:1294 -> Biological process: GO:0022617 [extracellular matrix disassembly] evidence: TAS GeneID:1294 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS GeneID:1294 -> Biological process: GO:0030574 [collagen catabolic process] evidence: TAS GeneID:1294 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS GeneID:1294 -> Cellular component: GO:0005590 [collagen type VII] evidence: TAS GeneID:1294 -> Cellular component: GO:0005604 [basement membrane] evidence: IEA GeneID:1294 -> Cellular component: GO:0005788 [endoplasmic reticulum lumen] evidence: TAS GeneID:1294 -> Cellular component: GO:0031012 [extracellular matrix] evidence: ISS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.