Home |
Help |
Advanced search
2025-12-16 23:56:56, GGRNA : RefSeq release 60 (20130726)
LOCUS NR_049731 3522 bp RNA linear PRI 17-JUL-2013
DEFINITION Homo sapiens membrane-spanning 4-domains, subfamily A, member 14
(MS4A14), transcript variant 5, non-coding RNA.
ACCESSION NR_049731
VERSION NR_049731.1 GI:387849355
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3522)
AUTHORS Davila,S., Froeling,F.E., Tan,A., Bonnard,C., Boland,G.J.,
Snippe,H., Hibberd,M.L. and Seielstad,M.
TITLE New genetic associations detected in a host response study to
hepatitis B vaccine
JOURNAL Genes Immun. 11 (3), 232-238 (2010)
PUBMED 20237496
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AP003127.2 and AK057418.1.
Transcript Variant: This variant (5) includes an alternate exon in
the coding region, compared to variant 4, which results in the
introduction of an early stop codon. The transcript is sufficiently
abundant to represent as a RefSeq record; however, the predicted
protein product is not represented because the product is
significantly truncated and the transcript is a candidate for
nonsense-mediated mRNA decay (NMD).
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-605 AP003127.2 99935-100539
606-3451 AK057418.1 152-2997
3452-3522 AP003127.2 121607-121677
FEATURES Location/Qualifiers
source 1..3522
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="11"
/map="11q12.2"
gene 1..3522
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/note="membrane-spanning 4-domains, subfamily A, member
14"
/db_xref="GeneID:84689"
/db_xref="HGNC:30706"
misc_RNA 1..3522
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/product="membrane-spanning 4-domains, subfamily A, member
14, transcript variant 5"
/db_xref="GeneID:84689"
/db_xref="HGNC:30706"
exon 1..703
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 31
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:186234557"
variation 39
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:7929046"
variation 40
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:190992915"
variation 51..52
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="a"
/db_xref="dbSNP:377307026"
variation 102
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:76333679"
variation 110
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:143358541"
variation 149
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:3816270"
variation 223
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:76174817"
variation 281
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:180800488"
variation 296
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:185942516"
variation 379
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:141665394"
variation 421
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:112785513"
variation 427
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:375045470"
variation 432
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:190864604"
variation 472
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:6591579"
variation 517
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:368431455"
variation 545
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:367878785"
variation 560
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:200592380"
misc_feature 566..1027
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="COORDINATES:
alignment:Blast2seq::RefSeq|NM_001261827.1"
/note="primary ORF has stop codon >50 nucleotides from the
terminal splice site; nonsense-mediated decay (NMD)
candidate"
variation 569
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:201462421"
variation 577
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:375301622"
variation 589
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:140226757"
variation 601
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:200092161"
variation 602
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:371634910"
variation 640
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:150323558"
variation 653
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:200017443"
variation 701
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:138895874"
exon 704..832
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 709
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:141700245"
variation 731
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="tt"
/db_xref="dbSNP:72514098"
variation 732..733
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="tt"
/db_xref="dbSNP:3217518"
variation 732
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:74733740"
variation 732
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="tt"
/db_xref="dbSNP:77630012"
variation 747
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:147119308"
variation 769
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:138517611"
variation 770
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:368053345"
variation 771
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:144076317"
variation 794
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:369576834"
variation 796
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:144248317"
variation 802
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:2197234"
variation 810
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:372708908"
variation 815
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:148297999"
variation 827
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:375255532"
variation 831
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:141490187"
exon 833..982
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 833
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:375760675"
variation 834
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:202236686"
variation 846
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:146613208"
variation 847
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:371907012"
variation 856
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:183715072"
variation 876
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:76136794"
variation 881
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:375247098"
variation 891
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:146035561"
variation 910
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:140270120"
variation 960
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:145354751"
exon 983..1103
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 1039
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:200118179"
variation 1040
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:61898304"
variation 1051
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:10750937"
variation 1059
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:188315131"
exon 1104..1202
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 1138
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:369231964"
variation 1143
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:77038741"
variation 1169
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:186474420"
exon 1203..3522
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 1223
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:371774895"
variation 1234
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:375761169"
variation 1248
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:143463721"
variation 1263
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:7131283"
variation 1264
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:148391374"
variation 1311
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:369024994"
variation 1317
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:142563385"
variation 1327
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:373780418"
variation 1335
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:116626186"
variation 1340
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:140195795"
variation 1366
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:142269991"
variation 1372
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:147713621"
variation 1373
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:142667482"
variation 1384
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:370208539"
variation 1422
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:373858678"
variation 1425
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:150268605"
variation 1482
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:117801657"
variation 1485
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:149338262"
variation 1521
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:187868937"
variation 1567
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:150868984"
variation 1583
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:193025815"
variation 1584
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:368158780"
variation 1585
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:375278465"
variation 1590
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:114064661"
variation 1606
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:138285006"
variation 1611
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:142839945"
variation 1631
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:369608879"
variation 1642
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:185708225"
variation 1679
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:201469306"
variation 1685
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:114663860"
variation 1694
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:376669252"
variation 1705
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:139364741"
variation 1711
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:149681158"
variation 1731
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:150784858"
variation 1781
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:370940283"
variation 1810
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:145539034"
variation 1830
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:149868650"
variation 1841
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:144883718"
variation 1878
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:140428922"
variation 1914
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:144301602"
variation 1948
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:116345276"
variation 1970
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:112103602"
variation 2002
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:369619070"
variation 2030
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:373220783"
variation 2042..2043
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="c"
/db_xref="dbSNP:35183103"
variation 2086
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:3802959"
variation 2117
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:143398166"
variation 2128
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:139435636"
variation 2135
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:145054362"
variation 2173
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:140456628"
variation 2187
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:376488191"
variation 2225
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:150409796"
variation 2230
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:74837900"
variation 2246
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:142892172"
variation 2261
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:145051590"
variation 2278
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:199805024"
variation 2302
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:199505839"
variation 2305
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:374402343"
variation 2316
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:201227484"
variation 2339
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:142235413"
variation 2371
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:113290465"
variation 2375
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:80173276"
variation 2376
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:144635507"
variation 2389
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:372468983"
variation 2411
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:370935983"
variation 2461
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:200738251"
variation 2462
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:148489703"
variation 2469
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:375897716"
variation 2484
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:3825020"
variation 2510
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:374558627"
variation 2563
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:116224124"
variation 2570
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:73481226"
variation 2580
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:200543306"
variation 2584
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:144309625"
variation 2585
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:201726394"
variation 2592
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:200307761"
variation 2599
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:3016727"
variation 2612
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:147367847"
variation 2613
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:140936913"
variation 2628
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:368186934"
variation 2630
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:146179294"
variation 2642
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:370794980"
variation 2651
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:375353153"
variation 2671
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:145801550"
variation 2695
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:368014397"
variation 2697
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:149015522"
variation 2755
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:142968938"
variation 2760
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:151183005"
variation 2793
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:181547264"
variation 2901
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:77025492"
variation 3011
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:184474834"
variation 3111
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:375774697"
variation 3133
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:1443243"
variation 3222
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:78731118"
variation 3301
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:375396734"
variation 3337
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:75538311"
variation 3359
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:138237921"
variation 3367
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:188971082"
variation 3458..3459
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="aacac"
/db_xref="dbSNP:140068962"
variation 3499
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:181921480"
ORIGIN
atcaagtaaaagaaactcctttcaaaggagggcagaagcgtggctgagtttaaaaaacatagattttggagacaggtcaagttgagtttgccccttccctgtcctgtatgtctttgggtgacataaccttgctgttcctcagtttcagtattgtagaactgttaaaagaataaatgttagtgcatgtcaacaccttctacacagttcccagaacataaggaatattccataagttttagttcctttataactcatgaacatatgtgtaaggacttgtttcgtatataccatctattctttgtttaccatatgtttgtaagcaaattgacaagagagtaagtcttctggatacagtacttttcaccaggaagatggggggctgagcatgctctagaattctaaaactctgtgactcaactatgattctgagattctactactgagtagagtcatcactaagggctcatctctgagggctccatgtgactctggtggagaggtagatcatgatttgggcggcaatgtttgctcactctttcccttactagagttctgccatagaatcatggagtcaacatcccaggacagaagggcaactcacgtcatcactataaaaccaaacgaaactgtattgactgcatttccctacagacctcatagctctctgctggattttctgaagggagagccaagagtcttgggggctacccagatcctgcttgctctaatcattgtgggctttggaactatatttgcacttaattacatcggtttctcccaaagacttccccttgttgtcctcacaggatatccattctggggagcacttattggtcaaggtgtcacgggcatgaatgttatcagctccttggttgcgataactgggattactttcaccattctcagctacagacatcaagacaagtactgccagatgccatcctttgaagaaatatgtgttttcagtagaactcttttcattgacttcatccttctcactcctccacactccagccacttcctataatcccttaatgtgtcaagtatccacggccccaagatgatcagaggatcagcttcttccggctttgaaccgtcaccagggaattttgttaatcttactgatcatcagcatagcagagctcagcatctctgtgactattgcatcctttagaagcaagtgctggacacagtcagatgaggttctgtttttcttgccttcggatgttactcaaaatagtgaacaacctgccccagaagaaaatgatcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaatgcacaatctgttatctttggaggctatgctttcttcaagttaacactctctaggagtcctttagtctcccaaccaggtaataaaggtagagaatttgtgccagatgaacaaaagcaaagtatccttccatctcccaaattttcagaggaagaaattgaacctttgcctcccacactagagaaaaagccctcagaaaatatgtccattcagctagactctacatttaaacaaatgaaagatgaagatctacaatctgctattgtacaaccttctcaaatgcaaaccaagcttctgcaggaccaagctgcgtcactccaagtttttccatcccattctgcactaaaactcgaagatatatcacctgaagacttgccatcccaagctctaccagtagaaggcctgtcagaacaaaccatgccatctaagtctacatcatcccatgtcaaacagtcttctaatctgacagctaatgacctgccccctcaaggcatactatcccaagacacatcatctcaagatatgctgtttcatgacatgacatcccaagatatgcaatccctagatatgctatctcaagacacaccatcccacgccatgccacctcaagacataccttcccaagatatgctatcccaagctctatcagcgcatgccatattacctgaagcctcaacatcccatattgtgcagttccctgaaatacaacacctacttcagcagcccccagatcttcaaccagaaaacactgaacctcaaaaccagcaaattttacaaatgtcatatcaagatattagatcagaagttatggaagagaccaaagaatggaaatctgaggaggaactccatagaagaaaatcctcaagacggcattccttaaaccagcaaaccaaagccttgcaatacttaaggagacattctttagacgtgcaagccaaaggccagaaatcctcaaagaggcattccttagatcagcaaagcaaaggctggcaatctccaaagcagaaatccttagaccagcaaatcaaagactggctatccccaaagaggcactccgtagataagcaagctcaacttaatcaaactaaagagcaactcccagatcagcaagctgaagatcagcaagccaaaggggaacaatacccagaaggacaatctaaagatggacaagttaaagaccagcagactgataaggagcaaaactcaaagaagcaaacccaggatcagcaaactgaagaccagccggcccaagagaagaaatccccgaaaggacaattccaaaatgttcaagccgaaggacagcaagctcaggtggagaaagtgccaaaactgttatgccaagattcagaatcccaaatacagcaataccaattctggcaattccacaaaggcaatctccaggctggacaacccaggactgtcaatcttttggccaagaatcccctgactggataactcagggctggagaaacaaagattataaagcacgagaatggcaatttgaaatgaagcactggcaaacacaggatctattagagaaagaagccctaaagcagaaagctctataccaagaagtccaaacccagcacgcaacagcccaacataacctagaatgtcaagacactcaagataaagaccaacaagaccttcaatccagagttacacaaaaaggagatatgtacactagagacatcaaaccaggggacatgaaatgtatagggcaaacctcaggggacctgcaatcagaagacgtgaaggcagattttcattcttcttctggccaaagctcagtacaagacacatgtttagcctatttgtccaatctagattcagaacaagatgtgcaaccagacacttcagcttcctcaaattcatataaagaagatgtgaatttaacttctacttcatgtgatccaaaagatcaacagcaatctgaagactctgactaacatgcagaatctacccaataccacactgcccccattaatggaattaaattgggaaaaacaatattgcctcctccaatctgtgttctcaactgtggttgccacctcattaacttacaaaaaaatgaagggcatgctgagcactcaaacaatttgttcttacttaaaataaaatgacaacaaaccaaatgttaacactgtatcatcactttatgtatgtgaagaaataattcacatgtatattccttgtcatcaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:84689 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.