Home |
Help |
Advanced search
2026-04-25 19:20:23, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001256379 4102 bp mRNA linear PRI 16-JUN-2013
DEFINITION Homo sapiens minichromosome maintenance complex binding protein
(MCMBP), transcript variant 3, mRNA.
ACCESSION NM_001256379
VERSION NM_001256379.1 GI:373838728
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 4102)
AUTHORS Jagannathan,M., Sakwe,A.M., Nguyen,T. and Frappier,L.
TITLE The MCM-associated protein MCM-BP is important for human nuclear
morphology
JOURNAL J. Cell. Sci. 125 (PT 1), 133-143 (2012)
PUBMED 22250201
REMARK GeneRIF: results suggest that MCM-BP makes multiple contributions
to human cells that are not limited to unloading of the MCM complex
REFERENCE 2 (bases 1 to 4102)
AUTHORS Nguyen,T., Jagannathan,M., Shire,K. and Frappier,L.
TITLE Interactions of the human MCM-BP protein with MCM complex
components and Dbf4
JOURNAL PLoS ONE 7 (4), E35931 (2012)
PUBMED 22540012
REMARK GeneRIF: MCM-BP can decrease phosphorylation by DDK but is not a
substrate.
REFERENCE 3 (bases 1 to 4102)
AUTHORS Nishiyama,A., Frappier,L. and Mechali,M.
TITLE MCM-BP regulates unloading of the MCM2-7 helicase in late S phase
JOURNAL Genes Dev. 25 (2), 165-175 (2011)
PUBMED 21196493
REMARK GeneRIF: MCM-BP silencing in human cells also delays MCM
dissociation in late S phase
REFERENCE 4 (bases 1 to 4102)
AUTHORS Takahashi,N., Quimbaya,M., Schubert,V., Lammens,T., Vandepoele,K.,
Schubert,I., Matsui,M., Inze,D., Berx,G. and De Veylder,L.
TITLE The MCM-binding protein ETG1 aids sister chromatid cohesion
required for postreplicative homologous recombination repair
JOURNAL PLoS Genet. 6 (1), E1000817 (2010)
PUBMED 20090939
REMARK GeneRIF: Knockdown of the human ETG1 results in defective chromatid
cohesion.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 4102)
AUTHORS Sakwe,A.M., Nguyen,T., Athanasopoulos,V., Shire,K. and Frappier,L.
TITLE Identification and characterization of a novel component of the
human minichromosome maintenance complex
JOURNAL Mol. Cell. Biol. 27 (8), 3044-3055 (2007)
PUBMED 17296731
REMARK GeneRIF: MCM-BP is conserved in multicellular eukaryotes and shares
limited homology with MCM proteins. MCM-BP formed a complex with
MCM3 to MCM7, which excluded MCM2.
REFERENCE 6 (bases 1 to 4102)
AUTHORS Beausoleil,S.A., Villen,J., Gerber,S.A., Rush,J. and Gygi,S.P.
TITLE A probability-based approach for high-throughput protein
phosphorylation analysis and site localization
JOURNAL Nat. Biotechnol. 24 (10), 1285-1292 (2006)
PUBMED 16964243
REFERENCE 7 (bases 1 to 4102)
AUTHORS Grupe,A., Li,Y., Rowland,C., Nowotny,P., Hinrichs,A.L., Smemo,S.,
Kauwe,J.S., Maxwell,T.J., Cherny,S., Doil,L., Tacey,K., van
Luchene,R., Myers,A., Wavrant-De Vrieze,F., Kaleem,M.,
Hollingworth,P., Jehu,L., Foy,C., Archer,N., Hamilton,G.,
Holmans,P., Morris,C.M., Catanese,J., Sninsky,J., White,T.J.,
Powell,J., Hardy,J., O'Donovan,M., Lovestone,S., Jones,L.,
Morris,J.C., Thal,L., Owen,M., Williams,J. and Goate,A.
TITLE A scan of chromosome 10 identifies a novel locus showing strong
association with late-onset Alzheimer disease
JOURNAL Am. J. Hum. Genet. 78 (1), 78-88 (2006)
PUBMED 16385451
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
DA381502.1, AK094075.1 and AC027672.12.
Summary: This gene encodes a protein which is a component of the
hexameric minichromosome maintenance (MCM) complex which regulates
initiation and elongation of DNA. Multiple transcript variants
encoding different isoforms have been found for this gene.
[provided by RefSeq, Jan 2012].
Transcript Variant: This variant (3) differs in the 5' UTR and
coding region, and uses a downstream start codon compared to
variant 1. The resulting protein (isoform 3) is shorter and has a
shorter N-terminus compared to isoform 1.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
##Evidence-Data-START##
Transcript exon combination :: AK094075.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025088 [ECO:0000348]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-7 DA381502.1 1-7
8-1390 AK094075.1 2-1384
1391-1391 AC027672.12 176894-176894
1392-1930 AK094075.1 1386-1924
1931-1931 AC027672.12 183980-183980
1932-2305 AK094075.1 1926-2299
2306-4102 AC027672.12 184355-186151
FEATURES Location/Qualifiers
source 1..4102
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="10"
/map="10q26.11"
gene 1..4102
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/note="minichromosome maintenance complex binding protein"
/db_xref="GeneID:79892"
/db_xref="HGNC:25782"
/db_xref="MIM:610909"
exon 1..198
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 199..284
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 285..425
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 426..467
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 468..560
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
misc_feature 482..484
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/note="upstream in-frame stop codon"
exon 561..683
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
CDS 629..2032
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/note="isoform 3 is encoded by transcript variant 3;
MCM-binding protein; minichromosome maintenance
complex-binding protein; mini-chromosome maintenance
complex-binding protein"
/codon_start=1
/product="mini-chromosome maintenance complex-binding
protein isoform 3"
/protein_id="NP_001243308.1"
/db_xref="GI:373838729"
/db_xref="GeneID:79892"
/db_xref="HGNC:25782"
/db_xref="MIM:610909"
/translation="
MDLQPNKQKDQHAGARQAGSVGGLQWCGEPKRLETEASTGQQLNSLNLSSPFDLNFPLPGEKGPACLVKVYEDWDCFKVNDILELYGILSVDPVLSILNNDERDASALLDPMECTDTAEEQRVHSPPASLVPRIHVILAQKLQHINPLLPACLNKEESKTFVSSFMSELSPVRAELLGFLTHALLGDSLAAEYLILHLISTVYTRRDVLPLGKFTVNLSGCPRNSTFTEHLYRIIQHLVPASFRLQMTIENMNHLKFIPHKDYTANRLVSGLLQLPSNTSLVIDETLLEQGQLDTPGVHNVTALSNLITWQKVDYDFSYHQMEFPCNINVFITSEGRSLLPADCQIHLQPQLIPPNMEEYMNSLLSAVLPSVLNKFRIYLTLLRFLEYSISDEITKAVEDDFVEMRKNDPQSITADDLHQLLVVARCLSLSAGQTTLSRERWLRAKQLESLRRTRLQQQKCVNGNEL
"
misc_feature 1157..1456
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/note="Putative alanine racemase; Region: Racemase_4;
pfam13615"
/db_xref="CDD:205793"
variation 663
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/replace="a"
/replace="g"
/db_xref="dbSNP:35175048"
exon 684..835
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 836..936
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 937..1109
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
variation 994
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/replace="a"
/replace="g"
/db_xref="dbSNP:35484984"
variation 1045
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/replace="c"
/replace="t"
/db_xref="dbSNP:34297798"
exon 1110..1233
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 1234..1351
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 1352..1517
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 1518..1651
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
variation 1561
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/replace="a"
/replace="g"
/db_xref="dbSNP:34118671"
exon 1652..1816
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 1817..1905
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 1906..4102
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
variation 1914
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/replace="c"
/replace="g"
/db_xref="dbSNP:35371199"
variation 2167..2168
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/replace=""
/replace="gt"
/db_xref="dbSNP:28362484"
variation 3244
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/replace="a"
/replace="g"
/db_xref="dbSNP:10550"
STS 3484..3598
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/standard_name="A005M41"
/db_xref="UniSTS:7490"
STS 3484..3598
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/standard_name="G32243"
/db_xref="UniSTS:116846"
variation 3616
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/replace="a"
/replace="c"
/db_xref="dbSNP:6881"
ORIGIN
attttccaaattgcctcagcaaaaggctgctgtagtcggtcttcgtagcttccttctccagggtatcctagcggcgcgcagtgcaggagcctcgcaccgctccccgacggcggctgccagcttccagacagacgccgacccggtgttcgcaaccagggcgcaggccgggcccggagcgtttagagcgcccgcccctcgcccaaaatggagttaatcctgactgggagaagaaagtaattgagtattttaaggaaaagctgaaggaaaataatgctcctaagtgggtaccatcactgaacgaagttccccttcattatttgaaacctaatagttttgtgaaatttcgttgcatgattcaggatatgtttgaccctgagttttacatgggagtttatgaaacggttaaccaaaacacaaaagcacatgttcttcattttggaaaatatagagatgtagcagagtgtgggcctcaacaagaacttgatttaaactctccacgaaataccactttggaaagacagactttctattgtgttccggtgcctggggaatctacgtggctcgagtcagtccctcaacatcctacactcctagtcgccacaagaggagttatgaagatgatgacgatatggacctacagcccaataagcagaaagaccaacatgcaggtgccagacaagcagggagtgttggtggtcttcaatggtgtggagagccaaaacgtttagaaactgaagcttctactgggcaacagctgaactctctgaacttgtcttctccttttgatttgaattttccattgccaggagagaagggccctgcatgccttgtgaaggtttatgaagattgggattgtttcaaagtaaatgacattcttgagctatatggcatactgtctgtggatcctgtgctgagtatactgaataatgatgaaagggatgcctctgcactgctggatccgatggagtgcacagacacagcagaggagcagagagtacacagtcctcctgcttcattagtgccgagaattcatgtgatcttagcccagaagttgcaacacatcaacccattattgcctgcctgccttaacaaagaggagagcaaaacctttgtttcaagtttcatgtccgaattgtctccagtcagagcagaacttcttgggttccttactcatgcccttctgggggatagtttggctgctgaataccttatattacatctcatctccacagtatatacaagaagagatgtccttccactaggaaaatttacagttaacttgagtggttgcccacggaatagtaccttcacagaacacttgtatcgaattattcaacatcttgttccagcatcttttcgtctgcagatgactatagagaacatgaaccatttgaaattcattccccacaaagactacacagccaatcgcttggtcagtgggctcctccagctgcccagcaatacttcccttgtaatcgatgagactctcctggaacaggggcagctggataccccaggtgttcataatgtgacagccctgagcaacctcataacgtggcagaaggtggattatgacttcagctaccatcagatggaattcccctgcaatattaacgttttcattacttcggaggggaggtcactcctcccggcagactgccagattcacttacagccccagctaattccaccaaacatggaggagtacatgaacagccttctctcagcggtgctgccttccgtgctgaacaaattccgcatttatctaactcttttgagattcttggaatatagcatatctgatgaaataaccaaggcagttgaagatgactttgtggaaatgcggaagaacgaccctcagagcatcactgctgatgatcttcaccagctgctcgtggtggctcggtgtctgtctctcagtgctggtcagacaacgctgtcaagagaacgatggctgagagcaaagcagctagagtctttaagaagaacgaggcttcagcagcaaaaatgtgtgaatggaaatgaactttaaagatgtaatacctatgaagagtaatgggcaaactgtagccacataattgtaaaattcagatattcatttataccacattgttttataggtaatttctatcacaaaccagtgacatttcctgaaatcaagcctggtaacacctgatgtttatatgatattcagtaaggacttttaccttactgatttcatggagcttttgaagtttgttttataataattatataaattagtaatgatgtaaaaaaagtatttgatattaaaagtttaatattgataatgttgctgattgtaccatttccttagcttcagctgagtcataggccagactgttgaaatgctgaaatgaagaaggttgttgcagtttcaaagtcagaggaatcgtgcttcggatttcttatgttttctagttctctgtttttccagttcacagtgggttggggtgcattcagtagtccatctttggggaacggaggcgtacttgccattgattcacatgactacatgaaattctgtactgtcatttcccagatgtttggccacagaaactttttcccacttaacatttgttaacagcctgcaaaactaaacttgtacatggcagtggttcccagacttttgtattttatggaccggtagtaatatttccaaaaatctggggtactataaggttgccaatttaccttgccaagtaatccgaataaatcactgtattatcaccatttttttcataaaaggaaaggacaatctatctctgaataagaggagtcctttaaacggaatgaatgtggcttttgggggcaaaagaaaccaagacactacattgtctttattttctcctatcccagtgcatttgagaaccatgcataagggaatgctgtgctacaaagctgtgcccaaatatgaaaacaaaataggaaacttaaaaagcaataccccctttagaaagtttttattttcttaaatgtcattgagttgctttgattctattggatttttggcattttttatgggatcatcagttggttccaagtatgttagatcagctaacatctgctactccagtaacagcctcgtacaactgcaggtaggttttctccagaccaattagttttaatagagcaaactaacaacagactgtagtagcatggttatggcaaccagaatcttcagaaaggttaggacattactttttaagctgtcagtggtatcaaataacttacctagttggaggcagataaaggatcccttacgttttttcctataaggcctaaattgaaattgttaaccaaggaaacagggtcagccttgaaaaatcaaggaattcattgtacctaataactgaagtaaaaataactagttgttcaacttttcctaaactcaaatctatttttataaacaaatgtaaataatgtttatattagagttgaactggttttcatttttataactggtagactagaccttccttaaacttttagaaataaaatgaaggcttcactggatttgtgaggataaaatacattttctttaattgtcctagagcaaagtacattagtcaccatgtgttttttgtgccaatgtaaattgtaatttaccaaagaaaaatacatacattgcttggtcttgcagaaaagttcccttgaaagaacctttccaataaataaaacgtcccaaattagcagtaccttgggctgtttttcatgagtaagaagattcaccatcccatgtgatctgtgtggaaaaagaccatgtcctcttggtggaagacatgagagagctgaactgaagtggaggaggtggtgcaagagggaccttcctgctcaaggcccgcccaggcagcggaatggagtgcagtgcttggctgcagaaaccctttgtccctcacctatatatacacggacagtcaagtttgttgctctaacgtaaggcacagcgttaatcctgtatggccaggaaactgagtagactcctgtgtaaccctgtttggaactttgccttcttaaaatgatttttcaaagatctctttcgaactaatttctgtagagtttaaacgtgtattttatcacctaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:79892 -> Molecular function: GO:0003682 [chromatin binding] evidence: IDA
GeneID:79892 -> Biological process: GO:0000084 [S phase of mitotic cell cycle] evidence: IMP
GeneID:79892 -> Biological process: GO:0000084 [S phase of mitotic cell cycle] evidence: TAS
GeneID:79892 -> Biological process: GO:0006261 [DNA-dependent DNA replication] evidence: IMP
GeneID:79892 -> Biological process: GO:0007062 [sister chromatid cohesion] evidence: IMP
GeneID:79892 -> Biological process: GO:0007067 [mitosis] evidence: IEA
GeneID:79892 -> Biological process: GO:0051301 [cell division] evidence: IEA
GeneID:79892 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:79892 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
GeneID:79892 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:79892 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:79892 -> Cellular component: GO:0042555 [MCM complex] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.