Home |
Help |
Advanced search
2025-10-31 00:47:29, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001164382 2888 bp mRNA linear PRI 07-JUN-2013
DEFINITION Homo sapiens staufen double-stranded RNA binding protein 2 (STAU2),
transcript variant 3, mRNA.
ACCESSION NM_001164382
VERSION NM_001164382.1 GI:256418998
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2888)
AUTHORS Park,E., Gleghorn,M.L. and Maquat,L.E.
TITLE Staufen2 functions in Staufen1-mediated mRNA decay by binding to
itself and its paralog and promoting UPF1 helicase but not ATPase
activity
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 110 (2), 405-412 (2013)
PUBMED 23263869
REMARK GeneRIF: Staufen2 functions in Staufen1-mediated mRNA decay by
binding to itself and its paralog and promoting UPF1 helicase but
not ATPase activity.
REFERENCE 2 (bases 1 to 2888)
AUTHORS Lebeau,G., Miller,L.C., Tartas,M., McAdam,R., Laplante,I.,
Badeaux,F., DesGroseillers,L., Sossin,W.S. and Lacaille,J.C.
TITLE Staufen 2 regulates mGluR long-term depression and Map1b mRNA
distribution in hippocampal neurons
JOURNAL Learn. Mem. 18 (5), 314-326 (2011)
PUBMED 21508097
REMARK GeneRIF: We suggest a role for Stau2 in the generation and
regulation of Map1b mRNA containing granules that are required for
mGluR-long-term depression
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 2888)
AUTHORS Furic,L., Maher-Laporte,M. and DesGroseillers,L.
TITLE A genome-wide approach identifies distinct but overlapping subsets
of cellular mRNAs associated with Staufen1- and Staufen2-containing
ribonucleoprotein complexes
JOURNAL RNA 14 (2), 324-335 (2008)
PUBMED 18094122
REMARK GeneRIF: Stau1- and Stau2-mRNPs associate with distinct but
overlapping sets of cellular mRNAs.
REFERENCE 4 (bases 1 to 2888)
AUTHORS Beausoleil,S.A., Villen,J., Gerber,S.A., Rush,J. and Gygi,S.P.
TITLE A probability-based approach for high-throughput protein
phosphorylation analysis and site localization
JOURNAL Nat. Biotechnol. 24 (10), 1285-1292 (2006)
PUBMED 16964243
REFERENCE 5 (bases 1 to 2888)
AUTHORS Duchaine,T.F., Hemraj,I., Furic,L., Deitinghoff,A., Kiebler,M.A.
and DesGroseillers,L.
TITLE Staufen2 isoforms localize to the somatodendritic domain of neurons
and interact with different organelles
JOURNAL J. Cell. Sci. 115 (PT 16), 3285-3295 (2002)
PUBMED 12140260
REMARK GeneRIF: Data show that Stau2 is localized to the neuronal soma and
dendrites, but it does not colocalize with Stau1-containing
particles.
REFERENCE 6 (bases 1 to 2888)
AUTHORS Kiebler,M.A. and DesGroseillers,L.
TITLE Molecular insights into mRNA transport and local translation in the
mammalian nervous system
JOURNAL Neuron 25 (1), 19-28 (2000)
PUBMED 10707969
REMARK Review article
REFERENCE 7 (bases 1 to 2888)
AUTHORS Buchner,G., Bassi,M.T., Andolfi,G., Ballabio,A. and Franco,B.
TITLE Identification of a novel homolog of the Drosophila staufen protein
in the chromosome 8q13-q21.1 region
JOURNAL Genomics 62 (1), 113-118 (1999)
PUBMED 10585778
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DB501161.1, AK303104.1,
AC100784.2, AK002152.1 and AF459097.1.
Summary: Staufen homolog 2 is a member of the family of
double-stranded RNA (dsRNA)-binding proteins involved in the
transport and/or localization of mRNAs to different subcellular
compartments and/or organelles. These proteins are characterized by
the presence of multiple dsRNA-binding domains which are required
to bind RNAs having double-stranded secondary structures. Staufen
homolog 2 shares 48.5% and 59.9% similarity with drosophila and
human staufen, respectively. The exact function of Staufen homolog
2 is not known, but since it contains 3 copies of conserved dsRNA
binding domain, it could be involved in double-stranded RNA binding
events. Several transcript variants encoding different isoforms
have been found for this gene. [provided by RefSeq, Aug 2009].
Transcript Variant: This variant (3) differs in the 5' UTR and
coding sequence compared to variant 1. The resulting isoform (c)
has a shorter N-terminus compared to isoform a.
##Evidence-Data-START##
Transcript exon combination :: AK303104.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-87 DB501161.1 1-87
88-641 AK303104.1 1-554
642-642 AC100784.2 53879-53879
643-2037 AK303104.1 556-1950
2038-2861 AK002152.1 2128-2951
2862-2888 AF459097.1 2758-2784
FEATURES Location/Qualifiers
source 1..2888
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="8"
/map="8q21.11"
gene 1..2888
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/note="staufen double-stranded RNA binding protein 2"
/db_xref="GeneID:27067"
/db_xref="HGNC:11371"
/db_xref="MIM:605920"
exon 1..145
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/inference="alignment:Splign:1.39.8"
variation complement(92)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="g"
/db_xref="dbSNP:182586484"
variation complement(141)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:190921391"
exon 146..258
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/inference="alignment:Splign:1.39.8"
variation complement(155)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:367669479"
variation complement(180..181)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace=""
/replace="t"
/db_xref="dbSNP:367547275"
exon 259..324
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/inference="alignment:Splign:1.39.8"
variation complement(269)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:202210177"
variation complement(270)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="g"
/replace="t"
/db_xref="dbSNP:375973716"
misc_feature 303..305
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/note="upstream in-frame stop codon"
exon 325..460
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/inference="alignment:Splign:1.39.8"
CDS 363..1877
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/note="isoform c is encoded by transcript variant 3;
double-stranded RNA-binding protein Staufen homolog 2;
staufen homolog 2; staufen, RNA binding protein, homolog
2"
/codon_start=1
/product="double-stranded RNA-binding protein Staufen
homolog 2 isoform c"
/protein_id="NP_001157854.1"
/db_xref="GI:256418999"
/db_xref="CCDS:CCDS55245.1"
/db_xref="GeneID:27067"
/db_xref="HGNC:11371"
/db_xref="MIM:605920"
/translation="
MKRGEPAIYRPLDPKPFPNYRANYNFRGMYNQRYHCPVPKIFYVQLTVGNNEFFGEGKTRQAARHNAAMKALQALQNEPIPERSPQNGESGKDVDDDKDANKSEISLVFEIALKRNMPVSFEVIKESGPPHMKSFVTRVSVGEFSAEGEGNSKKLSKKRAATTVLQELKKLPPLPVVEKPKLFFKKRPKTIVKAGPEYGQGMNPISRLAQIQQAKKEKEPDYVLLSERGMPRRREFVMQVKVGNEVATGTGPNKKIAKKNAAEAMLLQLGYKASTNLQDQLEKTGENKGWSGPKPGFPEPTNNTPKGILHLSPDVYQEMEASRHKVISGTTLGYLSPKDMNQPSSSFFSISPTSNSSATIARELLMNGTSSTAEAIGLKGSSPTPPCSPVQPSKQLEYLARIQGFQVHYCDRQSGKECVTCLTLAPVQMTFHAIGSSIEASHDQAALSALKQFSEQGLDPIDGAMNIEKGSLEKQAKHLREKADNNQAPPGSIAQDCKKSNSAV
"
misc_feature <471..587
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/note="Double-stranded RNA binding motif. Binding is not
sequence specific but is highly specific for double
stranded RNA. Found in a variety of proteins including
dsRNA dependent protein kinase PKR, RNA helicases,
Drosophila staufen protein, E. coli RNase III; Region:
DSRM; cd00048"
/db_xref="CDD:28930"
misc_feature order(534..545,552..554)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/note="dsRNA binding site [nucleotide binding]; other
site"
/db_xref="CDD:28930"
misc_feature 675..860
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/note="Double-stranded RNA binding motif. Binding is not
sequence specific but is highly specific for double
stranded RNA. Found in a variety of proteins including
dsRNA dependent protein kinase PKR, RNA helicases,
Drosophila staufen protein, E. coli RNase III; Region:
DSRM; cd00048"
/db_xref="CDD:28930"
misc_feature order(687..692,813..824,831..833)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/note="dsRNA binding site [nucleotide binding]; other
site"
/db_xref="CDD:28930"
misc_feature 969..1169
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/note="Double-stranded RNA binding motif. Binding is not
sequence specific but is highly specific for double
stranded RNA. Found in a variety of proteins including
dsRNA dependent protein kinase PKR, RNA helicases,
Drosophila staufen protein, E. coli RNase III; Region:
DSRM; cd00048"
/db_xref="CDD:28930"
misc_feature order(969..971,987..992,1116..1127,1134..1136)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/note="dsRNA binding site [nucleotide binding]; other
site"
/db_xref="CDD:28930"
variation complement(380)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:373781707"
variation complement(381)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:200832177"
variation complement(395)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:115816230"
variation complement(422)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:150527132"
variation complement(424)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:200996921"
exon 461..620
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/inference="alignment:Splign:1.39.8"
variation complement(486)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:199731066"
variation complement(496)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:200297530"
variation complement(540)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="c"
/db_xref="dbSNP:201210593"
variation complement(548)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:201898195"
STS 597..702
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/standard_name="WI-16800"
/db_xref="UniSTS:64871"
exon 621..728
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/inference="alignment:Splign:1.39.8"
variation complement(642)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:949493"
exon 729..941
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/inference="alignment:Splign:1.39.8"
variation complement(750)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:376554654"
variation complement(782)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="t"
/db_xref="dbSNP:199859315"
variation complement(796)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:184418849"
variation complement(839)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:28728027"
variation complement(845)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:368673903"
variation complement(854)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:144539323"
variation complement(887)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:201913123"
variation complement(888)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:373605907"
variation complement(899)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:192673893"
variation complement(919)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:199601674"
exon 942..1079
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/inference="alignment:Splign:1.39.8"
variation complement(944)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:371435229"
variation complement(945)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:142831475"
variation complement(977)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:370812556"
variation complement(981)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:138925194"
variation complement(1036)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="t"
/db_xref="dbSNP:376665220"
variation complement(1044)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:368955920"
variation complement(1057)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:369041333"
variation complement(1060)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:377142999"
exon 1080..1211
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/inference="alignment:Splign:1.39.8"
variation complement(1090)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="g"
/replace="t"
/db_xref="dbSNP:147219043"
variation complement(1143)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="g"
/replace="t"
/db_xref="dbSNP:200304414"
exon 1212..1272
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/inference="alignment:Splign:1.39.8"
variation complement(1220)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:199836880"
variation complement(1221)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:200276587"
variation complement(1251)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:201007858"
variation complement(1252)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:202001506"
variation complement(1262)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:142953051"
exon 1273..1580
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/inference="alignment:Splign:1.39.8"
variation complement(1277)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:138728668"
variation complement(1292)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:150211307"
variation complement(1329)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:140982689"
variation complement(1374)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:199937946"
variation complement(1378)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="t"
/db_xref="dbSNP:376067283"
variation complement(1388)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:148124805"
variation complement(1389)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:373103243"
variation complement(1394)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="t"
/db_xref="dbSNP:370371919"
variation complement(1414)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="g"
/db_xref="dbSNP:377256202"
variation complement(1418)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:373075598"
variation complement(1420)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="g"
/db_xref="dbSNP:369610486"
variation complement(1437)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:145795257"
variation complement(1443)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:375207062"
variation complement(1459)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:202085377"
variation complement(1485)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:140667237"
variation complement(1515)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="c"
/db_xref="dbSNP:374802646"
variation complement(1521)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:146866411"
variation complement(1535)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:370311327"
exon 1581..1694
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/inference="alignment:Splign:1.39.8"
variation complement(1625..1628)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace=""
/replace="tctg"
/db_xref="dbSNP:371637726"
variation complement(1659)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:370898737"
variation complement(1673)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:376807384"
exon 1695..1783
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/inference="alignment:Splign:1.39.8"
variation complement(1699)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="c"
/db_xref="dbSNP:376970137"
variation complement(1701)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="g"
/replace="t"
/db_xref="dbSNP:75740279"
variation complement(1727)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:73318729"
variation complement(1743)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="c"
/db_xref="dbSNP:114263344"
variation complement(1746)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:139158161"
exon 1784..2880
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/inference="alignment:Splign:1.39.8"
variation complement(1808)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="t"
/db_xref="dbSNP:145759808"
variation complement(1811)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:368365328"
variation complement(1868)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:146501256"
variation complement(1871)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:369462384"
variation complement(1894)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:375647181"
variation complement(1921)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:184498114"
variation complement(1929)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:143999038"
variation complement(2171)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:72659432"
variation complement(2203)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:192055318"
variation complement(2216..2217)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace=""
/replace="g"
/db_xref="dbSNP:36069340"
variation complement(2250)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="t"
/db_xref="dbSNP:188780480"
variation complement(2266)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:184724066"
variation complement(2281..2282)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace=""
/replace="tc"
/db_xref="dbSNP:149185059"
variation complement(2283)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:193047022"
variation complement(2375)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:187933579"
variation complement(2517)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="g"
/replace="t"
/db_xref="dbSNP:77216259"
variation complement(2519)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="t"
/db_xref="dbSNP:76395585"
variation complement(2520)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="t"
/db_xref="dbSNP:77588845"
variation complement(2522)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="t"
/db_xref="dbSNP:75569575"
variation complement(2544)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:182521597"
variation complement(2579)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:375063234"
variation complement(2620)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="c"
/replace="t"
/db_xref="dbSNP:146705265"
STS 2667..2784
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/standard_name="D8S1387E"
/db_xref="UniSTS:55892"
variation complement(2688)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:16938648"
variation complement(2704)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:192977182"
STS 2755..2880
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/standard_name="RH12642"
/db_xref="UniSTS:77739"
variation complement(2790)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="g"
/db_xref="dbSNP:187118704"
variation complement(2858)
/gene="STAU2"
/gene_synonym="39K2; 39K3"
/replace="a"
/replace="c"
/db_xref="dbSNP:113732226"
polyA_site 2880
/gene="STAU2"
/gene_synonym="39K2; 39K3"
ORIGIN
gggagcgccggggaggcgggcggaggcgggcggaggcggggggcggggagcccgaggggtggaagccggcggcggccgagcggggtcagttctctgtagtgtttgccaatgttggagccgtctgcaaagtgtccccggcaagaagaggctgcctaccacaaggactttagcttactttttaaagattgaagaaaaaaaagaagacagaaaaagaagaactcaaagatacacaaagtaatttgaaccaaggctcagaagtttttggagccgtgagggatacagcagtttggtcaatattgtcttaacatgcttcaaataaatcaggcagtataactccaactgtggaactgaatgggcttgctatgaaaaggggagagcctgccatctacaggccattagatccaaagccattcccaaattatagagctaattacaactttcggggcatgtacaatcagaggtatcattgcccagtgcctaagatcttttatgttcagctcactgtaggaaataatgaattttttggggaaggaaagactcgacaagctgctagacacaatgctgcaatgaaagccctccaagcactgcagaatgaacctattccagaaagatctcctcagaatggtgaatcaggaaaggatgtggatgatgacaaagatgcaaataagtctgagatcagcttagtgtttgaaattgctctgaagcgaaatatgcctgtcagttttgaggttattaaagaaagtggaccaccacatatgaaaagctttgttactcgagtgtcagtaggagagttctctgcagaaggagaaggaaatagcaaaaaactctccaagaagcgcgctgcgaccaccgtcttacaggagcttaaaaaacttccacctcttcctgtggtggaaaagccaaaactattttttaaaaaacgccctaaaacaatagtaaaggccggaccagaatatggccaagggatgaaccctattagccgcctggcgcaaattcaacaggccaaaaaggaaaaggagccggattatgttttgctttcagaaagaggaatgcctcgacgtcgagaatttgtgatgcaggtgaaggtaggcaatgaagttgctacaggaacaggacctaataaaaagatagccaaaaaaaatgctgcagaagcaatgctgttacaacttggttataaagcatccactaatcttcaggatcaacttgagaagacaggggaaaacaaaggatggagtggtccaaagcctgggtttcctgaaccaacaaataatactccaaaaggaattcttcatttgtctcctgatgtttatcaagagatggaagccagccgccacaaagtaatctctggcactactctaggctatttgtcacccaaagatatgaaccaaccttcaagctctttcttcagtatatctcccacatcgaatagttcagctacaattgccagggaactccttatgaatggaacatcttctacagctgaagccataggtttaaaaggaagttctcctactcccccttgttctccagtacaaccttcaaaacaactggaatatttagcaaggattcaaggctttcaggttcactactgtgatagacaaagtggcaaagagtgtgtgacctgtctgacattagcccctgtgcagatgactttccatgctattggaagctccattgaagccagccatgatcaggcagccttaagtgccttgaaacaattttctgaacaaggactggatccaatcgatggagcaatgaatatcgaaaaaggttctcttgaaaaacaagccaagcatctgagagagaaagcggacaataaccaggcacccccgggctccatcgctcaggactgcaagaaatcaaactcggccgtctagcagctcccagaacccgcggctgccaccgcatccttataaacctgtcagcacgcatgagggtgtctgtgttcagggaaatgaatgactaataccattatttgagtcttatgtgaagacaacactattctaacacgagagataatatacatggtactgtttattcaactggggaaaaataaaactttgagcatttcccttggaactcgagatcagatcataactcatttgcctagaggcagcagaaatctgatcctgctactggagcttaaaataacaagtaaagaaaagtgttagaaacaaagctaaaattttaacatgattaataatagagaagttgggtttggttctgttgttatgattgttttgtcgtggtgcttgtgttcagttatattctctctctctctcatttcaaatactgcttgacaattcgaaaatgaaccaatgatgtgctgtggaatgtgatggttgtcttcatatagagtcacatggtttctctttttatgcagatatttataatcttcatcctatatcagtaggaataactataaggtgcactacaaaaagatgtatgcaaacaaacatgttttaaatcaggtcagatatctgatgaaaaatacgaactaatgttaagagcaagtagtttcaacatactccaggaactgagaaacaaaacaaagcaattgtgggttttgagctccatatactcttagcaagtaagggggcgtcttgcccctatatatcatcttcccggattccactccctgttgtgggaatcgcgcccacccccatccgtgtgttgtagccactcacggtttgcatcaagagtgttttttgtaactgcctctggacttgggacagtgagtaggatcaaaaataaataatgtacatgacggggaagggaaaaacctgttggagttgcttccagccagccacgctccgggccagcatgttggaatccagcgtggagcagatgcagtaaaaatgtggttggtttctgtgtgaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:27067 -> Molecular function: GO:0003725 [double-stranded RNA binding] evidence: TAS
GeneID:27067 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:27067 -> Biological process: GO:0006810 [transport] evidence: IEA
GeneID:27067 -> Cellular component: GO:0005730 [nucleolus] evidence: IEA
GeneID:27067 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: IEA
GeneID:27067 -> Cellular component: GO:0005874 [microtubule] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.