GGRNA Home | Help | Advanced search

2025-05-09 17:11:19, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_020996                744 bp    mRNA    linear   PRI 15-JUN-2013
DEFINITION  Homo sapiens fibroblast growth factor 6 (FGF6), mRNA.
ACCESSION   NM_020996
VERSION     NM_020996.1  GI:10337586
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 744)
  AUTHORS   Jia,W.H., Zhang,B., Matsuo,K., Shin,A., Xiang,Y.B., Jee,S.H.,
            Kim,D.H., Ren,Z., Cai,Q., Long,J., Shi,J., Wen,W., Yang,G.,
            Delahanty,R.J., Ji,B.T., Pan,Z.Z., Matsuda,F., Gao,Y.T., Oh,J.H.,
            Ahn,Y.O., Park,E.J., Li,H.L., Park,J.W., Jo,J., Jeong,J.Y.,
            Hosono,S., Casey,G., Peters,U., Shu,X.O., Zeng,Y.X. and Zheng,W.
  CONSRTM   Colon Cancer Family Registry (CCFR); Genetics and Epidemiology of
            Colorectal Cancer Consortium (GECCO)
  TITLE     Genome-wide association analyses in East Asians identify new
            susceptibility loci for colorectal cancer
  JOURNAL   Nat. Genet. 45 (2), 191-196 (2013)
   PUBMED   23263487
REFERENCE   2  (bases 1 to 744)
  AUTHORS   Bosetti,M., Leigheb,M., Brooks,R.A., Boccafoschi,F. and Cannas,M.F.
  TITLE     Regulation of osteoblast and osteoclast functions by FGF-6
  JOURNAL   J. Cell. Physiol. 225 (2), 466-471 (2010)
   PUBMED   20458746
  REMARK    GeneRIF: These data demonstrate that FGF-6 may be considered a
            regulator of bone metabolism as shown by its activity on both
            osteoblasts and osteoclasts.
REFERENCE   3  (bases 1 to 744)
  AUTHORS   Kestenbaum,B., Glazer,N.L., Kottgen,A., Felix,J.F., Hwang,S.J.,
            Liu,Y., Lohman,K., Kritchevsky,S.B., Hausman,D.B., Petersen,A.K.,
            Gieger,C., Ried,J.S., Meitinger,T., Strom,T.M., Wichmann,H.E.,
            Campbell,H., Hayward,C., Rudan,I., de Boer,I.H., Psaty,B.M.,
            Rice,K.M., Chen,Y.D., Li,M., Arking,D.E., Boerwinkle,E., Coresh,J.,
            Yang,Q., Levy,D., van Rooij,F.J., Dehghan,A., Rivadeneira,F.,
            Uitterlinden,A.G., Hofman,A., van Duijn,C.M., Shlipak,M.G.,
            Kao,W.H., Witteman,J.C., Siscovick,D.S. and Fox,C.S.
  TITLE     Common genetic variants associate with serum phosphorus
            concentration
  JOURNAL   J. Am. Soc. Nephrol. 21 (7), 1223-1232 (2010)
   PUBMED   20558539
REFERENCE   4  (bases 1 to 744)
  AUTHORS   Moffa,A.B. and Ethier,S.P.
  TITLE     Differential signal transduction of alternatively spliced FGFR2
            variants expressed in human mammary epithelial cells
  JOURNAL   J. Cell. Physiol. 210 (3), 720-731 (2007)
   PUBMED   17133345
REFERENCE   5  (bases 1 to 744)
  AUTHORS   Zhang,X., Ibrahimi,O.A., Olsen,S.K., Umemori,H., Mohammadi,M. and
            Ornitz,D.M.
  TITLE     Receptor specificity of the fibroblast growth factor family. The
            complete mammalian FGF family
  JOURNAL   J. Biol. Chem. 281 (23), 15694-15700 (2006)
   PUBMED   16597617
REFERENCE   6  (bases 1 to 744)
  AUTHORS   Vainikka,S., Partanen,J., Bellosta,P., Coulier,F., Birnbaum,D.,
            Basilico,C., Jaye,M. and Alitalo,K.
  TITLE     Fibroblast growth factor receptor-4 shows novel features in genomic
            structure, ligand binding and signal transduction
  JOURNAL   EMBO J. 11 (12), 4273-4280 (1992)
   PUBMED   1385111
  REMARK    Erratum:[EMBO J 1993 Feb;12(2):810]
REFERENCE   7  (bases 1 to 744)
  AUTHORS   Iida,S., Yoshida,T., Naito,K., Sakamoto,H., Katoh,O., Hirohashi,S.,
            Sato,T., Onda,M., Sugimura,T. and Terada,M.
  TITLE     Human hst-2 (FGF-6) oncogene: cDNA cloning and characterization
  JOURNAL   Oncogene 7 (2), 303-309 (1992)
   PUBMED   1549352
REFERENCE   8  (bases 1 to 744)
  AUTHORS   Coulier,F., Batoz,M., Marics,I., de Lapeyriere,O. and Birnbaum,D.
  TITLE     Putative structure of the FGF6 gene product and role of the signal
            peptide
  JOURNAL   Oncogene 6 (8), 1437-1444 (1991)
   PUBMED   1886714
REFERENCE   9  (bases 1 to 744)
  AUTHORS   Dionne,C.A., Crumley,G., Bellot,F., Kaplow,J.M., Searfoss,G.,
            Ruta,M., Burgess,W.H., Jaye,M. and Schlessinger,J.
  TITLE     Cloning and expression of two distinct high-affinity receptors
            cross-reacting with acidic and basic fibroblast growth factors
  JOURNAL   EMBO J. 9 (9), 2685-2692 (1990)
   PUBMED   1697263
REFERENCE   10 (bases 1 to 744)
  AUTHORS   Marics,I., Adelaide,J., Raybaud,F., Mattei,M.G., Coulier,F.,
            Planche,J., de Lapeyriere,O. and Birnbaum,D.
  TITLE     Characterization of the HST-related FGF.6 gene, a new member of the
            fibroblast growth factor gene family
  JOURNAL   Oncogene 4 (3), 335-340 (1989)
   PUBMED   2649847
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from X63454.1.
            
            Summary: The protein encoded by this gene is a member of the
            fibroblast growth factor (FGF) family. FGF family members possess
            broad mitogenic and cell survival activities, and are involved in a
            variety of biological processes, including embryonic development,
            cell growth, morphogenesis, tissue repair, tumor growth and
            invasion. This gene displayed oncogenic transforming activity when
            transfected into mammalian cells. The mouse homolog of this gene
            exhibits a restricted expression profile predominantly in the
            myogenic lineage, which suggested a role in muscle regeneration or
            differentiation. [provided by RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: X63454.1, BC121097.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025084, ERS025088 [ECO:0000350]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..744
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12p13"
     gene            1..744
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /note="fibroblast growth factor 6"
                     /db_xref="GeneID:2251"
                     /db_xref="HGNC:3684"
                     /db_xref="HPRD:00623"
                     /db_xref="MIM:134921"
     STS             1..721
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /db_xref="UniSTS:480860"
     exon            1..390
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /inference="alignment:Splign:1.39.8"
     STS             12..691
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /db_xref="UniSTS:482119"
     STS             17..738
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /db_xref="UniSTS:490467"
     misc_feature    30..32
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /note="upstream in-frame stop codon"
     CDS             45..671
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /note="FGF-6; HST-2; HSTF-2; heparin-binding growth factor
                     6; heparin secretory-transforming protein 2"
                     /codon_start=1
                     /product="fibroblast growth factor 6 precursor"
                     /protein_id="NP_066276.2"
                     /db_xref="GI:15147343"
                     /db_xref="CCDS:CCDS8527.1"
                     /db_xref="GeneID:2251"
                     /db_xref="HGNC:3684"
                     /db_xref="HPRD:00623"
                     /db_xref="MIM:134921"
                     /translation="
MALGQKLFITMSRGAGRLQGTLWALVFLGILVGMVVPSPAGTRANNTLLDSRGWGTLLSRSRAGLAGEIAGVNWESGYLVGIKRQRRLYCNVGIGFHLQVLPDGRISGTHEENPYSLLEISTVERGVVSLFGVRSALFVAMNSKGRLYATPSFQEECKFRETLLPNNYNAYESDLYQGTYIALSKYGRVKRGSKVSPIMTVTHFLPRI
"
     sig_peptide     45..155
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
     misc_feature    75..77
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Region: alternative start codon"
     misc_feature    144..146
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Region: alternative start codon"
     mat_peptide     156..638
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /product="fibroblast growth factor 6"
     misc_feature    300..668
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /note="Acidic and basic fibroblast growth factor family;
                     FGFs are mitogens, which stimulate growth or
                     differentiation of cells of mesodermal or neuroectodermal
                     origin. The family plays essential roles in patterning and
                     differentiation during vertebrate...; Region: FGF;
                     cd00058"
                     /db_xref="CDD:28940"
     misc_feature    order(300..302,309..311,405..407,411..413,417..419,
                     501..503,525..527,534..551,555..557,651..653,657..659,
                     663..665)
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /note="receptor interaction site; other site"
                     /db_xref="CDD:28940"
     misc_feature    order(594..599,612..614,624..626,642..644)
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /note="heparin binding site (glycine box) [chemical
                     binding]; other site"
                     /db_xref="CDD:28940"
     variation       119
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17183515"
     variation       232
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17183529"
     exon            391..494
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /inference="alignment:Splign:1.39.8"
     variation       410
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2241279"
     variation       461
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2241280"
     exon            495..744
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /inference="alignment:Splign:1.39.8"
     variation       615
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17183778"
     variation       691
                     /gene="FGF6"
                     /gene_synonym="HBGF-6; HST2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2241286"
ORIGIN      
tttagggccattaattctgaccacgtgcctgagaggcaaggtggatggccctgggacagaaactgttcatcactatgtcccggggagcaggacgtctgcagggcacgctgtgggctctcgtcttcctaggcatcctagtgggcatggtggtgccctcgcctgcaggcacccgtgccaacaacacgctgctggactcgaggggctggggcaccctgctgtccaggtctcgcgcggggctagctggagagattgccggggtgaactgggaaagtggctatttggtggggatcaagcggcagcggaggctctactgcaacgtgggcatcggctttcacctccaggtgctccccgacggccggatcagcgggacccacgaggagaacccctacagcctgctggaaatttccactgtggagcgaggcgtggtgagtctctttggagtgagaagtgccctcttcgttgccatgaacagtaaaggaagattgtacgcaacgcccagcttccaagaagaatgcaagttcagagaaaccctcctgcccaacaattacaatgcctacgagtcagacttgtaccaagggacctacattgccctgagcaaatacggacgggtaaagcggggcagcaaggtgtccccgatcatgactgtcactcatttccttcccaggatctaaggacccacaaaagaaggcttacagatttaaagcatcatctgttcgattgaaattttgcaccagcgaagaattc
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:2251 -> Molecular function: GO:0008083 [growth factor activity] evidence: IEA
            GeneID:2251 -> Biological process: GO:0001502 [cartilage condensation] evidence: IEA
            GeneID:2251 -> Biological process: GO:0001525 [angiogenesis] evidence: IEA
            GeneID:2251 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
            GeneID:2251 -> Biological process: GO:0007173 [epidermal growth factor receptor signaling pathway] evidence: TAS
            GeneID:2251 -> Biological process: GO:0007267 [cell-cell signaling] evidence: TAS
            GeneID:2251 -> Biological process: GO:0008283 [cell proliferation] evidence: TAS
            GeneID:2251 -> Biological process: GO:0008284 [positive regulation of cell proliferation] evidence: IGI
            GeneID:2251 -> Biological process: GO:0008286 [insulin receptor signaling pathway] evidence: TAS
            GeneID:2251 -> Biological process: GO:0008543 [fibroblast growth factor receptor signaling pathway] evidence: IGI
            GeneID:2251 -> Biological process: GO:0008543 [fibroblast growth factor receptor signaling pathway] evidence: TAS
            GeneID:2251 -> Biological process: GO:0038095 [Fc-epsilon receptor signaling pathway] evidence: TAS
            GeneID:2251 -> Biological process: GO:0045087 [innate immune response] evidence: TAS
            GeneID:2251 -> Biological process: GO:0045445 [myoblast differentiation] evidence: IEA
            GeneID:2251 -> Biological process: GO:0048011 [neurotrophin TRK receptor signaling pathway] evidence: TAS
            GeneID:2251 -> Biological process: GO:0048015 [phosphatidylinositol-mediated signaling] evidence: TAS
            GeneID:2251 -> Biological process: GO:0051781 [positive regulation of cell division] evidence: IEA
            GeneID:2251 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS
            GeneID:2251 -> Cellular component: GO:0005615 [extracellular space] evidence: IEA
            GeneID:2251 -> Cellular component: GO:0042383 [sarcolemma] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.