Home |
Help |
Advanced search
2025-12-23 07:10:44, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001271696 2525 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7
(ABCB7), transcript variant 2, mRNA.
ACCESSION NM_001271696
VERSION NM_001271696.1 GI:411147362
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2525)
AUTHORS Nikpour,M., Scharenberg,C., Liu,A., Conte,S., Karimi,M.,
Mortera-Blanco,T., Giai,V., Fernandez-Mercado,M., Papaemmanuil,E.,
Hogstrand,K., Jansson,M., Vedin,I., Stephen Wainscoat,J.,
Campbell,P., Cazzola,M., Boultwood,J., Grandien,A. and
Hellstrom-Lindberg,E.
TITLE The transporter ABCB7 is a mediator of the phenotype of acquired
refractory anemia with ring sideroblasts
JOURNAL Leukemia 27 (4), 889-896 (2013)
PUBMED 23070040
REMARK GeneRIF: findings support that ABCB7 is implicated in the phenotype
of acquired RARS and suggest a relation between SF3B1 mutations and
ABCB7 downregulation
REFERENCE 2 (bases 1 to 2525)
AUTHORS D'Hooghe,M., Selleslag,D., Mortier,G., Van Coster,R.,
Vermeersch,P., Billiet,J. and Bekri,S.
TITLE X-linked sideroblastic anemia and ataxia: a new family with
identification of a fourth ABCB7 gene mutation
JOURNAL Eur. J. Paediatr. Neurol. 16 (6), 730-735 (2012)
PUBMED 22398176
REMARK GeneRIF: We describe a fourth family with X-linked sideroblastic
anemia and ataxia and a novel mutation in the ABCB7 gene
REFERENCE 3 (bases 1 to 2525)
AUTHORS Sato,K., Torimoto,Y., Hosoki,T., Ikuta,K., Takahashi,H.,
Yamamoto,M., Ito,S., Okamura,N., Ichiki,K., Tanaka,H., Shindo,M.,
Hirai,K., Mizukami,Y., Otake,T., Fujiya,M., Sasaki,K. and Kohgo,Y.
TITLE Loss of ABCB7 gene: pathogenesis of mitochondrial iron accumulation
in erythroblasts in refractory anemia with ringed sideroblast with
isodicentric (X)(q13)
JOURNAL Int. J. Hematol. 93 (3), 311-318 (2011)
PUBMED 21380928
REMARK GeneRIF: loss of the ABCB7 gene may be a pathogenetic factor
underlying mitochondrial iron accumulation in RARS patients with
idicXq13.
REFERENCE 4 (bases 1 to 2525)
AUTHORS Boultwood,J., Pellagatti,A., Nikpour,M., Pushkaran,B., Fidler,C.,
Cattan,H., Littlewood,T.J., Malcovati,L., Della Porta,M.G.,
Jadersten,M., Killick,S., Giagounidis,A., Bowen,D.,
Hellstrom-Lindberg,E., Cazzola,M. and Wainscoat,J.S.
TITLE The role of the iron transporter ABCB7 in refractory anemia with
ring sideroblasts
JOURNAL PLoS ONE 3 (4), E1970 (2008)
PUBMED 18398482
REMARK GeneRIF: ABCB7 may have a role in refractory anemia with ring
sideroblasts
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 2525)
AUTHORS Taketani,S., Kakimoto,K., Ueta,H., Masaki,R. and Furukawa,T.
TITLE Involvement of ABC7 in the biosynthesis of heme in erythroid cells:
interaction of ABC7 with ferrochelatase
JOURNAL Blood 101 (8), 3274-3280 (2003)
PUBMED 12480705
REFERENCE 6 (bases 1 to 2525)
AUTHORS Allikmets,R., Raskind,W.H., Hutchinson,A., Schueck,N.D., Dean,M.
and Koeller,D.M.
TITLE Mutation of a putative mitochondrial iron transporter gene (ABC7)
in X-linked sideroblastic anemia and ataxia (XLSA/A)
JOURNAL Hum. Mol. Genet. 8 (5), 743-749 (1999)
PUBMED 10196363
REFERENCE 7 (bases 1 to 2525)
AUTHORS Csere,P., Lill,R. and Kispal,G.
TITLE Identification of a human mitochondrial ABC transporter, the
functional orthologue of yeast Atm1p
JOURNAL FEBS Lett. 441 (2), 266-270 (1998)
PUBMED 9883897
REFERENCE 8 (bases 1 to 2525)
AUTHORS Shimada,Y., Okuno,S., Kawai,A., Shinomiya,H., Saito,A., Suzuki,M.,
Omori,Y., Nishino,N., Kanemoto,N., Fujiwara,T., Horie,M. and
Takahashi,E.
TITLE Cloning and chromosomal mapping of a novel ABC transporter gene
(hABC7), a candidate for X-linked sideroblastic anemia with
spinocerebellar ataxia
JOURNAL J. Hum. Genet. 43 (2), 115-122 (1998)
PUBMED 9621516
REFERENCE 9 (bases 1 to 2525)
AUTHORS Savary,S., Allikmets,R., Denizot,F., Luciani,M.F., Mattei,M.G.,
Dean,M. and Chimini,G.
TITLE Isolation and chromosomal mapping of a novel ATP-binding cassette
transporter conserved in mouse and human
JOURNAL Genomics 41 (2), 275-278 (1997)
PUBMED 9143506
REFERENCE 10 (bases 1 to 2525)
AUTHORS Allikmets,R., Gerrard,B., Hutchinson,A. and Dean,M.
TITLE Characterization of the human ABC superfamily: isolation and
mapping of 21 new genes using the expressed sequence tags database
JOURNAL Hum. Mol. Genet. 5 (10), 1649-1655 (1996)
PUBMED 8894702
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from BP228998.1, AF133659.1 and
CN411218.1.
Summary: The membrane-associated protein encoded by this gene is a
member of the superfamily of ATP-binding cassette (ABC)
transporters. ABC proteins transport various molecules across
extra- and intra-cellular membranes. ABC genes are divided into
seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20,
White). This protein is a member of the MDR/TAP subfamily. Members
of the MDR/TAP subfamily are involved in multidrug resistance as
well as antigen presentation. This gene encodes a half-transporter
involved in the transport of heme from the mitochondria to the
cytosol. With iron/sulfur cluster precursors as its substrates,
this protein may play a role in metal homeostasis. Mutations in
this gene have been associated with mitochondrial iron accumulation
and isodicentric (X)(q13) and sideroblastic anemia. Alternatively
spliced transcript variants encoding multiple isoforms have been
observed for this gene. [provided by RefSeq, Nov 2012].
Transcript Variant: This variant (2) uses an alternate in-frame
splice site in the 5' coding region, compared to variant 1. This
results in a shorter protein (isoform 2), compared to isoform 1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AF038950.1, AF133659.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025088 [ECO:0000348]
##Evidence-Data-END##
##RefSeq-Attributes-START##
gene product(s) localized to mito. :: inferred from homology
##RefSeq-Attributes-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-68 BP228998.1 1-68
69-2413 AF133659.1 1-2345
2414-2479 CN411218.1 462-527
2480-2515 CN411218.1 529-564
2516-2525 CN411218.1 567-576
FEATURES Location/Qualifiers
source 1..2525
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="X"
/map="Xq13.3"
gene 1..2525
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/note="ATP-binding cassette, sub-family B (MDR/TAP),
member 7"
/db_xref="GeneID:22"
/db_xref="HGNC:48"
/db_xref="MIM:300135"
exon 1..236
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="alignment:Splign:1.39.8"
CDS 69..2327
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/note="isoform 2 is encoded by transcript variant 2;
ATP-binding cassette sub-family B member 7, mitochondrial;
ABC transporter 7 protein; ATP-binding cassette
transporter 7"
/codon_start=1
/product="ATP-binding cassette sub-family B member 7,
mitochondrial isoform 2"
/protein_id="NP_001258625.1"
/db_xref="GI:411147363"
/db_xref="GeneID:22"
/db_xref="HGNC:48"
/db_xref="MIM:300135"
/translation="
MALLAMHSWRWAAAAAAFEKRRHSAILIRPLVSVSGSGPQWRPHQLGALGTARAYQIPESLKSITWQRLGKGNSGQFLDAAKALQVWPLIEKRTCWHGHAGGGLHTDPKEGLKDVDTRKIIKAMLSYVWPKDRPDLRARVAISLGFLGGAKAMNIVVPFMFKYAVDSLNQMSGNMLNLSDAPNTVATMATAVLIGYGVSRAGAAFFNEVRNAVFGKVAQNSIRRIAKNVFLHLHNLDLGFHLSRQTGALSKAIDRGTRGISFVLSALVFNLLPIMFEVMLVSGVLYYKCGAQFALVTLGTLGTYTAFTVAVTRWRTRFRIEMNKADNDAGNAAIDSLLNYETVKYFNNERYEAQRYDGFLKTYETASLKSTSTLAMLNFGQSAIFSVGLTAIMVLASQGIVAGTLTVGDLVMVNGLLFQLSLPLNFLGTVYRETRQALIDMNTLFTLLKVDTQIKDKVMASPLQITPQTATVAFDNVHFEYIEGQKVLSGISFEVPAGKKVAIVGGSGSGKSTIVRLLFRFYEPQKGSIYLAGQNIQDVSLESLRRAVGVVPQDAVLFHNTIYYNLLYGNISASPEEVYAVAKLAGLHDAILRMPHGYDTQVGERGLKLSGGEKQRVAIARAILKDPPVILYDEATSSLDSITEETILGAMKDVVKHRTSIFIAHRLSTVVDADEIIVLDQGKVAERGTHHGLLANPHSIYSEMWHTQSSRVQNHDNPKWEAKKENISKEEERKKLQEEIVNSVKGCGNCSC
"
misc_feature 486..1301
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/note="ABC transporter transmembrane region; Region:
ABC_membrane; pfam00664"
/db_xref="CDD:201380"
misc_feature 489..551
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (O75027.2);
transmembrane region"
misc_feature 624..686
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (O75027.2);
transmembrane region"
misc_feature 696..2183
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/note="ABC-type transport system involved in Fe-S cluster
assembly, permease and ATPase components
[Posttranslational modification, protein turnover,
chaperones]; Region: ATM1; COG5265"
/db_xref="CDD:34862"
misc_feature 714..716
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (O75027.2); acetylation site"
misc_feature 819..821
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (O75027.2); acetylation site"
misc_feature 846..908
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (O75027.2);
transmembrane region"
misc_feature 939..1001
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (O75027.2);
transmembrane region"
misc_feature 1215..1277
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (O75027.2);
transmembrane region"
misc_feature 1296..1358
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (O75027.2);
transmembrane region"
misc_feature 1482..2192
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/note="ATP-binding cassette domain of iron-sulfur clusters
transporter, subfamily C; Region: ABCC_ATM1_transporter;
cd03253"
/db_xref="CDD:213220"
misc_feature 1581..1604
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/note="Walker A/P-loop; other site"
/db_xref="CDD:213220"
misc_feature order(1590..1595,1599..1607,1725..1727,1965..1970,
2061..2063)
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:213220"
misc_feature 1716..1727
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/note="Q-loop/lid; other site"
/db_xref="CDD:213220"
misc_feature 1893..1922
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/note="ABC transporter signature motif; other site"
/db_xref="CDD:213220"
misc_feature 1953..1970
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/note="Walker B; other site"
/db_xref="CDD:213220"
misc_feature 1977..1988
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/note="D-loop; other site"
/db_xref="CDD:213220"
misc_feature 2049..2069
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/note="H-loop/switch region; other site"
/db_xref="CDD:213220"
exon 237..314
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="alignment:Splign:1.39.8"
exon 315..401
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="alignment:Splign:1.39.8"
exon 402..521
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="alignment:Splign:1.39.8"
exon 522..654
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="alignment:Splign:1.39.8"
exon 655..923
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="alignment:Splign:1.39.8"
variation 841
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/replace="a"
/replace="g"
/db_xref="dbSNP:1054913"
variation 880
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/replace="c"
/replace="t"
/db_xref="dbSNP:1054914"
exon 924..1012
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="alignment:Splign:1.39.8"
variation 936
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/replace="g"
/replace="t"
/db_xref="dbSNP:1133577"
exon 1013..1100
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="alignment:Splign:1.39.8"
variation 1026
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1133578"
variation 1028
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/replace="a"
/replace="g"
/db_xref="dbSNP:1133579"
exon 1101..1275
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="alignment:Splign:1.39.8"
variation 1145
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/replace="c"
/replace="t"
/db_xref="dbSNP:1054919"
exon 1276..1433
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="alignment:Splign:1.39.8"
exon 1434..1597
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="alignment:Splign:1.39.8"
exon 1598..1727
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="alignment:Splign:1.39.8"
exon 1728..1899
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="alignment:Splign:1.39.8"
variation 1807
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/replace="c"
/replace="t"
/db_xref="dbSNP:1340989"
variation 1808
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/replace="a"
/replace="g"
/db_xref="dbSNP:1340990"
exon 1900..2003
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="alignment:Splign:1.39.8"
exon 2004..2111
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="alignment:Splign:1.39.8"
exon 2112..2525
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/inference="alignment:Splign:1.39.8"
STS 2282..2398
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/standard_name="WI-11286"
/db_xref="UniSTS:60847"
polyA_signal 2395..2400
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
polyA_site 2427
/gene="ABCB7"
/gene_synonym="ABC7; ASAT; Atm1p; EST140535"
/note="The 3' most polyA site has not been determined.
This represents a 5' major polyA site."
ORIGIN
aggtagccgaattcagtccgccagtgtcccataatcctcttctctcggttcctctttcctcgctcaagatggcgctgctcgcgatgcattcttggcgctgggcggccgcggcggctgctttcgaaaagcgccggcactccgcgattctgatccggcctttagtctctgttagcggctcaggtccgcagtggaggccacatcaactcggcgccttgggaaccgctcgagcctaccagattccagagtcattaaaaagtatcacatggcagagattgggaaaaggcaattcaggacagttcttagatgctgcaaaggctctccaggtatggccactgatagaaaagaggacatgttggcatggtcatgcaggaggaggactccacacagacccaaaagaagggttaaaagatgttgatactcggaaaatcataaaagcaatgctttcttatgtgtggcccaaagacaggccagatctacgagctagagttgccatttcgctgggatttttgggtggtgcaaaggccatgaatattgtggttcccttcatgtttaaatatgctgtagacagcctcaaccagatgtcgggaaacatgctgaacctgagtgatgcaccaaatacagttgcaaccatggcaacagcagttctgattggctatggtgtatcaagagctggagctgctttttttaacgaagttcgaaatgcagtatttggcaaggtagcccagaattcaatccgaagaatagccaaaaatgtctttctccatcttcacaacctggatctgggttttcacctgagcagacagacgggagctttatctaaggctattgacagaggaacaaggggtatcagttttgtcctgagtgctttggtatttaatcttcttcccatcatgtttgaagtgatgcttgtcagtggtgttttgtattacaaatgcggtgcccagtttgctttggtaacccttggaacacttggtacatacacagcattcacagttgcagtcacacggtggagaactagatttagaatagaaatgaacaaagcagataatgatgcaggtaatgctgctatagactcactgctgaattatgaaactgtgaagtattttaataatgaaagatatgaagcacagagatatgatggatttttgaagacgtatgagactgcttcattgaaaagtacctctactctggctatgctgaactttggtcaaagtgctattttcagtgtcggtttaacagctataatggtgctcgccagtcagggaattgtggcaggtacccttactgttggagatctagtaatggtgaatggactgctttttcagctttcattacccctgaactttctgggaactgtatatagagagactagacaagcactcatagatatgaacaccttgtttactctactcaaggtagacacccaaattaaagacaaagtgatggcatctccccttcagatcacaccacagacagctaccgtggcctttgataatgtgcattttgaatacattgagggccagaaagtccttagtggaatatcctttgaagtccctgcaggaaagaaagtggccattgtaggaggtagtgggtcagggaaaagcacaatagtgaggctattatttcgcttctatgagcctcaaaagggtagcatttatcttgctggtcaaaatatacaagatgtgagcctggaaagccttcggagggcagtgggagtggtacctcaggatgctgtcctcttccataatactatttattacaacctcttatatggaaacatcagtgcttcacctgaggaagtgtatgcagtggcaaaattagctggacttcatgatgcaattcttcgaatgccacatggatatgacacccaagtaggggaacgaggactcaagctttcaggaggagaaaagcaaagagtagcaattgcaagagccattttgaaggaccccccagtcatactctatgatgaagctacttcatcgttagattcgattactgaagagactattcttggtgccatgaaggatgtggtcaaacacagaacttctattttcattgcacacagattgtcaacagtggttgatgcagatgaaatcattgtcttggatcagggtaaggtagccgaacgtggtacccaccatggtttgcttgctaaccctcatagtatctattcagaaatgtggcatacacagagcagccgtgtgcagaaccatgataaccccaaatgggaagcaaagaaagaaaatatatccaaagaggaggaaagaaagaaactacaagaagaaattgtcaatagtgtgaaaggctgtggaaactgttcgtgctaagtcacataagacattttctttttttgttgttttggactacatatttgcactgaagcagaattgttttattaaaaaaatcatacattcccattttctataatccttcttttagataagatttatttaaaaggggatttgagttttacatctttcatagtctatttaatgtggcatctgtatttatccccaaattatttt
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:22 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:22 -> Molecular function: GO:0015232 [heme transporter activity] evidence: TAS
GeneID:22 -> Molecular function: GO:0042626 [ATPase activity, coupled to transmembrane movement of substances] evidence: IBA
GeneID:22 -> Biological process: GO:0006810 [transport] evidence: TAS
GeneID:22 -> Biological process: GO:0006879 [cellular iron ion homeostasis] evidence: IBA
GeneID:22 -> Biological process: GO:0015886 [heme transport] evidence: TAS
GeneID:22 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
GeneID:22 -> Biological process: GO:0055085 [transmembrane transport] evidence: IBA
GeneID:22 -> Biological process: GO:0055085 [transmembrane transport] evidence: TAS
GeneID:22 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:22 -> Cellular component: GO:0005739 [mitochondrion] evidence: IDA
GeneID:22 -> Cellular component: GO:0005743 [mitochondrial inner membrane] evidence: IDA
GeneID:22 -> Cellular component: GO:0005743 [mitochondrial inner membrane] evidence: TAS
GeneID:22 -> Cellular component: GO:0016021 [integral to membrane] evidence: IBA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.