Home |
Help |
Advanced search
2025-05-09 16:45:25, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_006343 3632 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens c-mer proto-oncogene tyrosine kinase (MERTK), mRNA.
ACCESSION NM_006343
VERSION NM_006343.2 GI:66932917
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3632)
AUTHORS Schlegel,J., Sambade,M.J., Sather,S., Moschos,S.J., Tan,A.C.,
Winges,A., DeRyckere,D., Carson,C.C., Trembath,D.G., Tentler,J.J.,
Eckhardt,S.G., Kuan,P.F., Hamilton,R.L., Duncan,L.M., Miller,C.R.,
Nikolaishvili-Feinberg,N., Midkiff,B.R., Liu,J., Zhang,W., Yang,C.,
Wang,X., Frye,S.V., Earp,H.S., Shields,J.M. and Graham,D.K.
TITLE MERTK receptor tyrosine kinase is a therapeutic target in melanoma
JOURNAL J. Clin. Invest. 123 (5), 2257-2267 (2013)
PUBMED 23585477
REMARK GeneRIF: MERTK expression correlates with disease progression in
metastatic melanomas, primary melanomas, and nevi
REFERENCE 2 (bases 1 to 3632)
AUTHORS Garbin,U., Baggio,E., Stranieri,C., Pasini,A., Manfro,S.,
Mozzini,C., Vallerio,P., Lipari,G., Merigo,F., Guidi,G.,
Cominacini,L. and Fratta Pasini,A.
TITLE Expansion of necrotic core and shedding of Mertk receptor in human
carotid plaques: a role for oxidized polyunsaturated fatty acids?
JOURNAL Cardiovasc. Res. 97 (1), 125-133 (2013)
PUBMED 22997156
REMARK GeneRIF: Oxidized of polyunsaturated fatty acids contained in the
tissue close to necrotic core of human carotid plaques are strong
inducers of Adam17, which in turn may cleave the extracellular
domain of Mertk giving rise to sMer.
REFERENCE 3 (bases 1 to 3632)
AUTHORS Fraineau,S., Monvoisin,A., Clarhaut,J., Talbot,J., Simonneau,C.,
Kanthou,C., Kanse,S.M., Philippe,M. and Benzakour,O.
TITLE The vitamin K-dependent anticoagulant factor, protein S, inhibits
multiple VEGF-A-induced angiogenesis events in a Mer- and
SHP2-dependent manner
JOURNAL Blood 120 (25), 5073-5083 (2012)
PUBMED 23065156
REMARK GeneRIF: The tyrosine kinase receptor MER is activated by PROS and
mediates its inhibitory effect on VEGF-A-induced EC proliferation.
REFERENCE 4 (bases 1 to 3632)
AUTHORS Patin E, Kutalik Z, Guergnon J, Bibert S, Nalpas B, Jouanguy E,
Munteanu M, Bousquet L, Argiro L, Halfon P, Boland A, Mullhaupt B,
Semela D, Dufour JF, Heim MH, Moradpour D, Cerny A, Malinverni R,
Hirsch H, Martinetti G, Suppiah V, Stewart G, Booth DR, George J,
Casanova JL, Brechot C, Rice CM, Talal AH, Jacobson IM, Bourliere
M, Theodorou I, Poynard T, Negro F, Pol S, Bochud PY and Abel L.
CONSRTM Swiss Hepatitis C Cohort Study Group; International Hepatitis C
Genetics Consortium; French ANRS HC EP 26 Genoscan Study Group
TITLE Genome-wide association study identifies variants associated with
progression of liver fibrosis from HCV infection
JOURNAL Gastroenterology 143 (5), 1244-1252 (2012)
PUBMED 22841784
REMARK GeneRIF: The single nucleotide polymorphisms rs4374383 and
rs9380516 were linked to the functionally related genes MERTK and
TULP1, which encode factors involved in phagocytosis of apoptotic
cells by macrophages.
REFERENCE 5 (bases 1 to 3632)
AUTHORS Zizzo,G., Hilliard,B.A., Monestier,M. and Cohen,P.L.
TITLE Efficient clearance of early apoptotic cells by human macrophages
requires M2c polarization and MerTK induction
JOURNAL J. Immunol. 189 (7), 3508-3520 (2012)
PUBMED 22942426
REMARK GeneRIF: MerTK expression levels adapt to changing immunologic
environment, being suppressed in M1 and M2a macrophages and in
dendritic cells.
REFERENCE 6 (bases 1 to 3632)
AUTHORS Weier,H.U., Fung,J. and Lersch,R.A.
TITLE Assignment of protooncogene MERTK (a.k.a. c-mer) to human
chromosome 2q14.1 by in situ hybridization
JOURNAL Cytogenet. Cell Genet. 84 (1-2), 91-92 (1999)
PUBMED 10343112
REFERENCE 7 (bases 1 to 3632)
AUTHORS Ling,L., Templeton,D. and Kung,H.J.
TITLE Identification of the major autophosphorylation sites of Nyk/Mer,
an NCAM-related receptor tyrosine kinase
JOURNAL J. Biol. Chem. 271 (31), 18355-18362 (1996)
PUBMED 8702477
REFERENCE 8 (bases 1 to 3632)
AUTHORS Mark,M.R., Chen,J., Hammonds,R.G., Sadick,M. and Godowsk,P.J.
TITLE Characterization of Gas6, a member of the superfamily of G
domain-containing proteins, as a ligand for Rse and Axl
JOURNAL J. Biol. Chem. 271 (16), 9785-9789 (1996)
PUBMED 8621659
REFERENCE 9 (bases 1 to 3632)
AUTHORS Graham,D.K., Dawson,T.L., Mullaney,D.L., Snodgrass,H.R. and
Earp,H.S.
TITLE Cloning and mRNA expression analysis of a novel human
protooncogene, c-mer
JOURNAL Cell Growth Differ. 5 (6), 647-657 (1994)
PUBMED 8086340
REMARK Erratum:[Cell Growth Differ 1994 Sep;5(9):1022]
REFERENCE 10 (bases 1 to 3632)
AUTHORS Iwase,T., Tanaka,M., Suzuki,M., Naito,Y., Sugimura,H. and Kino,I.
TITLE Identification of protein-tyrosine kinase genes preferentially
expressed in embryo stomach and gastric cancer
JOURNAL Biochem. Biophys. Res. Commun. 194 (2), 698-705 (1993)
PUBMED 7688222
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from BX474860.1, U08023.1,
CN371299.1, AL705756.1, CA454601.1, CN371300.1, AC093675.4,
BM719997.1 and AW627665.1.
This sequence is a reference standard in the RefSeqGene project.
On Jun 3, 2005 this sequence version replaced gi:5453737.
Summary: This gene is a member of the MER/AXL/TYRO3 receptor kinase
family and encodes a transmembrane protein with two fibronectin
type-III domains, two Ig-like C2-type (immunoglobulin-like)
domains, and one tyrosine kinase domain. Mutations in this gene
have been associated with disruption of the retinal pigment
epithelium (RPE) phagocytosis pathway and onset of autosomal
recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul
2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: U08023.1, AK316584.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025083, ERS025084 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-34 BX474860.1 2-35
35-474 U08023.1 50-489
475-550 CN371299.1 110-185
551-860 U08023.1 566-875
861-862 CN371299.1 496-497
863-941 U08023.1 878-956
942-943 CN371299.1 577-578
944-1103 U08023.1 959-1118
1104-1105 AL705756.1 564-565
1106-1249 U08023.1 1121-1264
1250-1251 CA454601.1 640-641
1252-2004 U08023.1 1267-2019
2005-2006 CN371300.1 271-272
2007-2501 U08023.1 2022-2516
2502-2503 AC093675.4 34928-34929
2504-2783 U08023.1 2519-2798
2784-2785 BM719997.1 304-305
2786-3263 U08023.1 2801-3278
3264-3632 AW627665.1 1-369 c
FEATURES Location/Qualifiers
source 1..3632
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="2"
/map="2q14.1"
gene 1..3632
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/note="c-mer proto-oncogene tyrosine kinase"
/db_xref="GeneID:10461"
/db_xref="HGNC:7027"
/db_xref="MIM:604705"
exon 1..183
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="alignment:Splign:1.39.8"
variation 59..60
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace=""
/replace="g"
/db_xref="dbSNP:34973298"
variation 89
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:141412373"
variation 109..110
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace=""
/replace="g"
/db_xref="dbSNP:34841018"
CDS 123..3122
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/EC_number="2.7.10.1"
/note="STK kinase; tyrosine-protein kinase Mer; MER
receptor tyrosine kinase; proto-oncogene c-Mer; receptor
tyrosine kinase MerTK"
/codon_start=1
/product="tyrosine-protein kinase Mer precursor"
/protein_id="NP_006334.2"
/db_xref="GI:66932918"
/db_xref="CCDS:CCDS2094.1"
/db_xref="GeneID:10461"
/db_xref="HGNC:7027"
/db_xref="MIM:604705"
/translation="
MGPAPLPLLLGLFLPALWRRAITEAREEAKPYPLFPGPFPGSLQTDHTPLLSLPHASGYQPALMFSPTQPGRPHTGNVAIPQVTSVESKPLPPLAFKHTVGHIILSEHKGVKFNCSISVPNIYQDTTISWWKDGKELLGAHHAITQFYPDDEVTAIIASFSITSVQRSDNGSYICKMKINNEEIVSDPIYIEVQGLPHFTKQPESMNVTRNTAFNLTCQAVGPPEPVNIFWVQNSSRVNEQPEKSPSVLTVPGLTEMAVFSCEAHNDKGLTVSKGVQINIKAIPSPPTEVSIRNSTAHSILISWVPGFDGYSPFRNCSIQVKEADPLSNGSVMIFNTSALPHLYQIKQLQALANYSIGVSCMNEIGWSAVSPWILASTTEGAPSVAPLNVTVFLNESSDNVDIRWMKPPTKQQDGELVGYRISHVWQSAGISKELLEEVGQNGSRARISVQVHNATCTVRIAAVTRGGVGPFSDPVKIFIPAHGWVDYAPSSTPAPGNADPVLIIFGCFCGFILIGLILYISLAIRKRVQETKFGNAFTEEDSELVVNYIAKKSFCRRAIELTLHSLGVSEELQNKLEDVVIDRNLLILGKILGEGEFGSVMEGNLKQEDGTSLKVAVKTMKLDNSSQREIEEFLSEAACMKDFSHPNVIRLLGVCIEMSSQGIPKPMVILPFMKYGDLHTYLLYSRLETGPKHIPLQTLLKFMVDIALGMEYLSNRNFLHRDLAARNCMLRDDMTVCVADFGLSKKIYSGDYYRQGRIAKMPVKWIAIESLADRVYTSKSDVWAFGVTMWEIATRGMTPYPGVQNHEMYDYLLHGHRLKQPEDCLDELYEIMYSCWRTDPLDRPTFSVLRLQLEKLLESLPDVRNQADVIYVNTQLLESSEGLAQGSTLAPLDLNIDPDSIIASCTPRAAISVVTAEVHDSKPHEGRYILNGGSEEWEDLTSAPSAAVTAEKNSVLPGERLVRNGVSWSHSSMLPLGSSLPDELLFADDSSEGSEVLM
"
sig_peptide 123..182
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
mat_peptide 183..3119
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/product="tyrosine-protein kinase Mer"
misc_feature 453..650
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/note="Immunoglobulin domain; Region: Ig; cd00096"
/db_xref="CDD:143165"
misc_feature 711..962
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/note="Immunoglobulin I-set domain; Region: I-set;
pfam07679"
/db_xref="CDD:191810"
misc_feature 717..959
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/note="Second immunoglobulin (Ig)-like domain of Axl/Tyro3
receptor tyrosine kinases (RTKs); Region: Ig2_Tyro3_like;
cd05749"
/db_xref="CDD:143226"
misc_feature 915..932
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/note="dimerization loop; other site"
/db_xref="CDD:143226"
misc_feature order(924..932,936..938)
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:143226"
misc_feature 972..1256
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/note="Fibronectin type 3 domain; One of three types of
internal repeats found in the plasma protein fibronectin.
Its tenth fibronectin type III repeat contains an RGD cell
recognition sequence in a flexible loop between 2 strands.
Approximately 2% of all...; Region: FN3; cd00063"
/db_xref="CDD:28945"
misc_feature order(972..974,1173..1175,1218..1220)
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/note="Interdomain contacts; other site"
/db_xref="CDD:28945"
misc_feature order(1221..1226,1230..1235)
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/note="Cytokine receptor motif; other site"
/db_xref="CDD:28945"
misc_feature 1278..1556
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/note="Fibronectin type 3 domain; One of three types of
internal repeats found in the plasma protein fibronectin.
Its tenth fibronectin type III repeat contains an RGD cell
recognition sequence in a flexible loop between 2 strands.
Approximately 2% of all...; Region: FN3; cd00063"
/db_xref="CDD:28945"
misc_feature order(1479..1481,1524..1526)
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/note="Interdomain contacts; other site"
/db_xref="CDD:28945"
misc_feature order(1527..1532,1536..1541)
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/note="Cytokine receptor motif; other site"
/db_xref="CDD:28945"
misc_feature 1638..1700
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q12866.2);
transmembrane region"
misc_feature 1749..1751
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q12866.2); phosphorylation site"
misc_feature 1920..2669
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/note="Catalytic Domain of Axl-like Protein Tyrosine
Kinases; Region: PTKc_Axl_like; cd05035"
/db_xref="CDD:133167"
misc_feature 1923..2666
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/note="Protein tyrosine kinase; Region: Pkinase_Tyr;
pfam07714"
/db_xref="CDD:203736"
misc_feature order(1923..1925,1971..1973,1977..1979,2070..2072,
2136..2144,2154..2156,2289..2291,2301..2306,2310..2312,
2343..2345,2397..2411,2436..2438,2538..2540)
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/note="active site"
/db_xref="CDD:133167"
misc_feature order(1923..1925,1971..1973,2070..2072,2136..2144,
2154..2156,2289..2291,2301..2306,2310..2312,2343..2345)
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:133167"
misc_feature order(2289..2291,2301..2303,2397..2411,2436..2438,
2538..2540)
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/note="substrate binding site [chemical binding]; other
site"
/db_xref="CDD:133167"
misc_feature 2340..2417
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/note="activation loop (A-loop); other site"
/db_xref="CDD:133167"
misc_feature 2367..2369
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine, by autocatalysis; propagated from
UniProtKB/Swiss-Prot (Q12866.2); phosphorylation site"
misc_feature 2367..2369
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/citation=[7]
/db_xref="HPRD:05269"
misc_feature 2379..2381
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine, by autocatalysis; propagated from
UniProtKB/Swiss-Prot (Q12866.2); phosphorylation site"
misc_feature 2379..2381
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/citation=[7]
/db_xref="HPRD:05269"
misc_feature 2382..2384
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine, by autocatalysis; propagated from
UniProtKB/Swiss-Prot (Q12866.2); phosphorylation site"
misc_feature 2382..2384
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/citation=[7]
/db_xref="HPRD:05269"
misc_feature 2925..2927
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q12866.2); phosphorylation site"
variation 128
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="g"
/replace="t"
/db_xref="dbSNP:369484994"
variation 182
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="t"
/db_xref="dbSNP:35898499"
exon 184..604
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="alignment:Splign:1.39.8"
variation 220
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:144751432"
variation 224
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:143215350"
variation 229
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:150870104"
variation 230
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:367707279"
variation 245
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="g"
/replace="t"
/db_xref="dbSNP:144162028"
variation 300
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="c"
/db_xref="dbSNP:376885459"
variation 310
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:140848545"
variation 324
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:138557708"
variation 329
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="g"
/db_xref="dbSNP:200120223"
variation 353
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:137909193"
variation 385
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:372527246"
variation 391
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="c"
/db_xref="dbSNP:199912096"
variation 397
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:200985967"
variation 451
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="g"
/replace="t"
/db_xref="dbSNP:143388544"
variation 475
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:13027171"
variation 477
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:139327260"
variation 539
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:370201392"
variation 585
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:373445297"
variation 603
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:374645167"
exon 605..705
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="alignment:Splign:1.39.8"
variation 637
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:143570667"
variation 674
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="c"
/db_xref="dbSNP:148690514"
variation 675
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:56205303"
variation 687
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:201529080"
variation 704
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:370446612"
exon 706..879
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="alignment:Splign:1.39.8"
variation 735
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:200198573"
variation 748
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:140249054"
variation 781
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="g"
/db_xref="dbSNP:146962542"
variation 783
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:376228438"
variation 805
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:377346429"
variation 832
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:199707021"
variation 848
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:56256703"
variation 878
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:3761702"
exon 880..966
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="alignment:Splign:1.39.8"
variation 887
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:368133234"
variation 895
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="c"
/db_xref="dbSNP:35252762"
variation 904
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:142284609"
variation 913
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="g"
/db_xref="dbSNP:199779970"
variation 936
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:140065278"
variation 966
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:7588635"
exon 967..1082
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="alignment:Splign:1.39.8"
variation 978
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:145602430"
variation 999
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:369655379"
variation 1000
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:34072093"
exon 1083..1266
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="alignment:Splign:1.39.8"
variation 1100
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:112257146"
variation 1108
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:34943572"
variation 1126
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:200167805"
STS 1130..1656
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/standard_name="GDB:372731"
/db_xref="UniSTS:156891"
variation 1176
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:199942623"
variation 1180
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:142060697"
variation 1194
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:113052219"
variation 1206
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="c"
/db_xref="dbSNP:151145412"
variation 1249
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:369339515"
variation 1256
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:150487517"
exon 1267..1418
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="alignment:Splign:1.39.8"
variation 1286..1287
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace=""
/replace="t"
/db_xref="dbSNP:66613908"
variation 1329
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="c"
/db_xref="dbSNP:143584038"
variation 1338
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:377752022"
variation 1345
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:147166671"
variation 1351
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:3761698"
variation 1363
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="t"
/db_xref="dbSNP:370278504"
variation 1383
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:142985827"
variation 1384
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:138908058"
variation 1397
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:144708969"
variation 1408
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:374989199"
variation 1409
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:115203717"
exon 1419..1572
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="alignment:Splign:1.39.8"
variation 1456
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:202242962"
variation 1461
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:370577205"
variation 1475
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:35981104"
variation 1476
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="g"
/db_xref="dbSNP:34010621"
variation 1490
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:374043440"
variation 1496
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="t"
/db_xref="dbSNP:140463186"
variation 1512
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:148833587"
variation 1519
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:7604639"
variation 1522
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="g"
/replace="t"
/db_xref="dbSNP:368219980"
variation 1527
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="g"
/replace="t"
/db_xref="dbSNP:79943145"
variation 1558
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="t"
/db_xref="dbSNP:145142422"
variation 1566
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:374488598"
exon 1573..1726
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="alignment:Splign:1.39.8"
variation 1587
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="g"
/replace="t"
/db_xref="dbSNP:140650643"
variation 1607
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:191874938"
variation 1615
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:35858762"
variation 1616
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:3811634"
variation 1617
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:147206385"
variation 1674
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:2230515"
variation 1681
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:374649522"
exon 1727..1812
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="alignment:Splign:1.39.8"
variation 1740
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:113485015"
variation 1778..1779
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace=""
/replace="a"
/db_xref="dbSNP:67199299"
variation 1792
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:374078768"
exon 1813..1908
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="alignment:Splign:1.39.8"
variation 1813
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:200794038"
variation 1827
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:201392053"
variation 1830
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:373307689"
variation 1836
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="g"
/db_xref="dbSNP:143925029"
variation 1859
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:140681547"
variation 1872
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="c"
/db_xref="dbSNP:199937492"
exon 1909..1989
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="alignment:Splign:1.39.8"
variation 1973
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:148125428"
variation 1985
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:368347736"
exon 1990..2082
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="alignment:Splign:1.39.8"
variation 2003
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:1131244"
variation 2006
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="g"
/replace="t"
/db_xref="dbSNP:1131245"
variation 2016
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:376129675"
variation 2073
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:119489105"
variation 2080
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:201578313"
exon 2083..2201
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="alignment:Splign:1.39.8"
variation 2104
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:375952233"
variation 2106
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="g"
/db_xref="dbSNP:56209758"
variation 2111
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:149310088"
variation 2150
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:56225811"
variation 2162
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="t"
/db_xref="dbSNP:377006926"
variation 2173
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:370309420"
variation 2184
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:372910380"
variation 2191
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:139822416"
exon 2202..2311
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="alignment:Splign:1.39.8"
variation 2215
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:373570386"
variation 2264
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="g"
/db_xref="dbSNP:200363872"
variation 2287
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:147779020"
STS 2312..2551
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/standard_name="MERTK"
/db_xref="UniSTS:505021"
exon 2312..2471
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="alignment:Splign:1.39.8"
variation 2315
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:146886088"
variation 2317
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:201621067"
variation 2319
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="g"
/db_xref="dbSNP:201840939"
variation 2326
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:150046180"
variation 2331
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="g"
/db_xref="dbSNP:142721656"
variation 2375
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:149178674"
variation 2380
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:372801864"
variation 2394
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:200576584"
variation 2395
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:370526555"
variation 2427
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:147899488"
variation 2445
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:387907314"
variation 2464
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="g"
/db_xref="dbSNP:374847434"
exon 2472..2608
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="alignment:Splign:1.39.8"
variation 2488
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:185118842"
variation 2490
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:138971326"
variation 2537
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="g"
/db_xref="dbSNP:80350193"
variation 2557
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:141361084"
variation 2589
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="g"
/db_xref="dbSNP:55924349"
exon 2609..3626
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/inference="alignment:Splign:1.39.8"
variation 2651
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="g"
/db_xref="dbSNP:370956458"
variation 2655
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:148926887"
variation 2667
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:375585784"
variation 2706
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:143190615"
variation 2715
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:2230516"
variation 2729
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:200167420"
variation 2730
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:2230517"
variation 2734
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:377341255"
variation 2759
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:139897984"
variation 2761
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:147916288"
variation 2784
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:1131246"
variation 2800
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:147051895"
variation 2842
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:202205484"
variation 2848
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:149131360"
variation 2880
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="g"
/db_xref="dbSNP:189194232"
variation 2891
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:148056914"
variation 2899
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="c"
/db_xref="dbSNP:370413166"
variation 2910
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="c"
/db_xref="dbSNP:375163842"
variation 2918
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:144771372"
variation 2926
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:372199408"
variation 2931
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:141647333"
variation 2973
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:148261231"
variation 2981
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:375528521"
variation 2995
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:201460398"
variation 2996
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:144406499"
variation 3012
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="c"
/db_xref="dbSNP:368880991"
variation 3038
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:10205793"
variation 3050
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:151054792"
variation 3058
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:377207025"
variation 3089
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:140956730"
variation 3090
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:200644454"
STS 3113..3255
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/standard_name="STS-U08023"
/db_xref="UniSTS:33373"
variation 3133
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:375195445"
variation 3157
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:200622481"
variation 3204..3205
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace=""
/replace="t"
/db_xref="dbSNP:147500027"
variation 3208..3209
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace=""
/replace="t"
/db_xref="dbSNP:67811207"
variation 3233
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:367613631"
STS 3237..3428
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/standard_name="RH70546"
/db_xref="UniSTS:29192"
variation 3245
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:186330340"
variation 3315
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="c"
/replace="t"
/db_xref="dbSNP:79712097"
polyA_signal 3348..3353
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
polyA_site 3373
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/experiment="experimental evidence, no additional details
recorded"
STS 3405..3605
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/standard_name="D2S1987"
/db_xref="UniSTS:14468"
variation 3543
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="c"
/db_xref="dbSNP:79733690"
variation 3561
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:191525605"
variation 3598
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
/replace="a"
/replace="g"
/db_xref="dbSNP:111564226"
polyA_signal 3606..3611
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
polyA_site 3626
/gene="MERTK"
/gene_synonym="c-mer; MER; RP38"
ORIGIN
actcactgcccgggccgcccggacagggagcttcgctggcgcgcttggccggcgacaggacaggttcgggacgtccatctgtccatccgtccggagagaaattacagatccgcagccccgggatggggccggccccgctgccgctgctgctgggcctcttcctccccgcgctctggcgtagagctatcactgaggcaagggaagaagccaagccttacccgctattcccgggaccttttccagggagcctgcaaactgaccacacaccgctgttatcccttcctcacgccagtgggtaccagcctgccttgatgttttcaccaacccagcctggaagaccacatacaggaaacgtagccattccccaggtgacctctgtcgaatcaaagcccctaccgcctcttgccttcaaacacacagttggacacataatactttctgaacataaaggtgtcaaatttaattgctcaatcagtgtacctaatatataccaggacaccacaatttcttggtggaaagatgggaaggaattgcttggggcacatcatgcaattacacagttttatccagatgatgaagttacagcaataatcgcttccttcagcataaccagtgtgcagcgttcagacaatgggtcgtatatctgtaagatgaaaataaacaatgaagagatcgtgtctgatcccatctacatcgaagtacaaggacttcctcactttactaagcagcctgagagcatgaatgtcaccagaaacacagccttcaacctcacctgtcaggctgtgggcccgcctgagcccgtcaacattttctgggttcaaaacagtagccgtgttaacgaacagcctgaaaaatccccctccgtgctaactgttccaggcctgacggagatggcggtcttcagttgtgaggcccacaatgacaaagggctgaccgtgtccaagggagtgcagatcaacatcaaagcaattccctccccaccaactgaagtcagcatccgtaacagcactgcacacagcattctgatctcctgggttcctggttttgatggatactccccgttcaggaattgcagcattcaggtcaaggaagctgatccgctgagtaatggctcagtcatgatttttaacacctctgccttaccacatctgtaccaaatcaagcagctgcaagccctggctaattacagcattggtgtttcctgcatgaatgaaataggctggtctgcagtgagcccttggattctagccagcacgactgaaggagccccatcagtagcacctttaaatgtcactgtgtttctgaatgaatctagtgataatgtggacatcagatggatgaagcctccgactaagcagcaggatggagaactggtgggctaccggatatcccacgtgtggcagagtgcagggatttccaaagagctcttggaggaagttggccagaatggcagccgagctcggatctctgttcaagtccacaatgctacgtgcacagtgaggattgcagccgtcaccagagggggagttgggcccttcagtgatccagtgaaaatatttatccctgcacacggttgggtagattatgccccctcttcaactccggcgcctggcaacgcagatcctgtgctcatcatctttggctgcttttgtggatttattttgattgggttgattttatacatctccttggccatcagaaaaagagtccaggagacaaagtttgggaatgcattcacagaggaggattctgaattagtggtgaattatatagcaaagaaatccttctgtcggcgagccattgaacttaccttacatagcttgggagtcagtgaggaactacaaaataaactagaagatgttgtgattgacaggaatcttctaattcttggaaaaattctgggtgaaggagagtttgggtctgtaatggaaggaaatcttaagcaggaagatgggacctctctgaaagtggcagtgaagaccatgaagttggacaactcttcacagcgggagatcgaggagtttctcagtgaggcagcgtgcatgaaagacttcagccacccaaatgtcattcgacttctaggtgtgtgtatagaaatgagctctcaaggcatcccaaagcccatggtaattttacccttcatgaaatacggggacctgcatacttacttactttattcccgattggagacaggaccaaagcatattcctctgcagacactattgaagttcatggtggatattgccctgggaatggagtatctgagcaacaggaattttcttcatcgagatttagctgctcgaaactgcatgttgcgagatgacatgactgtctgtgttgcggacttcggcctctctaagaagatttacagtggcgattattaccgccaaggccgcattgctaagatgcctgttaaatggatcgccatagaaagtcttgcagaccgagtctacacaagtaaaagtgatgtgtgggcatttggcgtgaccatgtgggaaatagctacgcggggaatgactccctatcctggggtccagaaccatgagatgtatgactatcttctccatggccacaggttgaagcagcccgaagactgcctggatgaactgtatgaaataatgtactcttgctggagaaccgatcccttagaccgccccaccttttcagtattgaggctgcagctagaaaaactcttagaaagtttgcctgacgttcggaaccaagcagacgttatttacgtcaatacacagttgctggagagctctgagggcctggcccagggctccacccttgctccactggacttgaacatcgaccctgactctataattgcctcctgcactccccgcgctgccatcagtgtggtcacagcagaagttcatgacagcaaacctcatgaaggacggtacatcctgaatgggggcagtgaggaatgggaagatctgacttctgccccctctgctgcagtcacagctgaaaagaacagtgttttaccgggggagagacttgttaggaatggggtctcctggtcccattcgagcatgctgcccttgggaagctcattgcccgatgaacttttgtttgctgacgactcctcagaaggctcagaagtcctgatgtgaggagaggtgcggggagacattccaaaaatcaagccaattcttctgctgtaggagaatccaattgtacctgatgtttttggtatttgtcttccttaccaagtgaactccatggccccaaagcaccagatgaatgttgttaagtaagctgtcattaaaaatacataatatatatttatttaaagagaaaaaatatgtgtatatcatggaaaaagacaaggatattttaataaaacattacttatttcatttcacttatcttgcatatcttaaaattaagcttcagctgctccttgatattaacatttgtacagagttgaagttgttttttcaagttcttttctttttcatgactattaaatgtaaaaatatttgtaaaatgaaatgccatatttgacttggcttctggtcttgatgtatttgataagaatgattcattcaatgtttaaagttgtataactgattaattttctgatatggcttcctaataaaatatgaataaggaagaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:10461 -> Molecular function: GO:0004714 [transmembrane receptor protein tyrosine kinase activity] evidence: IEA
GeneID:10461 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:10461 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:10461 -> Biological process: GO:0001779 [natural killer cell differentiation] evidence: IEA
GeneID:10461 -> Biological process: GO:0006468 [protein phosphorylation] evidence: TAS
GeneID:10461 -> Biological process: GO:0006909 [phagocytosis] evidence: IMP
GeneID:10461 -> Biological process: GO:0007166 [cell surface receptor signaling pathway] evidence: TAS
GeneID:10461 -> Biological process: GO:0007267 [cell-cell signaling] evidence: TAS
GeneID:10461 -> Biological process: GO:0007283 [spermatogenesis] evidence: IEA
GeneID:10461 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS
GeneID:10461 -> Biological process: GO:0030168 [platelet activation] evidence: IEA
GeneID:10461 -> Biological process: GO:0032940 [secretion by cell] evidence: IEA
GeneID:10461 -> Biological process: GO:0034446 [substrate adhesion-dependent cell spreading] evidence: IEA
GeneID:10461 -> Biological process: GO:0043277 [apoptotic cell clearance] evidence: IEA
GeneID:10461 -> Biological process: GO:0043491 [protein kinase B signaling cascade] evidence: IEA
GeneID:10461 -> Biological process: GO:0050766 [positive regulation of phagocytosis] evidence: IDA
GeneID:10461 -> Biological process: GO:0050900 [leukocyte migration] evidence: TAS
GeneID:10461 -> Biological process: GO:0051250 [negative regulation of lymphocyte activation] evidence: IEA
GeneID:10461 -> Biological process: GO:0060041 [retina development in camera-type eye] evidence: IEA
GeneID:10461 -> Biological process: GO:0060068 [vagina development] evidence: IEA
GeneID:10461 -> Cellular component: GO:0001750 [photoreceptor outer segment] evidence: IEA
GeneID:10461 -> Cellular component: GO:0005615 [extracellular space] evidence: IDA
GeneID:10461 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:10461 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
GeneID:10461 -> Cellular component: GO:0005887 [integral to plasma membrane] evidence: TAS
GeneID:10461 -> Cellular component: GO:0016028 [rhabdomere] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_006334 -> EC 2.7.10.1
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.