2025-09-17 00:47:03, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_052931 2751 bp mRNA linear PRI 07-JUL-2013 DEFINITION Homo sapiens SLAM family member 6 (SLAMF6), transcript variant 2, mRNA. ACCESSION NM_052931 VERSION NM_052931.4 GI:296040489 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2751) AUTHORS Bolduan,S., Hubel,P., Reif,T., Lodermeyer,V., Hohne,K., Fritz,J.V., Sauter,D., Kirchhoff,F., Fackler,O.T., Schindler,M. and Schubert,U. TITLE HIV-1 Vpu affects the anterograde transport and the glycosylation pattern of NTB-A JOURNAL Virology 440 (2), 190-203 (2013) PUBMED 23528733 REMARK GeneRIF: Together, these results suggest that the reduction of NTB-A from the cell surface is associated with the Vpu-mediated effect on the glycosylation pattern of newly synthesized NTB-A molecules. REFERENCE 2 (bases 1 to 2751) AUTHORS Chatterjee,M., Hedrich,C.M., Rauen,T., Ioannidis,C., Terhorst,C. and Tsokos,G.C. TITLE CD3-T cell receptor co-stimulation through SLAMF3 and SLAMF6 receptors enhances RORgammat recruitment to the IL17A promoter in human T lymphocytes JOURNAL J. Biol. Chem. 287 (45), 38168-38177 (2012) PUBMED 22989874 REMARK GeneRIF: Data indicate that the dominance of the SLAMF3/SLAMF6 pathway in inducing IL-17A production can be attributed to an increased nuclear abundance and recruitment of RORgammat to the IL17A promoter. REFERENCE 3 (bases 1 to 2751) AUTHORS Chatterjee,M., Rauen,T., Kis-Toth,K., Kyttaris,V.C., Hedrich,C.M., Terhorst,C. and Tsokos,G.C. TITLE Increased expression of SLAM receptors SLAMF3 and SLAMF6 in systemic lupus erythematosus T lymphocytes promotes Th17 differentiation JOURNAL J. Immunol. 188 (3), 1206-1212 (2012) PUBMED 22184727 REMARK GeneRIF: SLAMF3 and SLAMF6 T cell surface expression and IL-17 levels significantly correlate with disease activity in systemic lupus erythematosus patients REFERENCE 4 (bases 1 to 2751) AUTHORS Chatterjee,M., Kis-Toth,K., Thai,T.H., Terhorst,C. and Tsokos,G.C. TITLE SLAMF6-driven co-stimulation of human peripheral T cells is defective in SLE T cells JOURNAL Autoimmunity 44 (3), 211-218 (2011) PUBMED 21231893 REMARK GeneRIF: Although the expression of SLAMF6 on the surface of T cells from patients with systemic lupus erythematosus (SLE) T cells is comparable to that on the normal T cells, engagement of SLAMF6 results in severely reduced Th1 and IL-2 cytokine production REFERENCE 5 (bases 1 to 2751) AUTHORS Shah,A.H., Sowrirajan,B., Davis,Z.B., Ward,J.P., Campbell,E.M., Planelles,V. and Barker,E. TITLE Degranulation of natural killer cells following interaction with HIV-1-infected cells is hindered by downmodulation of NTB-A by Vpu JOURNAL Cell Host Microbe 8 (5), 397-409 (2010) PUBMED 21075351 REMARK GeneRIF: Vpu downmodulation of NTB-A protects the infected cell from lysis by NK cells. REFERENCE 6 (bases 1 to 2751) AUTHORS Fraser,C.C., Howie,D., Morra,M., Qiu,Y., Murphy,C., Shen,Q., Gutierrez-Ramos,J.C., Coyle,A., Kingsbury,G.A. and Terhorst,C. TITLE Identification and characterization of SF2000 and SF2001, two new members of the immune receptor SLAM/CD2 family JOURNAL Immunogenetics 53 (10-11), 843-850 (2002) PUBMED 11862385 REFERENCE 7 (bases 1 to 2751) AUTHORS Bottino,C., Falco,M., Parolini,S., Marcenaro,E., Augugliaro,R., Sivori,S., Landi,E., Biassoni,R., Notarangelo,L.D., Moretta,L. and Moretta,A. TITLE NTB-A [correction of GNTB-A], a novel SH2D1A-associated surface molecule contributing to the inability of natural killer cells to kill Epstein-Barr virus-infected B cells in X-linked lymphoproliferative disease JOURNAL J. Exp. Med. 194 (3), 235-246 (2001) PUBMED 11489943 REMARK Erratum:[J Exp Med 2001 Sep 3;194(5):following 703] REFERENCE 8 (bases 1 to 2751) AUTHORS Lee,Y.J., Luisiri,P. and Clark,M.R. TITLE A novel complex, p40/42, is constitutively associated with the B cell antigen receptor and phosphorylated upon receptor stimulation JOURNAL J. Immunol. 157 (9), 3828-3837 (1996) PUBMED 8892612 REFERENCE 9 (bases 1 to 2751) AUTHORS Kong,G., Dalton,M., Bubeck Wardenburg,J., Straus,D., Kurosaki,T. and Chan,A.C. TITLE Distinct tyrosine phosphorylation sites in ZAP-70 mediate activation and negative regulation of antigen receptor function JOURNAL Mol. Cell. Biol. 16 (9), 5026-5035 (1996) PUBMED 8756661 REFERENCE 10 (bases 1 to 2751) AUTHORS Hercend,T., Meuer,S., Brennan,A., Edson,M.A., Acuto,O., Reinherz,E.L., Schlossman,S.F. and Ritz,J. TITLE Natural killer-like function of activated T lymphocytes: differential blocking effects of monoclonal antibodies specific for a 90-kDa clonotypic structure JOURNAL Cell. Immunol. 86 (2), 381-392 (1984) PUBMED 6610481 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB197632.1, BC113893.1 and AK125624.1. On May 14, 2010 this sequence version replaced gi:38327616. Summary: The protein encoded by this gene is a type I transmembrane protein, belonging to the CD2 subfamily of the immunoglobulin superfamily. This encoded protein is expressed on Natural killer (NK), T, and B lymphocytes. It undergoes tyrosine phosphorylation and associates with the Src homology 2 domain-containing protein (SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs). It functions as a coreceptor in the process of NK cell activation. It can also mediate inhibitory signals in NK cells from X-linked lymphoproliferative patients. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]. Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1, which results in an isoform (2) that is one amino acid shorter than isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK125624.1, AJ277141.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025084, ERS025088 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-43 DB197632.1 1-43 44-1253 BC113893.1 1-1210 1254-2751 AK125624.1 1253-2750 FEATURES Location/Qualifiers source 1..2751 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="1" /map="1q23.2" gene 1..2751 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /note="SLAM family member 6" /db_xref="GeneID:114836" /db_xref="HGNC:21392" /db_xref="HPRD:05920" /db_xref="MIM:606446" exon 1..119 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /inference="alignment:Splign:1.39.8" STS 44..1494 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /db_xref="UniSTS:486452" CDS 71..1066 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /note="isoform 2 precursor is encoded by transcript variant 2; activating NK receptor; natural killer-, T- and B-cell antigen; NTBA receptor; NK-T-B-antigen" /codon_start=1 /product="SLAM family member 6 isoform 2 precursor" /protein_id="NP_443163.1" /db_xref="GI:16418407" /db_xref="CCDS:CCDS1205.1" /db_xref="GeneID:114836" /db_xref="HGNC:21392" /db_xref="HPRD:05920" /db_xref="MIM:606446" /translation="
MLWLFQSLLFVFCFGPGNVVSQSSLTPLMVNGILGESVTLPLEFPAGEKVNFITWLFNETSLAFIVPHETKSPEIHVTNPKQGKRLNFTQSYSLQLSNLKMEDTGSYRAQISTKTSAKLSSYTLRILRQLRNIQVTNHSQLFQNMTCELHLTCSVEDADDNVSFRWEALGNTLSSQPNLTVSWDPRISSEQDYTCIAENAVSNLSFSVSAQKLCEDVKIQYTDTKMILFMVSGICIVFGFIILLLLVLRKRRDSLSLSTQRTQGPESARNLEYVSVSPTNNTVYASVTHSNRETEIWTPRENDTITIYSTINHSKESKPTFSRATALDNVV
" sig_peptide 71..133 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /inference="COORDINATES: ab initio prediction:SignalP:4.0" misc_feature 131..409 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /note="Immunoglobulin V-set domain; Region: V-set; pfam07686" /db_xref="CDD:203725" mat_peptide 134..1063 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /product="SLAM family member 6 isoform 2" misc_feature 164..451 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /note="N-terminal immunoglobulin (Ig)-like domain of the signaling lymphocyte activation molecule (SLAM) family, CD84_like; Region: Ig_SLAM-CD84_like_N; cd05775" /db_xref="CDD:143252" misc_feature order(224..226,230..232,392..394,398..400,404..406) /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /note="dimer interface [polypeptide binding]; other site" /db_xref="CDD:143252" misc_feature 470..667 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:213125" misc_feature 749..811 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q96DU3.3); transmembrane region" misc_feature 887..889 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /experiment="experimental evidence, no additional details recorded" /note="Phosphotyrosine; propagated from UniProtKB/Swiss-Prot (Q96DU3.3); phosphorylation site" misc_feature 899..901 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q96DU3.3); phosphorylation site" misc_feature 992..994 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /experiment="experimental evidence, no additional details recorded" /note="Phosphotyrosine; propagated from UniProtKB/Swiss-Prot (Q96DU3.3); phosphorylation site" exon 120..452 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /inference="alignment:Splign:1.39.8" exon 453..716 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /inference="alignment:Splign:1.39.8" variation 556 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:35414223" exon 717..827 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /inference="alignment:Splign:1.39.8" variation 800 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /replace="c" /replace="t" /db_xref="dbSNP:34355503" exon 828..866 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /inference="alignment:Splign:1.39.8" exon 867..946 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /inference="alignment:Splign:1.39.8" exon 947..1018 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /inference="alignment:Splign:1.39.8" exon 1019..2743 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /inference="alignment:Splign:1.39.8" variation 2454 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /replace="a" /replace="t" /db_xref="dbSNP:634791" STS 2487..2655 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /standard_name="G35510" /db_xref="UniSTS:44150" STS 2529..2619 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" /standard_name="D8S2279" /db_xref="UniSTS:473907" polyA_signal 2709..2714 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" polyA_signal 2713..2718 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" polyA_signal 2717..2722 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" polyA_signal 2722..2727 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" polyA_site 2743 /gene="SLAMF6" /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000" ORIGIN
agtttatgacagaagggcaaaaacattgactgcctcaaggtctcaagcaccagtcttcaccgcggaaagcatgttgtggctgttccaatcgctcctgtttgtcttctgctttggcccagggaatgtagtttcacaaagcagcttaaccccattgatggtgaacgggattctgggggagtcagtaactcttcccctggagtttcctgcaggagagaaggtcaacttcatcacttggcttttcaatgaaacatctcttgccttcatagtaccccatgaaaccaaaagtccagaaatccacgtgactaatccgaaacagggaaagcgactgaacttcacccagtcctactccctgcaactcagcaacctgaagatggaagacacaggctcttacagagcccagatatccacaaagacctctgcaaagctgtccagttacactctgaggatattaagacaactgaggaacatacaagttaccaatcacagtcagctatttcagaatatgacctgtgagctccatctgacttgctctgtggaggatgcagatgacaatgtctcattcagatgggaggccttgggaaacacactttcaagtcagccaaacctcactgtctcctgggaccccaggatttccagtgaacaggactacacctgcatagcagagaatgctgtcagtaatttatccttctctgtctctgcccagaagctttgcgaagatgttaaaattcaatatacagataccaaaatgattctgtttatggtttctgggatatgcatagtcttcggtttcatcatactgctgttacttgttttgaggaaaagaagagattccctatctttgtctactcagcgaacacagggccccgagtccgcaaggaacctagagtatgtttcagtgtctccaacgaacaacactgtgtatgcttcagtcactcattcaaacagggaaacagaaatctggacacctagagaaaatgatactatcacaatttactccacaattaatcattccaaagagagtaaacccactttttccagggcaactgcccttgacaatgtcgtgtaagttgctgaaaggcctcagaggaattcgggaatgacacgtcttctgatcccatgagacagaacaaagaacaggaagcttggttcctgttgttcctggcaacagaatttgaatatctaggataggatgatcacctccagtccttcggacttaaacctgcctacctgagtcaaacacctaaggataacatcatttccagcatgtggttcaaataatattttccaatccacttcaggccaaaacatgctaaagataacacaccagcacattgactctctctttgataactaagcaaatggaattatggttgacagagagtttatgatccagaagacaaccacttctctccttttagaaagcagcaggattgacttattgagaaataatgcagtgtgttggttacatgtgtagtctctggagttggatgggcccatcctgatacaagttgagcatcccttgtctgaaatgcttgggattagaaatgtttcagatttcaattttttttcagattttggaatatttgcattatatttagcggttgagtatccaaatccaaaaatccaaaattcaaaatgctccaataagcatttcccttgagtttcattgatgtcgatgcagtgctcaaaatctcagattttggagcattttggatattggatttttggatttgggatgctcaacttgtacaatgtttattagacacatctcctgggacatactgcctaaccttttggagccttagtctcccagactgaaaaaggaagaggatggtattacatcagctccattgtttgagccaagaatctaagtcatccctgactccagtgtctttgtcaccaggccctttggactctacctcagaaatatttcttggaccttccacttctcctccaactccttgaccaccatcctgtatccaaccatcaccacctctaacctgaatcctaccttaagatcagaacagttgtcctcacttttgttcttgtccctctccaacccactctccacaagatggccagagtaatgtttttaatataaattggatccttcagtttcctgcttaaaaccctgcaggtttcccaatgcactcagaaagaaatccagtttccatggccctggatggtctggcccacctccagcctcagctagcattacccttctgacactctctatgtagcctccctgatcttctttcagctcctctattaaaggaaaagttctttatgttaattatttacatcttcctgcaggcccttcctctgcctgctggggtcctcctattctttaggtttaattttaaatatgtcacctcctaagagaaaccttcccagaccactctttctaaaatgaatcttctaggctgggcatggtggctcacacctgtaatccctgtactttgggaggccaaggggggagatcacttgaggtcaggagttcaagaccagcctggccaacttggtgaaaccccgtctttactaaaaatacaaaaaaattagccaggcgtggtggtgcacccctaaaatcccagctacttgagagactgaggcaggagaatcgcttgaacccaggaggtggaggttccagtgagccaaaatcatgccaatgtattccagtctgggtgacagagtgagactctgtctcaaaaaataaataaataaaataaaatgaaatagatcttataaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:114836 -> Molecular function: GO:0004872 [receptor activity] evidence: IEA GeneID:114836 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA GeneID:114836 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.