Home |
Help |
Advanced search
2024-04-20 21:13:26, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_000094 9169 bp mRNA linear PRI 26-MAY-2013
DEFINITION Homo sapiens collagen, type VII, alpha 1 (COL7A1), mRNA.
ACCESSION NM_000094
VERSION NM_000094.3 GI:157389010
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 9169)
AUTHORS Rodriguez,F.A., Gana,M.J., Yubero,M.J., Zillmann,G., Kramer,S.M.,
Catalan,J., Rubio-Astudillo,J., Gonzalez,S., Liu,L., Ozoemena,L.,
Mellerio,J.E., McGrath,J.A., Palisson,F. and Conget,P.
TITLE Novel and recurrent COL7A1 mutations in Chilean patients with
dystrophic epidermolysis bullosa
JOURNAL J. Dermatol. Sci. 65 (2), 149-152 (2012)
PUBMED 22209565
REMARK GeneRIF: Letter: report novel and recurrent COL7A1 mutations in
Chilean patients with dystrophic epidermolysis bullosa.
Erratum:[J Dermatol Sci. 2012 Apr;66(1):85. Mellerio, Jemima M
[corrected to Mellerio, Jemima E]]
REFERENCE 2 (bases 1 to 9169)
AUTHORS Wertheim-Tysarowska,K., Sobczynska-Tomaszewska,A., Kowalewski,C.,
Kutkowska-Kazmierczak,A., Wozniak,K., Niepokoj,K., Klausegger,A.,
Sypniewska-Jutkiewicz,J., Stepien,A. and Bal,J.
TITLE Novel and recurrent COL7A1 mutation in a Polish population
JOURNAL Eur J Dermatol 22 (1), 23-28 (2012)
PUBMED 22266148
REMARK GeneRIF: We present the first COL7A1 mutation analysis in Polish
dystrophic epidermolysis bullosa patients.
REFERENCE 3 (bases 1 to 9169)
AUTHORS Jiang,W., Sun,T.T., Lei,P.C. and Zhu,X.J.
TITLE Genotype-phenotype correlation in Chinese patients with dystrophic
epidermolysis bullosa pruriginosa
JOURNAL Acta Derm. Venereol. 92 (1), 50-53 (2012)
PUBMED 21879237
REMARK GeneRIF: we have identified three pathogenic COL7A1 mutations
(G1773R, splicing site mutation of c.6900+1G>C, and G2701W) in 3
dystrophic epidermolysis bullosa pruriginosa families.
REFERENCE 4 (bases 1 to 9169)
AUTHORS Lin,Y., Chen,X.J., Liu,W., Gong,B., Xie,J., Xiong,J.H., Cheng,J.,
Duan,X.L., Lin,Z.C., Huang,L.L., Wan,H.Y., Liu,X.Q., Song,L.H. and
Yang,Z.L.
TITLE Two novel mutations on exon 8 and intron 65 of COL7A1 gene in two
Chinese brothers result in recessive dystrophic epidermolysis
bullosa
JOURNAL PLoS ONE 7 (11), E50579 (2012)
PUBMED 23226319
REMARK GeneRIF: novel disease-causing mutations in the COL7A1 gene
REFERENCE 5 (bases 1 to 9169)
AUTHORS Frew,J., Lim,S.W., Klausseger,A., Chow,C.W., Tran,K., Su,J.,
Orchard,D., Varigos,G., Sawamura,D., Nishie,W., Shimizu,H. and
Murrell,D.F.
TITLE Autosomal dominant bullous dermolysis of the newborn associated
with a heterozygous missense mutation p.G1673R in type VII collagen
JOURNAL Australas. J. Dermatol. 52 (4), E1-E4 (2011)
PUBMED 22070715
REMARK GeneRIF: The infant's genomic DNA from blood was found to be
heterozygous for a missense mutation on exon 54 of COL7A1 (c.5017G
> A, p.G1673R) not previously described in bullous dermolysis of
the newborn.
REFERENCE 6 (bases 1 to 9169)
AUTHORS Gammon,W.R., Abernethy,M.L., Padilla,K.M., Prisayanh,P.S.,
Cook,M.E., Wright,J., Briggaman,R.A. and Hunt,S.W. III.
TITLE Noncollagenous (NC1) domain of collagen VII resembles multidomain
adhesion proteins involved in tissue-specific organization of
extracellular matrix
JOURNAL J. Invest. Dermatol. 99 (6), 691-696 (1992)
PUBMED 1469284
REFERENCE 7 (bases 1 to 9169)
AUTHORS Christiano,A.M., Rosenbaum,L.M., Chung-Honet,L.C., Parente,M.G.,
Woodley,D.T., Pan,T.C., Zhang,R.Z., Chu,M.L., Burgeson,R.E. and
Uitto,J.
TITLE The large non-collagenous domain (NC-1) of type VII collagen is
amino-terminal and chimeric. Homology to cartilage matrix protein,
the type III domains of fibronectin and the A domains of von
Willebrand factor
JOURNAL Hum. Mol. Genet. 1 (7), 475-481 (1992)
PUBMED 1307247
REFERENCE 8 (bases 1 to 9169)
AUTHORS Tanaka,T., Takahashi,K., Furukawa,F. and Imamura,S.
TITLE Molecular cloning and characterization of type VII collagen cDNA
JOURNAL Biochem. Biophys. Res. Commun. 183 (3), 958-963 (1992)
PUBMED 1567409
REFERENCE 9 (bases 1 to 9169)
AUTHORS Parente,M.G., Chung,L.C., Ryynanen,J., Woodley,D.T., Wynn,K.C.,
Bauer,E.A., Mattei,M.G., Chu,M.L. and Uitto,J.
TITLE Human type VII collagen: cDNA cloning and chromosomal mapping of
the gene
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 88 (16), 6931-6935 (1991)
PUBMED 1871109
REFERENCE 10 (bases 1 to 9169)
AUTHORS Seltzer,J.L., Eisen,A.Z., Bauer,E.A., Morris,N.P., Glanville,R.W.
and Burgeson,R.E.
TITLE Cleavage of type VII collagen by interstitial collagenase and type
IV collagenase (gelatinase) derived from human skin
JOURNAL J. Biol. Chem. 264 (7), 3822-3826 (1989)
PUBMED 2537292
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from L02870.1, BQ300155.1, S51236.1,
M65158.1 and AB209645.1.
This sequence is a reference standard in the RefSeqGene project.
On Sep 20, 2007 this sequence version replaced gi:17738300.
Summary: This gene encodes the alpha chain of type VII collagen.
The type VII collagen fibril, composed of three identical alpha
collagen chains, is restricted to the basement zone beneath
stratified squamous epithelia. It functions as an anchoring fibril
between the external epithelia and the underlying stroma. Mutations
in this gene are associated with all forms of dystrophic
epidermolysis bullosa. In the absence of mutations, however, an
acquired form of this disease can result from an autoimmune
response made to type VII collagen. [provided by RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: L02870.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: full length.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-570 L02870.1 113-682
571-577 BQ300155.1 95-101 c
578-1641 L02870.1 690-1753
1642-1642 S51236.1 537-537
1643-2817 L02870.1 1755-2929
2818-4318 M65158.1 375-1875
4319-5509 AB209645.1 235-1425
5510-8946 L02870.1 5622-9058
8947-9169 AB209645.1 5459-5681
FEATURES Location/Qualifiers
source 1..9169
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="3"
/map="3p21.1"
gene 1..9169
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="collagen, type VII, alpha 1"
/db_xref="GeneID:1294"
/db_xref="HGNC:2214"
/db_xref="HPRD:00358"
/db_xref="MIM:120120"
exon 1..86
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
CDS 2..8836
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="LC collagen; collagen VII, alpha-1 polypeptide;
collagen alpha-1(VII) chain; long-chain collagen"
/codon_start=1
/product="collagen alpha-1(VII) chain precursor"
/protein_id="NP_000085.1"
/db_xref="GI:4502961"
/db_xref="CCDS:CCDS2773.1"
/db_xref="GeneID:1294"
/db_xref="HGNC:2214"
/db_xref="HPRD:00358"
/db_xref="MIM:120120"
/translation="
MTLRLLVAALCAGILAEAPRVRAQHRERVTCTRLYAADIVFLLDGSSSIGRSNFREVRSFLEGLVLPFSGAASAQGVRFATVQYSDDPRTEFGLDALGSGGDVIRAIRELSYKGGNTRTGAAILHVADHVFLPQLARPGVPKVCILITDGKSQDLVDTAAQRLKGQGVKLFAVGIKNADPEELKRVASQPTSDFFFFVNDFSILRTLLPLVSRRVCTTAGGVPVTRPPDDSTSAPRDLVLSEPSSQSLRVQWTAASGPVTGYKVQYTPLTGLGQPLPSERQEVNVPAGETSVRLRGLRPLTEYQVTVIALYANSIGEAVSGTARTTALEGPELTIQNTTAHSLLVAWRSVPGATGYRVTWRVLSGGPTQQQELGPGQGSVLLRDLEPGTDYEVTVSTLFGRSVGPATSLMARTDASVEQTLRPVILGPTSILLSWNLVPEARGYRLEWRRETGLEPPQKVVLPSDVTRYQLDGLQPGTEYRLTLYTLLEGHEVATPATVVPTGPELPVSPVTDLQATELPGQRVRVSWSPVPGATQYRIIVRSTQGVERTLVLPGSQTAFDLDDVQAGLSYTVRVSARVGPREGSASVLTVRREPETPLAVPGLRVVVSDATRVRVAWGPVPGASGFRISWSTGSGPESSQTLPPDSTATDITGLQPGTTYQVAVSVLRGREEGPAAVIVARTDPLGPVRTVHVTQASSSSVTITWTRVPGATGYRVSWHSAHGPEKSQLVSGEATVAELDGLEPDTEYTVHVRAHVAGVDGPPASVVVRTAPEPVGRVSRLQILNASSDVLRITWVGVTGATAYRLAWGRSEGGPMRHQILPGNTDSAEIRGLEGGVSYSVRVTALVGDREGTPVSIVVTTPPEAPPALGTLHVVQRGEHSLRLRWEPVPRAQGFLLHWQPEGGQEQSRVLGPELSSYHLDGLEPATQYRVRLSVLGPAGEGPSAEVTARTESPRVPSIELRVVDTSIDSVTLAWTPVSRASSYILSWRPLRGPGQEVPGSPQTLPGISSSQRVTGLEPGVSYIFSLTPVLDGVRGPEASVTQTPVCPRGLADVVFLPHATQDNAHRAEATRRVLERLVLALGPLGPQAVQVGLLSYSHRPSPLFPLNGSHDLGIILQRIRDMPYMDPSGNNLGTAVVTAHRYMLAPDAPGRRQHVPGVMVLLVDEPLRGDIFSPIREAQASGLNVVMLGMAGADPEQLRRLAPGMDSVQTFFAVDDGPSLDQAVSGLATALCQASFTTQPRPEPCPVYCPKGQKGEPGEMGLRGQVGPPGDPGLPGRTGAPGPQGPPGSATAKGERGFPGADGRPGSPGRAGNPGTPGAPGLKGSPGLPGPRGDPGERGPRGPKGEPGAPGQVIGGEGPGLPGRKGDPGPSGPPGPRGPLGDPGPRGPPGLPGTAMKGDKGDRGERGPPGPGEGGIAPGEPGLPGLPGSPGPQGPVGPPGKKGEKGDSEDGAPGLPGQPGSPGEQGPRGPPGAIGPKGDRGFPGPLGEAGEKGERGPPGPAGSRGLPGVAGRPGAKGPEGPPGPTGRQGEKGEPGRPGDPAVVGPAVAGPKGEKGDVGPAGPRGATGVQGERGPPGLVLPGDPGPKGDPGDRGPIGLTGRAGPPGDSGPPGEKGDPGRPGPPGPVGPRGRDGEVGEKGDEGPPGDPGLPGKAGERGLRGAPGVRGPVGEKGDQGDPGEDGRNGSPGSSGPKGDRGEPGPPGPPGRLVDTGPGAREKGEPGDRGQEGPRGPKGDPGLPGAPGERGIEGFRGPPGPQGDPGVRGPAGEKGDRGPPGLDGRSGLDGKPGAAGPSGPNGAAGKAGDPGRDGLPGLRGEQGLPGPSGPPGLPGKPGEDGKPGLNGKNGEPGDPGEDGRKGEKGDSGASGREGRDGPKGERGAPGILGPQGPPGLPGPVGPPGQGFPGVPGGTGPKGDRGETGSKGEQGLPGERGLRGEPGSVPNVDRLLETAGIKASALREIVETWDESSGSFLPVPERRRGPKGDSGEQGPPGKEGPIGFPGERGLKGDRGDPGPQGPPGLALGERGPPGPSGLAGEPGKPGIPGLPGRAGGVGEAGRPGERGERGEKGERGEQGRDGPPGLPGTPGPPGPPGPKVSVDEPGPGLSGEQGPPGLKGAKGEPGSNGDQGPKGDRGVPGIKGDRGEPGPRGQDGNPGLPGERGMAGPEGKPGLQGPRGPPGPVGGHGDPGPPGAPGLAGPAGPQGPSGLKGEPGETGPPGRGLTGPTGAVGLPGPPGPSGLVGPQGSPGLPGQVGETGKPGAPGRDGASGKDGDRGSPGVPGSPGLPGPVGPKGEPGPTGAPGQAVVGLPGAKGEKGAPGGLAGDLVGEPGAKGDRGLPGPRGEKGEAGRAGEPGDPGEDGQKGAPGPKGFKGDPGVGVPGSPGPPGPPGVKGDLGLPGLPGAPGVVGFPGQTGPRGEMGQPGPSGERGLAGPPGREGIPGPLGPPGPPGSVGPPGASGLKGDKGDPGVGLPGPRGERGEPGIRGEDGRPGQEGPRGLTGPPGSRGERGEKGDVGSAGLKGDKGDSAVILGPPGPRGAKGDMGERGPRGLDGDKGPRGDNGDPGDKGSKGEPGDKGSAGLPGLRGLLGPQGQPGAAGIPGDPGSPGKDGVPGIRGEKGDVGFMGPRGLKGERGVKGACGLDGEKGDKGEAGPPGRPGLAGHKGEMGEPGVPGQSGAPGKEGLIGPKGDRGFDGQPGPKGDQGEKGERGTPGIGGFPGPSGNDGSAGPPGPPGSVGPRGPEGLQGQKGERGPPGERVVGAPGVPGAPGERGEQGRPGPAGPRGEKGEAALTEDDIRGFVRQEMSQHCACQGQFIASGSRPLPSYAADTAGSQLHAVPVLRVSHAEEEERVPPEDDEYSEYSEYSVEEYQDPEAPWDSDDPCSLPLDEGSCTAYTLRWYHRAVTGSTEACHPFVYGGCGGNANRFGTREACERRCPPRVVQSQGTGTAQD
"
sig_peptide 2..49
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
mat_peptide 50..8833
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/product="collagen alpha-1(VII) chain"
misc_feature 50..3760
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q02388.2);
Region: Nonhelical region (NC1)"
misc_feature 110..604
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Collagen: The extracellular matrix represents a
complex alloy of variable members of diverse protein
families defining structural integrity and various
physiological functions. The most abundant family is the
collagens with more than 20 different...; Region:
vWA_collagen_alphaI-XII-like; cd01482"
/db_xref="CDD:29255"
misc_feature order(131..133,137..139,143..145,350..352,446..448)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="metal ion-dependent adhesion site (MIDAS); other
site"
/db_xref="CDD:29255"
misc_feature order(137..145,149..151,350..352)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="integrin-collagen binding site; other site"
/db_xref="CDD:29255"
misc_feature 698..979
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Fibronectin type 3 domain; One of three types of
internal repeats found in the plasma protein fibronectin.
Its tenth fibronectin type III repeat contains an RGD cell
recognition sequence in a flexible loop between 2 strands.
Approximately 2% of all...; Region: FN3; cd00063"
/db_xref="CDD:28945"
misc_feature order(896..898,941..943)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Interdomain contacts; other site"
/db_xref="CDD:28945"
misc_feature order(944..949,953..958)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Cytokine receptor motif; other site"
/db_xref="CDD:28945"
misc_feature 998..1225
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Fibronectin type 3 domain; One of three types of
internal repeats found in the plasma protein fibronectin.
Its tenth fibronectin type III repeat contains an RGD cell
recognition sequence in a flexible loop between 2 strands.
Approximately 2% of all...; Region: FN3; cd00063"
/db_xref="CDD:28945"
misc_feature order(1160..1162,1205..1207)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Interdomain contacts; other site"
/db_xref="CDD:28945"
misc_feature order(1208..1213,1217..1222)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Cytokine receptor motif; other site"
/db_xref="CDD:28945"
misc_feature 1256..>1432
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Fibronectin type 3 domain; One of three types of
internal repeats found in the plasma protein fibronectin.
Its tenth fibronectin type III repeat contains an RGD cell
recognition sequence in a flexible loop between 2 strands.
Approximately 2% of all...; Region: FN3; cd00063"
/db_xref="CDD:28945"
misc_feature 1526..1762
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Fibronectin type 3 domain; One of three types of
internal repeats found in the plasma protein fibronectin.
Its tenth fibronectin type III repeat contains an RGD cell
recognition sequence in a flexible loop between 2 strands.
Approximately 2% of all...; Region: FN3; cd00063"
/db_xref="CDD:28945"
misc_feature order(1700..1702,1745..1747)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Interdomain contacts; other site"
/db_xref="CDD:28945"
misc_feature order(1748..1753,1757..1762)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Cytokine receptor motif; other site"
/db_xref="CDD:28945"
misc_feature 1793..2041
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Fibronectin type 3 domain; One of three types of
internal repeats found in the plasma protein fibronectin.
Its tenth fibronectin type III repeat contains an RGD cell
recognition sequence in a flexible loop between 2 strands.
Approximately 2% of all...; Region: FN3; cd00063"
/db_xref="CDD:28945"
misc_feature order(1793..1795,1970..1972,2015..2017)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Interdomain contacts; other site"
/db_xref="CDD:28945"
misc_feature order(2018..2023,2027..2032)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Cytokine receptor motif; other site"
/db_xref="CDD:28945"
misc_feature 2060..2308
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Fibronectin type 3 domain; One of three types of
internal repeats found in the plasma protein fibronectin.
Its tenth fibronectin type III repeat contains an RGD cell
recognition sequence in a flexible loop between 2 strands.
Approximately 2% of all...; Region: FN3; cd00063"
/db_xref="CDD:28945"
misc_feature order(2234..2236,2279..2281)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Interdomain contacts; other site"
/db_xref="CDD:28945"
misc_feature order(2282..2287,2291..2296)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Cytokine receptor motif; other site"
/db_xref="CDD:28945"
misc_feature 2330..2587
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Fibronectin type 3 domain; One of three types of
internal repeats found in the plasma protein fibronectin.
Its tenth fibronectin type III repeat contains an RGD cell
recognition sequence in a flexible loop between 2 strands.
Approximately 2% of all...; Region: FN3; cd00063"
/db_xref="CDD:28945"
misc_feature order(2507..2509,2552..2554)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Interdomain contacts; other site"
/db_xref="CDD:28945"
misc_feature order(2555..2560,2564..2569)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Cytokine receptor motif; other site"
/db_xref="CDD:28945"
misc_feature 2600..2857
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Fibronectin type 3 domain; One of three types of
internal repeats found in the plasma protein fibronectin.
Its tenth fibronectin type III repeat contains an RGD cell
recognition sequence in a flexible loop between 2 strands.
Approximately 2% of all...; Region: FN3; cd00063"
/db_xref="CDD:28945"
misc_feature order(2600..2602,2777..2779,2822..2824)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Interdomain contacts; other site"
/db_xref="CDD:28945"
misc_feature order(2825..2830,2831..2836)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Cytokine receptor motif; other site"
/db_xref="CDD:28945"
misc_feature 2873..3133
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Fibronectin type 3 domain; One of three types of
internal repeats found in the plasma protein fibronectin.
Its tenth fibronectin type III repeat contains an RGD cell
recognition sequence in a flexible loop between 2 strands.
Approximately 2% of all...; Region: FN3; cd00063"
/db_xref="CDD:28945"
misc_feature order(3059..3061,3104..3106)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Interdomain contacts; other site"
/db_xref="CDD:28945"
misc_feature order(3107..3112,3116..3121)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Cytokine receptor motif; other site"
/db_xref="CDD:28945"
misc_feature 3158..3613
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Von Willebrand factor type A (vWA) domain was
originally found in the blood coagulation protein von
Willebrand factor (vWF). Typically, the vWA domain is made
up of approximately 200 amino acid residues folded into a
classic a/b para-rossmann type of...; Region:
vWFA_subfamily_ECM; cd01450"
/db_xref="CDD:29223"
misc_feature order(3158..3160,3164..3166,3224..3226,3479..3481,
3485..3487,3563..3565)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="integrin inhibitor binding pocket; other site"
/db_xref="CDD:29223"
misc_feature order(3179..3181,3185..3187,3191..3193,3395..3397,
3497..3499)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="metal ion-dependent adhesion site (MIDAS); other
site"
/db_xref="CDD:29223"
misc_feature order(3185..3193,3194..3196,3395..3397)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="integrin-collagen binding site; other site"
/db_xref="CDD:29223"
misc_feature order(3275..3277,3320..3325,3356..3361)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="putative vWF-collagen binding site; other site"
/db_xref="CDD:29223"
misc_feature order(3302..3307,3311..3313,3407..3409,3416..3418,
3428..3433)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="glycoprotein Ib (GpIb) binding site [polypeptide
binding]; other site"
/db_xref="CDD:29223"
misc_feature 3509..3517
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q02388.2);
Region: Cell attachment site (Potential)"
misc_feature 3761..8353
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q02388.2);
Region: Triple-helical region"
misc_feature 3761..4432
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q02388.2);
Region: Interrupted collagenous region"
misc_feature 4001..4009
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q02388.2);
Region: Cell attachment site (Potential)"
misc_feature 5156..5329
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Collagen triple helix repeat (20 copies); Region:
Collagen; pfam01391"
/db_xref="CDD:189968"
misc_feature 6023..6031
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q02388.2);
Region: Cell attachment site (Potential)"
misc_feature 6323..6490
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Collagen triple helix repeat (20 copies); Region:
Collagen; pfam01391"
/db_xref="CDD:189968"
misc_feature 6500..6502
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/experiment="experimental evidence, no additional details
recorded"
/note="4-hydroxyproline; propagated from
UniProtKB/Swiss-Prot (Q02388.2); hydroxylation site"
misc_feature 6527..6529
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/experiment="experimental evidence, no additional details
recorded"
/note="4-hydroxyproline; propagated from
UniProtKB/Swiss-Prot (Q02388.2); hydroxylation site"
misc_feature 6554..6556
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/experiment="experimental evidence, no additional details
recorded"
/note="4-hydroxyproline; propagated from
UniProtKB/Swiss-Prot (Q02388.2); hydroxylation site"
misc_feature 6563..6565
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/experiment="experimental evidence, no additional details
recorded"
/note="4-hydroxyproline; propagated from
UniProtKB/Swiss-Prot (Q02388.2); hydroxylation site"
misc_feature 7469..7705
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Collagen triple helix repeat (20 copies); Region:
Collagen; pfam01391"
/db_xref="CDD:189968"
misc_feature 7658..7666
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q02388.2);
Region: Cell attachment site (Potential)"
misc_feature 7841..8020
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Collagen triple helix repeat (20 copies); Region:
Collagen; pfam01391"
/db_xref="CDD:189968"
misc_feature 7874..7876
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/experiment="experimental evidence, no additional details
recorded"
/note="5-hydroxylysine, alternate; propagated from
UniProtKB/Swiss-Prot (Q02388.2); hydroxylation site"
misc_feature 7892..7894
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/experiment="experimental evidence, no additional details
recorded"
/note="5-hydroxylysine, alternate; propagated from
UniProtKB/Swiss-Prot (Q02388.2); hydroxylation site"
misc_feature 7949..8122
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="Collagen triple helix repeat (20 copies); Region:
Collagen; pfam01391"
/db_xref="CDD:189968"
misc_feature 7991..7993
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/experiment="experimental evidence, no additional details
recorded"
/note="4-hydroxyproline; propagated from
UniProtKB/Swiss-Prot (Q02388.2); hydroxylation site"
misc_feature 8000..8002
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/experiment="experimental evidence, no additional details
recorded"
/note="4-hydroxyproline; propagated from
UniProtKB/Swiss-Prot (Q02388.2); hydroxylation site"
misc_feature 8018..8020
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/experiment="experimental evidence, no additional details
recorded"
/note="4-hydroxyproline; propagated from
UniProtKB/Swiss-Prot (Q02388.2); hydroxylation site"
misc_feature 8354..8833
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q02388.2);
Region: Nonhelical region (NC2)"
misc_feature 8462..8464
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00209"
misc_feature 8621..8791
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="BPTI/Kunitz family of serine protease inhibitors;
Structure is a disulfide rich alpha+beta fold. BPTI
(bovine pancreatic trypsin inhibitor) is an extensively
studied model structure; Region: KU; cd00109"
/db_xref="CDD:29009"
misc_feature order(8651..8665,8669..8671)
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/note="trypsin interaction site; other site"
/db_xref="CDD:29009"
misc_feature 8657..8662
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="non-experimental evidence, no additional
details recorded"
/note="Reactive bond (By similarity); propagated from
UniProtKB/Swiss-Prot (Q02388.2); other site"
exon 87..267
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 268..427
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 428..521
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 522..683
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 684..847
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 848..977
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 978..1094
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 1095..1241
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 1242..1358
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 1359..1508
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 1509..1637
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 1638..1781
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
variation 1642
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/replace="g"
/replace="t"
/db_xref="dbSNP:2854410"
exon 1782..1907
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
variation 1785
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2228561"
exon 1908..2051
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 2052..2171
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 2172..2315
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 2316..2441
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 2442..2588
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 2589..2711
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
variation 2679
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/replace="a"
/replace="c"
/db_xref="dbSNP:2854389"
exon 2712..2858
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
STS 2722..3093
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/standard_name="GDB:192955"
/db_xref="UniSTS:155734"
variation 2818
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1264194"
exon 2859..2993
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 2994..3140
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 3141..3277
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
variation 3149
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2229818"
exon 3278..3404
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
variation 3307
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2854390"
variation 3360
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2228563"
exon 3405..3551
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 3552..3724
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 3725..3760
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 3761..3787
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 3788..3832
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 3833..3895
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 3896..3976
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 3977..4012
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4013..4048
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4049..4120
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4121..4198
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4199..4225
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4226..4279
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4280..4342
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4343..4402
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4403..4438
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4439..4483
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4484..4519
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4520..4564
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4565..4600
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4601..4636
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
variation 4614
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2229824"
exon 4637..4669
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4670..4723
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4724..4783
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4784..4819
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4820..4900
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4901..4936
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4937..4981
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 4982..5053
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 5054..5098
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
variation 5087
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2229820"
exon 5099..5125
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 5126..5155
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 5156..5236
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 5237..5272
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 5273..5308
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 5309..5389
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 5390..5425
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 5426..5488
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 5489..5533
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
variation 5509
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/replace="c"
/replace="g"
/db_xref="dbSNP:2854404"
exon 5534..5569
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 5570..5605
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 5606..5701
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 5702..5737
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 5738..5773
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 5774..5821
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 5822..5857
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 5858..5980
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
variation 5924
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2229821"
exon 5981..6181
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 6182..6217
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
variation 6189
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2229825"
exon 6218..6280
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 6281..6349
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 6350..6394
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 6395..6457
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 6458..6502
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 6503..6538
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 6539..6574
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 6575..6619
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 6620..6652
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 6653..6715
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 6716..6751
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 6752..6832
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 6833..6901
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 6902..6937
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 6938..6979
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 6980..7024
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 7025..7069
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
variation 7052
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800013"
exon 7070..7105
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 7106..7165
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 7166..7273
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 7274..7345
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
variation 7287
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2229822"
exon 7346..7381
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 7382..7441
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 7442..7486
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 7487..7522
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 7523..7558
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 7559..7615
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 7616..7687
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 7688..7759
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 7760..7795
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 7796..7876
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 7877..7930
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 7931..7984
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 7985..8047
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 8048..8110
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 8111..8227
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 8228..8305
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 8306..8359
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 8360..8408
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 8409..8441
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 8442..8528
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 8529..8621
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
exon 8622..8819
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
STS 8721..9133
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/standard_name="GDB:384986"
/db_xref="UniSTS:157129"
exon 8820..9169
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/inference="alignment:Splign:1.39.8"
STS 8916..9162
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/standard_name="RH80100"
/db_xref="UniSTS:83603"
variation 8947
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1042469"
variation 9052
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1803298"
polyA_signal 9146..9151
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
polyA_site 9169
/gene="COL7A1"
/gene_synonym="EBD1; EBDCT; EBR1"
ORIGIN
gatgacgctgcggcttctggtggccgcgctctgcgccgggatcctggcagaggcgccccgagtgcgagcccagcacagggagagagtgacctgcacgcgcctttacgccgctgacattgtgttcttactggatggctcctcatccattggccgcagcaatttccgcgaggtccgcagctttctcgaagggctggtgctgcctttctctggagcagccagtgcacagggtgtgcgctttgccacagtgcagtacagcgatgacccacggacagagttcggcctggatgcacttggctctgggggtgatgtgatccgcgccatccgtgagcttagctacaaggggggcaacactcgcacaggggctgcaattctccatgtggctgaccatgtcttcctgccccagctggcccgacctggtgtccccaaggtctgcatcctgatcacagacgggaagtcccaggacctggtggacacagctgcccaaaggctgaaggggcagggggtcaagctatttgctgtggggatcaagaatgctgaccctgaggagctgaagcgagttgcctcacagcccaccagtgacttcttcttcttcgtcaatgacttcagcatcttgaggacactactgcccctcgtttcccggagagtgtgcacgactgctggtggcgtgcctgtgacccgacctccggatgactcgacctctgctccacgagacctggtgctgtctgagccaagcagccaatccttgagagtacagtggacagcggccagtggccctgtgactggctacaaggtccagtacactcctctgacggggctgggacagccactgccgagtgagcggcaggaggtgaacgtcccagctggtgagaccagtgtgcggctgcggggtctccggccactgaccgagtaccaagtgactgtgattgccctctacgccaacagcatcggggaggctgtgagcgggacagctcggaccactgccctagaagggccggaactgaccatccagaataccacagcccacagcctcctggtggcctggcggagtgtgccaggtgccactggctaccgtgtgacatggcgggtcctcagtggtgggcccacacagcagcaggagctgggccctgggcagggttcagtgttgctgcgtgacttggagcctggcacggactatgaggtgaccgtgagcaccctatttggccgcagtgtggggcccgccacttccctgatggctcgcactgacgcttctgttgagcagaccctgcgcccggtcatcctgggccccacatccatcctcctttcctggaacttggtgcctgaggcccgtggctaccggttggaatggcggcgtgagactggcttggagccaccgcagaaggtggtactgccctctgatgtgacccgctaccagttggatgggctgcagccgggcactgagtaccgcctcacactctacactctgctggagggccacgaggtggccacccctgcaaccgtggttcccactggaccagagctgcctgtgagccctgtaacagacctgcaagccaccgagctgcccgggcagcgggtgcgagtgtcctggagcccagtccctggtgccacccagtaccgcatcattgtgcgcagcacccagggggttgagcggaccctggtgcttcctgggagtcagacagcattcgacttggatgacgttcaggctgggcttagctacactgtgcgggtgtctgctcgagtgggtccccgtgagggcagtgccagtgtcctcactgtccgccgggagccggaaactccacttgctgttccagggctgcgggttgtggtgtcagatgcaacgcgagtgagggtggcctggggacccgtccctggagccagtggatttcggattagctggagcacaggcagtggtccggagtccagccagacactgcccccagactctactgccacagacatcacagggctgcagcctggaaccacctaccaggtggctgtgtcggtactgcgaggcagagaggagggccctgctgcagtcatcgtggctcgaacggacccactgggcccagtgaggacggtccatgtgactcaggccagcagctcatctgtcaccattacctggaccagggttcctggcgccacaggatacagggtttcctggcactcagcccacggcccagagaaatcccagttggtttctggggaggccacggtggctgagctggatggactggagccagatactgagtatacggtgcatgtgagggcccatgtggctggcgtggatgggccccctgcctctgtggttgtgaggactgcccctgagcctgtgggtcgtgtgtcgaggctgcagatcctcaatgcttccagcgacgttctacggatcacctgggtaggggtcactggagccacagcttacagactggcctggggccggagtgaaggcggccccatgaggcaccagatactcccaggaaacacagactctgcagagatccggggtctcgaaggtggagtcagctactcagtgcgagtgactgcacttgtcggggaccgcgagggcacacctgtctccattgttgtcactacgccgcctgaggctccgccagccctggggacgcttcacgtggtgcagcgcggggagcactcgctgaggctgcgctgggagccggtgcccagagcgcagggcttccttctgcactggcaacctgagggtggccaggaacagtcccgggtcctggggcccgagctcagcagctatcacctggacgggctggagccagcgacacagtaccgcgtgaggctgagtgtcctagggccagctggagaagggccctctgcagaggtgactgcgcgcactgagtcacctcgtgttccaagcattgaactacgtgtggtggacacctcgatcgactcggtgactttggcctggactccagtgtccagggcatccagctacatcctatcctggcggccactcagaggccctggccaggaagtgcctgggtccccgcagacacttccagggatctcaagctcccagcgggtgacagggctagagcctggcgtctcttacatcttctccctgacgcctgtcctggatggtgtgcggggtcctgaggcatctgtcacacagacgccagtgtgcccccgtggcctggcggatgtggtgttcctaccacatgccactcaagacaatgctcaccgtgcggaggctacgaggagggtcctggagcgtctggtgttggcacttgggcctcttgggccacaggcagttcaggttggcctgctgtcttacagtcatcggccctccccactgttcccactgaatggctcccatgaccttggcattatcttgcaaaggatccgtgacatgccctacatggacccaagtgggaacaacctgggcacagccgtggtcacagctcacagatacatgttggcaccagatgctcctgggcgccgccagcacgtaccaggggtgatggttctgctagtggatgaacccttgagaggtgacatattcagccccatccgtgaggcccaggcttctgggcttaatgtggtgatgttgggaatggctggagcggacccagagcagctgcgtcgcttggcgccgggtatggactctgtccagaccttcttcgccgtggatgatgggccaagcctggaccaggcagtcagtggtctggccacagccctgtgtcaggcatccttcactactcagccccggccagagccctgcccagtgtattgtccaaagggccagaagggggaacctggagagatgggcctgagaggacaagttgggcctcctggcgaccctggcctcccgggcaggaccggtgctcccggcccccaggggccccctggaagtgccactgccaagggcgagaggggcttccctggagcagatgggcgtccaggcagccctggccgcgccgggaatcctgggacccctggagcccctggcctaaagggctctccagggttgcctggccctcgtggggacccgggagagcgaggacctcgaggcccaaagggggagccgggggctcccggacaagtcatcggaggtgaaggacctgggcttcctgggcggaaaggggaccctggaccatcgggcccccctggacctcgtggaccactgggggacccaggaccccgtggccccccagggcttcctggaacagccatgaagggtgacaaaggcgatcgtggggagcggggtccccctggaccaggtgaaggtggcattgctcctggggagcctgggctgccgggtcttcccggaagccctggaccccaaggccccgttggcccccctggaaagaaaggagaaaaaggtgactctgaggatggagctccaggcctcccaggacaacctgggtctccgggtgagcagggcccacggggacctcctggagctattggccccaaaggtgaccggggctttccagggcccctgggtgaggctggagagaagggcgaacgtggacccccaggcccagcgggatcccgggggctgccaggggttgctggacgtcctggagccaagggtcctgaagggccaccaggacccactggccgccaaggagagaagggggagcctggtcgccctggggaccctgcagtggtgggacctgctgttgctggacccaaaggagaaaagggagatgtggggcccgctgggcccagaggagctaccggagtccaaggggaacggggcccacccggcttggttcttcctggagaccctggccccaagggagaccctggagaccggggtcccattggccttactggcagagcaggacccccaggtgactcagggcctcctggagagaagggagaccctgggcggcctggccccccaggacctgttggcccccgaggacgagatggtgaagttggagagaaaggtgacgagggtcctccgggtgacccgggtttgcctggaaaagcaggcgagcgtggccttcggggggcacctggagttcgggggcctgtgggtgaaaagggagaccagggagatcctggagaggatggacgaaatggcagccctggatcatctggacccaagggtgaccgtggggagccgggtcccccaggacccccgggacggctggtagacacaggacctggagccagagagaagggagagcctggggaccgcggacaagagggtcctcgagggcccaagggtgatcctggcctccctggagcccctggggaaaggggcattgaagggtttcggggacccccaggcccacagggggacccaggtgtccgaggcccagcaggagaaaagggtgaccggggtccccctgggctggatggccggagcggactggatgggaaaccaggagccgctgggccctctgggccgaatggtgctgcaggcaaagctggggacccagggagagacgggcttccaggcctccgtggagaacagggcctccctggcccctctggtccccctggattaccgggaaagccaggcgaggatggcaaacctggcctgaatggaaaaaacggagaacctggggaccctggagaagacgggaggaagggagagaaaggagattcaggcgcctctgggagagaaggtcgtgatggccccaagggtgagcgtggagctcctggtatccttggaccccaggggcctccaggcctcccagggccagtgggccctcctggccagggttttcctggtgtcccaggaggcacgggccccaagggtgaccgtggggagactggatccaaaggggagcagggcctccctggagagcgtggcctgcgaggagagcctggaagtgtgccgaatgtggatcggttgctggaaactgctggcatcaaggcatctgccctgcgggagatcgtggagacctgggatgagagctctggtagcttcctgcctgtgcccgaacggcgtcgaggccccaagggggactcaggcgaacagggccccccaggcaaggagggccccatcggctttcctggagaacgcgggctgaagggcgaccgtggagaccctggccctcaggggccacctggtctggcccttggggagaggggcccccccgggccttccggccttgccggggagcctggaaagcctggtattcccgggctcccaggcagggctgggggtgtgggagaggcaggaaggccaggagagaggggagaacggggagagaaaggagaacgtggagaacagggcagagatggccctcctggactccctggaacccctgggccccccggaccccctggccccaaggtgtctgtggatgagccaggtcctggactctctggagaacagggaccccctggactcaagggtgctaagggggagccgggcagcaatggtgaccaaggtcccaaaggagacaggggtgtgccaggcatcaaaggagaccggggagagcctggaccgaggggtcaggacggcaacccgggtctaccaggagagcgtggtatggctgggcctgaagggaagccgggtctgcagggtccaagaggcccccctggcccagtgggtggtcatggagaccctggaccacctggtgccccgggtcttgctggccctgcaggaccccaaggaccttctggcctgaagggggagcctggagagacaggacctccaggacggggcctgactggacctactggagctgtgggacttcctggaccccccggcccttcaggccttgtgggtccacaggggtctccaggtttgcctggacaagtgggggagacagggaagccgggagccccaggtcgagatggtgccagtggaaaagatggagacagagggagccctggtgtgccagggtcaccaggtctgcctggccctgtcggacctaaaggagaacctggccccacgggggcccctggacaggctgtggtcgggctccctggagcaaagggagagaagggagcccctggaggccttgctggagacctggtgggtgagccgggagccaaaggtgaccgaggactgccagggccgcgaggcgagaagggtgaagctggccgtgcaggggagcccggagaccctggggaagatggtcagaaaggggctccaggacccaaaggtttcaagggtgacccaggagtcggggtcccgggctcccctgggcctcctggccctccaggtgtgaagggagatctgggcctccctggcctgcccggtgctcctggtgttgttgggttcccgggtcagacaggccctcgaggagagatgggtcagccaggccctagtggagagcggggtctggcaggccccccagggagagaaggaatcccaggacccctggggccacctggaccaccggggtcagtgggaccacctggggcctctggactcaaaggagacaagggagaccctggagtagggctgcctgggccccgaggcgagcgtggggagccaggcatccggggtgaagatggccgccccggccaggagggaccccgaggactcacggggccccctggcagcaggggagagcgtggggagaagggtgatgttgggagtgcaggactaaagggtgacaagggagactcagctgtgatcctggggcctccaggcccacggggtgccaagggggacatgggtgaacgagggcctcggggcttggatggtgacaaaggacctcggggagacaatggggaccctggtgacaagggcagcaagggagagcctggtgacaagggctcagccgggttgccaggactgcgtggactcctgggaccccagggtcaacctggtgcagcagggatccctggtgacccgggatccccaggaaaggatggagtgcctggtatccgaggagaaaaaggagatgttggcttcatgggtccccggggcctcaagggtgaacggggagtgaagggagcctgtggccttgatggagagaagggagacaagggagaagctggtcccccaggccgccccgggctggcaggacacaaaggagagatgggggagcctggtgtgccgggccagtcgggggcccctggcaaggagggcctgatcggtcccaagggtgaccgaggctttgacgggcagccaggccccaagggtgaccagggcgagaaaggggagcggggaaccccaggaattgggggcttcccaggccccagtggaaatgatggctctgctggtcccccagggccacctggcagtgttggtcccagaggccccgaaggacttcagggccagaagggtgagcgaggtccccccggagagagagtggtgggggctcctggggtccctggagctcctggcgagagaggggagcaggggcggccagggcctgccggtcctcgaggcgagaagggagaagctgcactgacggaggatgacatccggggctttgtgcgccaagagatgagtcagcactgtgcctgccagggccagttcatcgcatctggatcacgacccctccctagttatgctgcagacactgccggctcccagctccatgctgtgcctgtgctccgcgtctctcatgcagaggaggaagagcgggtaccccctgaggatgatgagtactctgaatactccgagtattctgtggaggagtaccaggaccctgaagctccttgggatagtgatgacccctgttccctgccactggatgagggctcctgcactgcctacaccctgcgctggtaccatcgggctgtgacaggcagcacagaggcctgtcacccttttgtctatggtggctgtggagggaatgccaaccgttttgggacccgtgaggcctgcgagcgccgctgcccaccccgggtggtccagagccaggggacaggtactgcccaggactgaggcccagataatgagctgagattcagcatcccctggaggagtcggggtctcagcagaaccccactgtccctccccttggtgctagaggcttgtgtgcacgtgagcgtgcgtgtgcacgtccgttatttcagtgacttggtcccgtgggtctagccttcccccctgtggacaaacccccattgtggctcctgccaccctggcagatgactcactgtgggggggtggctgtgggcagtgagcggatgtgactggcgtctgacccgccccttgacccaagcctgtgatgacatggtgctgattctggggggcattaaagctgctgttttaaaaggc
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:1294 -> Molecular function: GO:0004867 [serine-type endopeptidase inhibitor activity] evidence: IEA
GeneID:1294 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:1294 -> Biological process: GO:0007155 [cell adhesion] evidence: IEA
GeneID:1294 -> Biological process: GO:0008544 [epidermis development] evidence: TAS
GeneID:1294 -> Biological process: GO:0022617 [extracellular matrix disassembly] evidence: TAS
GeneID:1294 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS
GeneID:1294 -> Biological process: GO:0030574 [collagen catabolic process] evidence: TAS
GeneID:1294 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS
GeneID:1294 -> Cellular component: GO:0005590 [collagen type VII] evidence: TAS
GeneID:1294 -> Cellular component: GO:0005604 [basement membrane] evidence: IEA
GeneID:1294 -> Cellular component: GO:0005788 [endoplasmic reticulum lumen] evidence: TAS
GeneID:1294 -> Cellular component: GO:0031012 [extracellular matrix] evidence: ISS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.