GGRNA Home | Help | Advanced search

2025-09-18 04:57:04, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001271696            2525 bp    mRNA    linear   PRI 07-JUL-2013
DEFINITION  Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7
            (ABCB7), transcript variant 2, mRNA.
ACCESSION   NM_001271696
VERSION     NM_001271696.1  GI:411147362
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2525)
  AUTHORS   Nikpour,M., Scharenberg,C., Liu,A., Conte,S., Karimi,M.,
            Mortera-Blanco,T., Giai,V., Fernandez-Mercado,M., Papaemmanuil,E.,
            Hogstrand,K., Jansson,M., Vedin,I., Stephen Wainscoat,J.,
            Campbell,P., Cazzola,M., Boultwood,J., Grandien,A. and
            Hellstrom-Lindberg,E.
  TITLE     The transporter ABCB7 is a mediator of the phenotype of acquired
            refractory anemia with ring sideroblasts
  JOURNAL   Leukemia 27 (4), 889-896 (2013)
   PUBMED   23070040
  REMARK    GeneRIF: findings support that ABCB7 is implicated in the phenotype
            of acquired RARS and suggest a relation between SF3B1 mutations and
            ABCB7 downregulation
REFERENCE   2  (bases 1 to 2525)
  AUTHORS   D'Hooghe,M., Selleslag,D., Mortier,G., Van Coster,R.,
            Vermeersch,P., Billiet,J. and Bekri,S.
  TITLE     X-linked sideroblastic anemia and ataxia: a new family with
            identification of a fourth ABCB7 gene mutation
  JOURNAL   Eur. J. Paediatr. Neurol. 16 (6), 730-735 (2012)
   PUBMED   22398176
  REMARK    GeneRIF: We describe a fourth family with X-linked sideroblastic
            anemia and ataxia and a novel mutation in the ABCB7 gene
REFERENCE   3  (bases 1 to 2525)
  AUTHORS   Sato,K., Torimoto,Y., Hosoki,T., Ikuta,K., Takahashi,H.,
            Yamamoto,M., Ito,S., Okamura,N., Ichiki,K., Tanaka,H., Shindo,M.,
            Hirai,K., Mizukami,Y., Otake,T., Fujiya,M., Sasaki,K. and Kohgo,Y.
  TITLE     Loss of ABCB7 gene: pathogenesis of mitochondrial iron accumulation
            in erythroblasts in refractory anemia with ringed sideroblast with
            isodicentric (X)(q13)
  JOURNAL   Int. J. Hematol. 93 (3), 311-318 (2011)
   PUBMED   21380928
  REMARK    GeneRIF: loss of the ABCB7 gene may be a pathogenetic factor
            underlying mitochondrial iron accumulation in RARS patients with
            idicXq13.
REFERENCE   4  (bases 1 to 2525)
  AUTHORS   Boultwood,J., Pellagatti,A., Nikpour,M., Pushkaran,B., Fidler,C.,
            Cattan,H., Littlewood,T.J., Malcovati,L., Della Porta,M.G.,
            Jadersten,M., Killick,S., Giagounidis,A., Bowen,D.,
            Hellstrom-Lindberg,E., Cazzola,M. and Wainscoat,J.S.
  TITLE     The role of the iron transporter ABCB7 in refractory anemia with
            ring sideroblasts
  JOURNAL   PLoS ONE 3 (4), E1970 (2008)
   PUBMED   18398482
  REMARK    GeneRIF: ABCB7 may have a role in refractory anemia with ring
            sideroblasts
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 2525)
  AUTHORS   Taketani,S., Kakimoto,K., Ueta,H., Masaki,R. and Furukawa,T.
  TITLE     Involvement of ABC7 in the biosynthesis of heme in erythroid cells:
            interaction of ABC7 with ferrochelatase
  JOURNAL   Blood 101 (8), 3274-3280 (2003)
   PUBMED   12480705
REFERENCE   6  (bases 1 to 2525)
  AUTHORS   Allikmets,R., Raskind,W.H., Hutchinson,A., Schueck,N.D., Dean,M.
            and Koeller,D.M.
  TITLE     Mutation of a putative mitochondrial iron transporter gene (ABC7)
            in X-linked sideroblastic anemia and ataxia (XLSA/A)
  JOURNAL   Hum. Mol. Genet. 8 (5), 743-749 (1999)
   PUBMED   10196363
REFERENCE   7  (bases 1 to 2525)
  AUTHORS   Csere,P., Lill,R. and Kispal,G.
  TITLE     Identification of a human mitochondrial ABC transporter, the
            functional orthologue of yeast Atm1p
  JOURNAL   FEBS Lett. 441 (2), 266-270 (1998)
   PUBMED   9883897
REFERENCE   8  (bases 1 to 2525)
  AUTHORS   Shimada,Y., Okuno,S., Kawai,A., Shinomiya,H., Saito,A., Suzuki,M.,
            Omori,Y., Nishino,N., Kanemoto,N., Fujiwara,T., Horie,M. and
            Takahashi,E.
  TITLE     Cloning and chromosomal mapping of a novel ABC transporter gene
            (hABC7), a candidate for X-linked sideroblastic anemia with
            spinocerebellar ataxia
  JOURNAL   J. Hum. Genet. 43 (2), 115-122 (1998)
   PUBMED   9621516
REFERENCE   9  (bases 1 to 2525)
  AUTHORS   Savary,S., Allikmets,R., Denizot,F., Luciani,M.F., Mattei,M.G.,
            Dean,M. and Chimini,G.
  TITLE     Isolation and chromosomal mapping of a novel ATP-binding cassette
            transporter conserved in mouse and human
  JOURNAL   Genomics 41 (2), 275-278 (1997)
   PUBMED   9143506
REFERENCE   10 (bases 1 to 2525)
  AUTHORS   Allikmets,R., Gerrard,B., Hutchinson,A. and Dean,M.
  TITLE     Characterization of the human ABC superfamily: isolation and
            mapping of 21 new genes using the expressed sequence tags database
  JOURNAL   Hum. Mol. Genet. 5 (10), 1649-1655 (1996)
   PUBMED   8894702
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BP228998.1, AF133659.1 and
            CN411218.1.
            
            Summary: The membrane-associated protein encoded by this gene is a
            member of the superfamily of ATP-binding cassette (ABC)
            transporters. ABC proteins transport various molecules across
            extra- and intra-cellular membranes. ABC genes are divided into
            seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20,
            White). This protein is a member of the MDR/TAP subfamily. Members
            of the MDR/TAP subfamily are involved in multidrug resistance as
            well as antigen presentation. This gene encodes a half-transporter
            involved in the transport of heme from the mitochondria to the
            cytosol. With iron/sulfur cluster precursors as its substrates,
            this protein may play a role in metal homeostasis. Mutations in
            this gene have been associated with mitochondrial iron accumulation
            and isodicentric (X)(q13) and sideroblastic anemia. Alternatively
            spliced transcript variants encoding multiple isoforms have been
            observed for this gene. [provided by RefSeq, Nov 2012].
            
            Transcript Variant: This variant (2) uses an alternate in-frame
            splice site in the 5' coding region, compared to variant 1. This
            results in a shorter protein (isoform 2), compared to isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF038950.1, AF133659.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            gene product(s) localized to mito. :: inferred from homology
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-68                BP228998.1         1-68
            69-2413             AF133659.1         1-2345
            2414-2479           CN411218.1         462-527
            2480-2515           CN411218.1         529-564
            2516-2525           CN411218.1         567-576
FEATURES             Location/Qualifiers
     source          1..2525
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
                     /map="Xq13.3"
     gene            1..2525
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /note="ATP-binding cassette, sub-family B (MDR/TAP),
                     member 7"
                     /db_xref="GeneID:22"
                     /db_xref="HGNC:48"
                     /db_xref="MIM:300135"
     exon            1..236
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="alignment:Splign:1.39.8"
     CDS             69..2327
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /note="isoform 2 is encoded by transcript variant 2;
                     ATP-binding cassette sub-family B member 7, mitochondrial;
                     ABC transporter 7 protein; ATP-binding cassette
                     transporter 7"
                     /codon_start=1
                     /product="ATP-binding cassette sub-family B member 7,
                     mitochondrial isoform 2"
                     /protein_id="NP_001258625.1"
                     /db_xref="GI:411147363"
                     /db_xref="GeneID:22"
                     /db_xref="HGNC:48"
                     /db_xref="MIM:300135"
                     /translation="
MALLAMHSWRWAAAAAAFEKRRHSAILIRPLVSVSGSGPQWRPHQLGALGTARAYQIPESLKSITWQRLGKGNSGQFLDAAKALQVWPLIEKRTCWHGHAGGGLHTDPKEGLKDVDTRKIIKAMLSYVWPKDRPDLRARVAISLGFLGGAKAMNIVVPFMFKYAVDSLNQMSGNMLNLSDAPNTVATMATAVLIGYGVSRAGAAFFNEVRNAVFGKVAQNSIRRIAKNVFLHLHNLDLGFHLSRQTGALSKAIDRGTRGISFVLSALVFNLLPIMFEVMLVSGVLYYKCGAQFALVTLGTLGTYTAFTVAVTRWRTRFRIEMNKADNDAGNAAIDSLLNYETVKYFNNERYEAQRYDGFLKTYETASLKSTSTLAMLNFGQSAIFSVGLTAIMVLASQGIVAGTLTVGDLVMVNGLLFQLSLPLNFLGTVYRETRQALIDMNTLFTLLKVDTQIKDKVMASPLQITPQTATVAFDNVHFEYIEGQKVLSGISFEVPAGKKVAIVGGSGSGKSTIVRLLFRFYEPQKGSIYLAGQNIQDVSLESLRRAVGVVPQDAVLFHNTIYYNLLYGNISASPEEVYAVAKLAGLHDAILRMPHGYDTQVGERGLKLSGGEKQRVAIARAILKDPPVILYDEATSSLDSITEETILGAMKDVVKHRTSIFIAHRLSTVVDADEIIVLDQGKVAERGTHHGLLANPHSIYSEMWHTQSSRVQNHDNPKWEAKKENISKEEERKKLQEEIVNSVKGCGNCSC
"
     misc_feature    486..1301
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /note="ABC transporter transmembrane region; Region:
                     ABC_membrane; pfam00664"
                     /db_xref="CDD:201380"
     misc_feature    489..551
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O75027.2);
                     transmembrane region"
     misc_feature    624..686
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O75027.2);
                     transmembrane region"
     misc_feature    696..2183
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /note="ABC-type transport system involved in Fe-S cluster
                     assembly, permease and ATPase components
                     [Posttranslational modification, protein turnover,
                     chaperones]; Region: ATM1; COG5265"
                     /db_xref="CDD:34862"
     misc_feature    714..716
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine; propagated from
                     UniProtKB/Swiss-Prot (O75027.2); acetylation site"
     misc_feature    819..821
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine; propagated from
                     UniProtKB/Swiss-Prot (O75027.2); acetylation site"
     misc_feature    846..908
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O75027.2);
                     transmembrane region"
     misc_feature    939..1001
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O75027.2);
                     transmembrane region"
     misc_feature    1215..1277
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O75027.2);
                     transmembrane region"
     misc_feature    1296..1358
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O75027.2);
                     transmembrane region"
     misc_feature    1482..2192
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /note="ATP-binding cassette domain of iron-sulfur clusters
                     transporter, subfamily C; Region: ABCC_ATM1_transporter;
                     cd03253"
                     /db_xref="CDD:213220"
     misc_feature    1581..1604
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /note="Walker A/P-loop; other site"
                     /db_xref="CDD:213220"
     misc_feature    order(1590..1595,1599..1607,1725..1727,1965..1970,
                     2061..2063)
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:213220"
     misc_feature    1716..1727
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /note="Q-loop/lid; other site"
                     /db_xref="CDD:213220"
     misc_feature    1893..1922
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /note="ABC transporter signature motif; other site"
                     /db_xref="CDD:213220"
     misc_feature    1953..1970
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /note="Walker B; other site"
                     /db_xref="CDD:213220"
     misc_feature    1977..1988
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /note="D-loop; other site"
                     /db_xref="CDD:213220"
     misc_feature    2049..2069
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /note="H-loop/switch region; other site"
                     /db_xref="CDD:213220"
     exon            237..314
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="alignment:Splign:1.39.8"
     exon            315..401
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="alignment:Splign:1.39.8"
     exon            402..521
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="alignment:Splign:1.39.8"
     exon            522..654
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="alignment:Splign:1.39.8"
     exon            655..923
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="alignment:Splign:1.39.8"
     variation       841
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054913"
     variation       880
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054914"
     exon            924..1012
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="alignment:Splign:1.39.8"
     variation       936
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1133577"
     exon            1013..1100
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="alignment:Splign:1.39.8"
     variation       1026
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1133578"
     variation       1028
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1133579"
     exon            1101..1275
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="alignment:Splign:1.39.8"
     variation       1145
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054919"
     exon            1276..1433
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="alignment:Splign:1.39.8"
     exon            1434..1597
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="alignment:Splign:1.39.8"
     exon            1598..1727
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="alignment:Splign:1.39.8"
     exon            1728..1899
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="alignment:Splign:1.39.8"
     variation       1807
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1340989"
     variation       1808
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340990"
     exon            1900..2003
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="alignment:Splign:1.39.8"
     exon            2004..2111
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="alignment:Splign:1.39.8"
     exon            2112..2525
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /inference="alignment:Splign:1.39.8"
     STS             2282..2398
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /standard_name="WI-11286"
                     /db_xref="UniSTS:60847"
     polyA_signal    2395..2400
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
     polyA_site      2427
                     /gene="ABCB7"
                     /gene_synonym="ABC7; ASAT; Atm1p; EST140535"
                     /note="The 3' most polyA site has not been determined.
                     This represents a 5' major polyA site."
ORIGIN      
aggtagccgaattcagtccgccagtgtcccataatcctcttctctcggttcctctttcctcgctcaagatggcgctgctcgcgatgcattcttggcgctgggcggccgcggcggctgctttcgaaaagcgccggcactccgcgattctgatccggcctttagtctctgttagcggctcaggtccgcagtggaggccacatcaactcggcgccttgggaaccgctcgagcctaccagattccagagtcattaaaaagtatcacatggcagagattgggaaaaggcaattcaggacagttcttagatgctgcaaaggctctccaggtatggccactgatagaaaagaggacatgttggcatggtcatgcaggaggaggactccacacagacccaaaagaagggttaaaagatgttgatactcggaaaatcataaaagcaatgctttcttatgtgtggcccaaagacaggccagatctacgagctagagttgccatttcgctgggatttttgggtggtgcaaaggccatgaatattgtggttcccttcatgtttaaatatgctgtagacagcctcaaccagatgtcgggaaacatgctgaacctgagtgatgcaccaaatacagttgcaaccatggcaacagcagttctgattggctatggtgtatcaagagctggagctgctttttttaacgaagttcgaaatgcagtatttggcaaggtagcccagaattcaatccgaagaatagccaaaaatgtctttctccatcttcacaacctggatctgggttttcacctgagcagacagacgggagctttatctaaggctattgacagaggaacaaggggtatcagttttgtcctgagtgctttggtatttaatcttcttcccatcatgtttgaagtgatgcttgtcagtggtgttttgtattacaaatgcggtgcccagtttgctttggtaacccttggaacacttggtacatacacagcattcacagttgcagtcacacggtggagaactagatttagaatagaaatgaacaaagcagataatgatgcaggtaatgctgctatagactcactgctgaattatgaaactgtgaagtattttaataatgaaagatatgaagcacagagatatgatggatttttgaagacgtatgagactgcttcattgaaaagtacctctactctggctatgctgaactttggtcaaagtgctattttcagtgtcggtttaacagctataatggtgctcgccagtcagggaattgtggcaggtacccttactgttggagatctagtaatggtgaatggactgctttttcagctttcattacccctgaactttctgggaactgtatatagagagactagacaagcactcatagatatgaacaccttgtttactctactcaaggtagacacccaaattaaagacaaagtgatggcatctccccttcagatcacaccacagacagctaccgtggcctttgataatgtgcattttgaatacattgagggccagaaagtccttagtggaatatcctttgaagtccctgcaggaaagaaagtggccattgtaggaggtagtgggtcagggaaaagcacaatagtgaggctattatttcgcttctatgagcctcaaaagggtagcatttatcttgctggtcaaaatatacaagatgtgagcctggaaagccttcggagggcagtgggagtggtacctcaggatgctgtcctcttccataatactatttattacaacctcttatatggaaacatcagtgcttcacctgaggaagtgtatgcagtggcaaaattagctggacttcatgatgcaattcttcgaatgccacatggatatgacacccaagtaggggaacgaggactcaagctttcaggaggagaaaagcaaagagtagcaattgcaagagccattttgaaggaccccccagtcatactctatgatgaagctacttcatcgttagattcgattactgaagagactattcttggtgccatgaaggatgtggtcaaacacagaacttctattttcattgcacacagattgtcaacagtggttgatgcagatgaaatcattgtcttggatcagggtaaggtagccgaacgtggtacccaccatggtttgcttgctaaccctcatagtatctattcagaaatgtggcatacacagagcagccgtgtgcagaaccatgataaccccaaatgggaagcaaagaaagaaaatatatccaaagaggaggaaagaaagaaactacaagaagaaattgtcaatagtgtgaaaggctgtggaaactgttcgtgctaagtcacataagacattttctttttttgttgttttggactacatatttgcactgaagcagaattgttttattaaaaaaatcatacattcccattttctataatccttcttttagataagatttatttaaaaggggatttgagttttacatctttcatagtctatttaatgtggcatctgtatttatccccaaattatttt
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:22 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:22 -> Molecular function: GO:0015232 [heme transporter activity] evidence: TAS
            GeneID:22 -> Molecular function: GO:0042626 [ATPase activity, coupled to transmembrane movement of substances] evidence: IBA
            GeneID:22 -> Biological process: GO:0006810 [transport] evidence: TAS
            GeneID:22 -> Biological process: GO:0006879 [cellular iron ion homeostasis] evidence: IBA
            GeneID:22 -> Biological process: GO:0015886 [heme transport] evidence: TAS
            GeneID:22 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
            GeneID:22 -> Biological process: GO:0055085 [transmembrane transport] evidence: IBA
            GeneID:22 -> Biological process: GO:0055085 [transmembrane transport] evidence: TAS
            GeneID:22 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:22 -> Cellular component: GO:0005739 [mitochondrion] evidence: IDA
            GeneID:22 -> Cellular component: GO:0005743 [mitochondrial inner membrane] evidence: IDA
            GeneID:22 -> Cellular component: GO:0005743 [mitochondrial inner membrane] evidence: TAS
            GeneID:22 -> Cellular component: GO:0016021 [integral to membrane] evidence: IBA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.