Home |
Help |
Advanced search
2025-12-18 03:05:14, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001184716 2421 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens SLAM family member 6 (SLAMF6), transcript variant 4,
mRNA.
ACCESSION NM_001184716
VERSION NM_001184716.1 GI:296040494
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2421)
AUTHORS Bolduan,S., Hubel,P., Reif,T., Lodermeyer,V., Hohne,K., Fritz,J.V.,
Sauter,D., Kirchhoff,F., Fackler,O.T., Schindler,M. and Schubert,U.
TITLE HIV-1 Vpu affects the anterograde transport and the glycosylation
pattern of NTB-A
JOURNAL Virology 440 (2), 190-203 (2013)
PUBMED 23528733
REMARK GeneRIF: Together, these results suggest that the reduction of
NTB-A from the cell surface is associated with the Vpu-mediated
effect on the glycosylation pattern of newly synthesized NTB-A
molecules.
REFERENCE 2 (bases 1 to 2421)
AUTHORS Chatterjee,M., Hedrich,C.M., Rauen,T., Ioannidis,C., Terhorst,C.
and Tsokos,G.C.
TITLE CD3-T cell receptor co-stimulation through SLAMF3 and SLAMF6
receptors enhances RORgammat recruitment to the IL17A promoter in
human T lymphocytes
JOURNAL J. Biol. Chem. 287 (45), 38168-38177 (2012)
PUBMED 22989874
REMARK GeneRIF: Data indicate that the dominance of the SLAMF3/SLAMF6
pathway in inducing IL-17A production can be attributed to an
increased nuclear abundance and recruitment of RORgammat to the
IL17A promoter.
REFERENCE 3 (bases 1 to 2421)
AUTHORS Chatterjee,M., Rauen,T., Kis-Toth,K., Kyttaris,V.C., Hedrich,C.M.,
Terhorst,C. and Tsokos,G.C.
TITLE Increased expression of SLAM receptors SLAMF3 and SLAMF6 in
systemic lupus erythematosus T lymphocytes promotes Th17
differentiation
JOURNAL J. Immunol. 188 (3), 1206-1212 (2012)
PUBMED 22184727
REMARK GeneRIF: SLAMF3 and SLAMF6 T cell surface expression and IL-17
levels significantly correlate with disease activity in systemic
lupus erythematosus patients
REFERENCE 4 (bases 1 to 2421)
AUTHORS Chatterjee,M., Kis-Toth,K., Thai,T.H., Terhorst,C. and Tsokos,G.C.
TITLE SLAMF6-driven co-stimulation of human peripheral T cells is
defective in SLE T cells
JOURNAL Autoimmunity 44 (3), 211-218 (2011)
PUBMED 21231893
REMARK GeneRIF: Although the expression of SLAMF6 on the surface of T
cells from patients with systemic lupus erythematosus (SLE) T cells
is comparable to that on the normal T cells, engagement of SLAMF6
results in severely reduced Th1 and IL-2 cytokine production
REFERENCE 5 (bases 1 to 2421)
AUTHORS Shah,A.H., Sowrirajan,B., Davis,Z.B., Ward,J.P., Campbell,E.M.,
Planelles,V. and Barker,E.
TITLE Degranulation of natural killer cells following interaction with
HIV-1-infected cells is hindered by downmodulation of NTB-A by Vpu
JOURNAL Cell Host Microbe 8 (5), 397-409 (2010)
PUBMED 21075351
REMARK GeneRIF: Vpu downmodulation of NTB-A protects the infected cell
from lysis by NK cells.
REFERENCE 6 (bases 1 to 2421)
AUTHORS Fraser,C.C., Howie,D., Morra,M., Qiu,Y., Murphy,C., Shen,Q.,
Gutierrez-Ramos,J.C., Coyle,A., Kingsbury,G.A. and Terhorst,C.
TITLE Identification and characterization of SF2000 and SF2001, two new
members of the immune receptor SLAM/CD2 family
JOURNAL Immunogenetics 53 (10-11), 843-850 (2002)
PUBMED 11862385
REFERENCE 7 (bases 1 to 2421)
AUTHORS Bottino,C., Falco,M., Parolini,S., Marcenaro,E., Augugliaro,R.,
Sivori,S., Landi,E., Biassoni,R., Notarangelo,L.D., Moretta,L. and
Moretta,A.
TITLE NTB-A [correction of GNTB-A], a novel SH2D1A-associated surface
molecule contributing to the inability of natural killer cells to
kill Epstein-Barr virus-infected B cells in X-linked
lymphoproliferative disease
JOURNAL J. Exp. Med. 194 (3), 235-246 (2001)
PUBMED 11489943
REMARK Erratum:[J Exp Med 2001 Sep 3;194(5):following 703]
REFERENCE 8 (bases 1 to 2421)
AUTHORS Lee,Y.J., Luisiri,P. and Clark,M.R.
TITLE A novel complex, p40/42, is constitutively associated with the B
cell antigen receptor and phosphorylated upon receptor stimulation
JOURNAL J. Immunol. 157 (9), 3828-3837 (1996)
PUBMED 8892612
REFERENCE 9 (bases 1 to 2421)
AUTHORS Kong,G., Dalton,M., Bubeck Wardenburg,J., Straus,D., Kurosaki,T.
and Chan,A.C.
TITLE Distinct tyrosine phosphorylation sites in ZAP-70 mediate
activation and negative regulation of antigen receptor function
JOURNAL Mol. Cell. Biol. 16 (9), 5026-5035 (1996)
PUBMED 8756661
REFERENCE 10 (bases 1 to 2421)
AUTHORS Hercend,T., Meuer,S., Brennan,A., Edson,M.A., Acuto,O.,
Reinherz,E.L., Schlossman,S.F. and Ritz,J.
TITLE Natural killer-like function of activated T lymphocytes:
differential blocking effects of monoclonal antibodies specific for
a 90-kDa clonotypic structure
JOURNAL Cell. Immunol. 86 (2), 381-392 (1984)
PUBMED 6610481
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DB197632.1, AK301026.1,
AW402723.1 and AK125624.1.
Summary: The protein encoded by this gene is a type I transmembrane
protein, belonging to the CD2 subfamily of the immunoglobulin
superfamily. This encoded protein is expressed on Natural killer
(NK), T, and B lymphocytes. It undergoes tyrosine phosphorylation
and associates with the Src homology 2 domain-containing protein
(SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs).
It functions as a coreceptor in the process of NK cell activation.
It can also mediate inhibitory signals in NK cells from X-linked
lymphoproliferative patients. Alternative splicing results in
multiple transcript variants encoding distinct isoforms.[provided
by RefSeq, May 2010].
Transcript Variant: This variant (4) lacks an alternate exon in the
5' coding region, compared to variant 1, which result in an isoform
(4) with a shorter extracellular domain than isoform 1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK301026.1, BI834685.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084, ERS025088 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-10 DB197632.1 1-10
11-874 AK301026.1 1-864
875-907 AW402723.1 127-159
908-2421 AK125624.1 1237-2750
FEATURES Location/Qualifiers
source 1..2421
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1q23.2"
gene 1..2421
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/note="SLAM family member 6"
/db_xref="GeneID:114836"
/db_xref="HGNC:21392"
/db_xref="MIM:606446"
exon 1..119
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/inference="alignment:Splign:1.39.8"
STS 44..1164
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/db_xref="UniSTS:486452"
CDS 71..736
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/note="isoform 4 precursor is encoded by transcript
variant 4; activating NK receptor; natural killer-, T- and
B-cell antigen; NTBA receptor; NK-T-B-antigen"
/codon_start=1
/product="SLAM family member 6 isoform 4 precursor"
/protein_id="NP_001171645.1"
/db_xref="GI:296040495"
/db_xref="CCDS:CCDS53393.1"
/db_xref="GeneID:114836"
/db_xref="HGNC:21392"
/db_xref="MIM:606446"
/translation="
MLWLFQSLLFVFCFGPGQLRNIQVTNHSQLFQNMTCELHLTCSVEDADDNVSFRWEALGNTLSSQPNLTVSWDPRISSEQDYTCIAENAVSNLSFSVSAQKLCEDVKIQYTDTKMILFMVSGICIVFGFIILLLLVLRKRRDSLSLSTQRTQGPAESARNLEYVSVSPTNNTVYASVTHSNRETEIWTPRENDTITIYSTINHSKESKPTFSRATALDNVV
"
sig_peptide 71..127
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
mat_peptide 128..733
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/product="SLAM family member 6 isoform 4"
misc_feature 137..334
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/note="Immunoglobulin domain; Region: Ig; cl11960"
/db_xref="CDD:213125"
exon 120..383
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/inference="alignment:Splign:1.39.8"
variation 223
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:35414223"
exon 384..494
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/inference="alignment:Splign:1.39.8"
variation 467
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/replace="c"
/replace="t"
/db_xref="dbSNP:34355503"
exon 495..533
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/inference="alignment:Splign:1.39.8"
exon 534..616
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/inference="alignment:Splign:1.39.8"
exon 617..688
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/inference="alignment:Splign:1.39.8"
exon 689..2413
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/inference="alignment:Splign:1.39.8"
variation 2124
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/replace="a"
/replace="t"
/db_xref="dbSNP:634791"
STS 2157..2325
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/standard_name="G35510"
/db_xref="UniSTS:44150"
STS 2199..2289
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/standard_name="D8S2279"
/db_xref="UniSTS:473907"
polyA_signal 2379..2384
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
polyA_signal 2383..2388
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
polyA_signal 2387..2392
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
polyA_signal 2392..2397
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
polyA_site 2413
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
ORIGIN
agtttatgacagaagggcaaaaacattgactgcctcaaggtctcaagcaccagtcttcaccgcggaaagcatgttgtggctgttccaatcgctcctgtttgtcttctgctttggcccaggacaactgaggaacatacaagttaccaatcacagtcagctatttcagaatatgacctgtgagctccatctgacttgctctgtggaggatgcagatgacaatgtctcattcagatgggaggccttgggaaacacactttcaagtcagccaaacctcactgtctcctgggaccccaggatttccagtgaacaggactacacctgcatagcagagaatgctgtcagtaatttatccttctctgtctctgcccagaagctttgcgaagatgttaaaattcaatatacagataccaaaatgattctgtttatggtttctgggatatgcatagtcttcggtttcatcatactgctgttacttgttttgaggaaaagaagagattccctatctttgtctactcagcgaacacagggccccgcagagtccgcaaggaacctagagtatgtttcagtgtctccaacgaacaacactgtgtatgcttcagtcactcattcaaacagggaaacagaaatctggacacctagagaaaatgatactatcacaatttactccacaattaatcattccaaagagagtaaacccactttttccagggcaactgcccttgacaatgtcgtgtaagttgctgaaaggcctcagaggaattcgggaatgacacgtcttctgatcccatgagacagaacaaagaacaggaagcttggttcctgttgttcctggcaacagaatttgaatatctaggataggatgatcacctccagtccttcggacttaaacctgcctacctgagtcaaacacctaaggataacatcatttccagcatgtggttcaaataatattttccaatccacttcaggccaaaacatgctaaagataacacaccagcacattgactctctctttgataactaagcaaatggaattatggttgacagagagtttatgatccagaagacaaccacttctctccttttagaaagcagcaggattgacttattgagaaataatgcagtgtgttggttacatgtgtagtctctggagttggatgggcccatcctgatacaagttgagcatcccttgtctgaaatgcttgggattagaaatgtttcagatttcaattttttttcagattttggaatatttgcattatatttagcggttgagtatccaaatccaaaaatccaaaattcaaaatgctccaataagcatttcccttgagtttcattgatgtcgatgcagtgctcaaaatctcagattttggagcattttggatattggatttttggatttgggatgctcaacttgtacaatgtttattagacacatctcctgggacatactgcctaaccttttggagccttagtctcccagactgaaaaaggaagaggatggtattacatcagctccattgtttgagccaagaatctaagtcatccctgactccagtgtctttgtcaccaggccctttggactctacctcagaaatatttcttggaccttccacttctcctccaactccttgaccaccatcctgtatccaaccatcaccacctctaacctgaatcctaccttaagatcagaacagttgtcctcacttttgttcttgtccctctccaacccactctccacaagatggccagagtaatgtttttaatataaattggatccttcagtttcctgcttaaaaccctgcaggtttcccaatgcactcagaaagaaatccagtttccatggccctggatggtctggcccacctccagcctcagctagcattacccttctgacactctctatgtagcctccctgatcttctttcagctcctctattaaaggaaaagttctttatgttaattatttacatcttcctgcaggcccttcctctgcctgctggggtcctcctattctttaggtttaattttaaatatgtcacctcctaagagaaaccttcccagaccactctttctaaaatgaatcttctaggctgggcatggtggctcacacctgtaatccctgtactttgggaggccaaggggggagatcacttgaggtcaggagttcaagaccagcctggccaacttggtgaaaccccgtctttactaaaaatacaaaaaaattagccaggcgtggtggtgcacccctaaaatcccagctacttgagagactgaggcaggagaatcgcttgaacccaggaggtggaggttccagtgagccaaaatcatgccaatgtattccagtctgggtgacagagtgagactctgtctcaaaaaataaataaataaaataaaatgaaatagatcttataaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:114836 -> Molecular function: GO:0004872 [receptor activity] evidence: IEA
GeneID:114836 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
GeneID:114836 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.