Home |
Help |
Advanced search
2025-05-09 16:58:05, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004685 5222 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens myotubularin related protein 6 (MTMR6), mRNA.
ACCESSION NM_004685
VERSION NM_004685.3 GI:134142347
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 5222)
AUTHORS Mochizuki,Y., Ohashi,R., Kawamura,T., Iwanari,H., Kodama,T.,
Naito,M. and Hamakubo,T.
TITLE Phosphatidylinositol 3-phosphatase myotubularin-related protein 6
(MTMR6) is regulated by small GTPase Rab1B in the early secretory
and autophagic pathways
JOURNAL J. Biol. Chem. 288 (2), 1009-1021 (2013)
PUBMED 23188820
REMARK GeneRIF: results indicate that the cellular localization of MTMR6
is regulated by Rab1B in the early secretory and autophagic
pathways
REFERENCE 2 (bases 1 to 5222)
AUTHORS Zou,J., Chang,S.C., Marjanovic,J. and Majerus,P.W.
TITLE MTMR9 increases MTMR6 enzyme activity, stability, and role in
apoptosis
JOURNAL J. Biol. Chem. 284 (4), 2064-2071 (2009)
PUBMED 19038970
REMARK GeneRIF: MTMR9 greatly enhances the functions of MTMR6
REFERENCE 3 (bases 1 to 5222)
AUTHORS Srivastava,S., Ko,K., Choudhury,P., Li,Z., Johnson,A.K.,
Nadkarni,V., Unutmaz,D., Coetzee,W.A. and Skolnik,E.Y.
TITLE Phosphatidylinositol-3 phosphatase myotubularin-related protein 6
negatively regulates CD4 T cells
JOURNAL Mol. Cell. Biol. 26 (15), 5595-5602 (2006)
PUBMED 16847315
REMARK GeneRIF: Data show that KCa3.1, which is critical for Ca2+ influx
in reactivated naive T cells and central memory T cells, requires
phosphatidylinositol-3 phosphatase for activation and is inhibited
by PI(3)P phosphatase myotubularin-related protein 6 (MTMR6).
REFERENCE 4 (bases 1 to 5222)
AUTHORS Srivastava,S., Li,Z., Lin,L., Liu,G., Ko,K., Coetzee,W.A. and
Skolnik,E.Y.
TITLE The phosphatidylinositol 3-phosphate phosphatase myotubularin-
related protein 6 (MTMR6) is a negative regulator of the
Ca2+-activated K+ channel KCa3.1
JOURNAL Mol. Cell. Biol. 25 (9), 3630-3638 (2005)
PUBMED 15831468
REFERENCE 5 (bases 1 to 5222)
AUTHORS Dunham,A., Matthews,L.H., Burton,J., Ashurst,J.L., Howe,K.L.,
Ashcroft,K.J., Beare,D.M., Burford,D.C., Hunt,S.E.,
Griffiths-Jones,S., Jones,M.C., Keenan,S.J., Oliver,K., Scott,C.E.,
Ainscough,R., Almeida,J.P., Ambrose,K.D., Andrews,D.T.,
Ashwell,R.I., Babbage,A.K., Bagguley,C.L., Bailey,J., Bannerjee,R.,
Barlow,K.F., Bates,K., Beasley,H., Bird,C.P., Bray-Allen,S.,
Brown,A.J., Brown,J.Y., Burrill,W., Carder,C., Carter,N.P.,
Chapman,J.C., Clamp,M.E., Clark,S.Y., Clarke,G., Clee,C.M.,
Clegg,S.C., Cobley,V., Collins,J.E., Corby,N., Coville,G.J.,
Deloukas,P., Dhami,P., Dunham,I., Dunn,M., Earthrowl,M.E.,
Ellington,A.G., Faulkner,L., Frankish,A.G., Frankland,J.,
French,L., Garner,P., Garnett,J., Gilbert,J.G., Gilson,C.J.,
Ghori,J., Grafham,D.V., Gribble,S.M., Griffiths,C., Hall,R.E.,
Hammond,S., Harley,J.L., Hart,E.A., Heath,P.D., Howden,P.J.,
Huckle,E.J., Hunt,P.J., Hunt,A.R., Johnson,C., Johnson,D., Kay,M.,
Kimberley,A.M., King,A., Laird,G.K., Langford,C.J., Lawlor,S.,
Leongamornlert,D.A., Lloyd,D.M., Lloyd,C., Loveland,J.E.,
Lovell,J., Martin,S., Mashreghi-Mohammadi,M., McLaren,S.J.,
McMurray,A., Milne,S., Moore,M.J., Nickerson,T., Palmer,S.A.,
Pearce,A.V., Peck,A.I., Pelan,S., Phillimore,B., Porter,K.M.,
Rice,C.M., Searle,S., Sehra,H.K., Shownkeen,R., Skuce,C.D.,
Smith,M., Steward,C.A., Sycamore,N., Tester,J., Thomas,D.W.,
Tracey,A., Tromans,A., Tubby,B., Wall,M., Wallis,J.M., West,A.P.,
Whitehead,S.L., Willey,D.L., Wilming,L., Wray,P.W., Wright,M.W.,
Young,L., Coulson,A., Durbin,R., Hubbard,T., Sulston,J.E., Beck,S.,
Bentley,D.R., Rogers,J. and Ross,M.T.
TITLE The DNA sequence and analysis of human chromosome 13
JOURNAL Nature 428 (6982), 522-528 (2004)
PUBMED 15057823
REFERENCE 6 (bases 1 to 5222)
AUTHORS Mochizuki,Y. and Majerus,P.W.
TITLE Characterization of myotubularin-related protein 7 and its binding
partner, myotubularin-related protein 9
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 100 (17), 9768-9773 (2003)
PUBMED 12890864
REFERENCE 7 (bases 1 to 5222)
AUTHORS Nandurkar,H.H., Layton,M., Laporte,J., Selan,C., Corcoran,L.,
Caldwell,K.K., Mochizuki,Y., Majerus,P.W. and Mitchell,C.A.
TITLE Identification of myotubularin as the lipid phosphatase catalytic
subunit associated with the 3-phosphatase adapter protein, 3-PAP
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 100 (15), 8660-8665 (2003)
PUBMED 12847286
REMARK GeneRIF: Identification of myotubularin as the lipid phosphatase
catalytic subunit associated with the 3-phosphatase adapter
protein, 3-PAP.
REFERENCE 8 (bases 1 to 5222)
AUTHORS Schaletzky,J., Dove,S.K., Short,B., Lorenzo,O., Clague,M.J. and
Barr,F.A.
TITLE Phosphatidylinositol-5-phosphate activation and conserved substrate
specificity of the myotubularin phosphatidylinositol 3-phosphatases
JOURNAL Curr. Biol. 13 (6), 504-509 (2003)
PUBMED 12646134
REMARK GeneRIF: investigation of MTM1 and MTMR6 and finding that they use
PtdIns(3,5)P2 in addition to PtdIns3P as a substrate in vitro
REFERENCE 9 (bases 1 to 5222)
AUTHORS Simpson,J.C., Wellenreuther,R., Poustka,A., Pepperkok,R. and
Wiemann,S.
TITLE Systematic subcellular localization of novel proteins identified by
large-scale cDNA sequencing
JOURNAL EMBO Rep. 1 (3), 287-292 (2000)
PUBMED 11256614
REFERENCE 10 (bases 1 to 5222)
AUTHORS Laporte,J., Blondeau,F., Buj-Bello,A., Tentler,D., Kretz,C.,
Dahl,N. and Mandel,J.L.
TITLE Characterization of the myotubularin dual specificity phosphatase
gene family from yeast to human
JOURNAL Hum. Mol. Genet. 7 (11), 1703-1712 (1998)
PUBMED 9736772
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AL590787.24, BC040012.1 and AL044815.1.
On Mar 27, 2007 this sequence version replaced gi:37537693.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data because no single transcript was available
for the full length of the gene. The extent of this transcript is
supported by transcript alignments.
##Evidence-Data-START##
Transcript exon combination :: AL832017.2, BC040012.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-128 AL590787.24 72714-72841 c
129-1273 BC040012.1 1-1145
1274-1274 AL590787.24 43025-43025 c
1275-1821 BC040012.1 1147-1693
1822-1822 AL590787.24 37026-37026 c
1823-2347 BC040012.1 1695-2219
2348-3952 AL590787.24 32740-34344 c
3953-4185 BC040012.1 3825-4057
4186-4999 AL590787.24 31693-32506 c
5000-5222 AL044815.1 122-344
FEATURES Location/Qualifiers
source 1..5222
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="13"
/map="13q12"
gene 1..5222
/gene="MTMR6"
/note="myotubularin related protein 6"
/db_xref="GeneID:9107"
/db_xref="HGNC:7453"
/db_xref="MIM:603561"
exon 1..343
/gene="MTMR6"
/inference="alignment:Splign:1.39.8"
variation 49
/gene="MTMR6"
/replace="c"
/replace="t"
/db_xref="dbSNP:3809334"
variation 128
/gene="MTMR6"
/replace="c"
/replace="t"
/db_xref="dbSNP:3809335"
misc_feature 305..307
/gene="MTMR6"
/note="upstream in-frame stop codon"
CDS 320..2185
/gene="MTMR6"
/codon_start=1
/product="myotubularin-related protein 6"
/protein_id="NP_004676.3"
/db_xref="GI:134142348"
/db_xref="CCDS:CCDS9313.1"
/db_xref="GeneID:9107"
/db_xref="HGNC:7453"
/db_xref="MIM:603561"
/translation="
MEHIRTTKVEQVKLLDRFSTSNKSLTGTLYLTATHLLFIDSHQKETWILHHHIASVEKLALTTSGCPLVIQCKNFRTVHFIVPRERDCHDIYNSLLQLSKQAKYEDLYAFSYNPKQNDSERLQGWQLIDLAEEYKRMGVPNSHWQLSDANRDYKICETYPRELYVPRIASKPIIVGSSKFRSKGRFPVLSYYHQDKEAAICRCSQPLSGFSARCLEDEHLLQAISKANPVNRYMYVMDTRPKLNAMANRAAGKGYENEDNYSNIRFQFVGIENIHVMRSSLQKLLEVNGTKGLSVNDFYSGLESSGWLRHIKAVMDAAIFLAKAITVENASVLVHCSDGWDRTSQVCSLGSLLLDSYYRTIKGFMVLIEKDWISFGHKFSERCGQLDGDPKEVSPVFTQFLECVWHLTEQFPQAFEFSEAFLLQIHEHIHSCQFGNFLGNCQKEREELKLKEKTYSLWPFLLEDQKKYLNPLYSSESHRFTVLEPNTVSFNFKFWRNMYHQFDRTLHPRQSVFNIIMNMNEQNKQLEKDIKDLESKIKQRKNKQTDGILTKELLHSVHPESPNLKTSLCFKEQTLLPVNDALRTIEGSSPADNRYSEYAEEFSKSEPAVVSLEYGVARMTC
"
misc_feature 776..1126
/gene="MTMR6"
/note="Myotubularin-related; Region: Myotub-related;
pfam06602"
/db_xref="CDD:203483"
misc_feature 1061..1072
/gene="MTMR6"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9Y217.3);
Region: Substrate binding (By similarity)"
misc_feature 1136..1141
/gene="MTMR6"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9Y217.3);
Region: Substrate binding (By similarity)"
misc_feature 1307..1471
/gene="MTMR6"
/note="Myotubularin Y_phosphatase-like; Region:
Y_phosphatase_m; pfam13849"
/db_xref="CDD:206020"
misc_feature 1325..1345
/gene="MTMR6"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9Y217.3);
Region: Substrate binding (By similarity)"
misc_feature 2000..2002
/gene="MTMR6"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9Y217.3); phosphorylation site"
misc_feature 2000..2002
/gene="MTMR6"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 2084..2086
/gene="MTMR6"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9Y217.3); phosphorylation site"
exon 344..460
/gene="MTMR6"
/inference="alignment:Splign:1.39.8"
exon 461..623
/gene="MTMR6"
/inference="alignment:Splign:1.39.8"
exon 624..781
/gene="MTMR6"
/inference="alignment:Splign:1.39.8"
exon 782..910
/gene="MTMR6"
/inference="alignment:Splign:1.39.8"
exon 911..1045
/gene="MTMR6"
/inference="alignment:Splign:1.39.8"
exon 1046..1178
/gene="MTMR6"
/inference="alignment:Splign:1.39.8"
exon 1179..1288
/gene="MTMR6"
/inference="alignment:Splign:1.39.8"
exon 1289..1414
/gene="MTMR6"
/inference="alignment:Splign:1.39.8"
exon 1415..1464
/gene="MTMR6"
/inference="alignment:Splign:1.39.8"
exon 1465..1665
/gene="MTMR6"
/inference="alignment:Splign:1.39.8"
exon 1666..1797
/gene="MTMR6"
/inference="alignment:Splign:1.39.8"
exon 1798..1924
/gene="MTMR6"
/inference="alignment:Splign:1.39.8"
exon 1925..5216
/gene="MTMR6"
/inference="alignment:Splign:1.39.8"
STS 2126..2248
/gene="MTMR6"
/standard_name="D13S824E"
/db_xref="UniSTS:151501"
STS 3904..4009
/gene="MTMR6"
/standard_name="A007G03"
/db_xref="UniSTS:56899"
variation 3952
/gene="MTMR6"
/replace="c"
/replace="t"
/db_xref="dbSNP:8262"
polyA_signal 4127..4132
/gene="MTMR6"
polyA_site 4145
/gene="MTMR6"
polyA_site 4185
/gene="MTMR6"
STS 4899..5173
/gene="MTMR6"
/standard_name="D13S1453"
/db_xref="UniSTS:20423"
STS 4948..5088
/gene="MTMR6"
/standard_name="RH11246"
/db_xref="UniSTS:78255"
polyA_signal 5171..5176
/gene="MTMR6"
polyA_site 5216
/gene="MTMR6"
ORIGIN
cagtaccggcctcctccagcagggggcgctgtgggatccgccgctgtccgggacgaaccagcaagccgctctcggtccacacacgctctgtctgcctgccccgagtcccccgggaggccgcggggtttggggaagtgtttctaggagacggcgctcaccggctgcacctgcgccgttgacgccaccggggccggcagacagacccgcggcgctggctggtggagggagttcccgcttgctctctgtcgctgtcaccgccctgtttctgtagccgtatggtacgcctgtgagaccggctgccggctgacgtctccttgcgatggagcatatccggacgaccaaggtcgaacaagtaaaattacttgaccgattcagtaccagcaacaagtcattaacaggaacactgtatcttacggctacacatctattatttatcgactctcatcaaaaagaaacctggatattacaccaccatattgcctcagtagagaaacttgctttgactacttctggatgcccccttgtgatacagtgcaagaacttcagaactgtgcatttcattgttcccagagaaagagattgccatgatatttacaactctttgctacaactgtcaaaacaagcaaaatatgaagatctctatgcattttcttataatcccaaacaaaatgattcagaacgactacaaggctggcagctcattgatctcgctgaggaatataagaggatgggagtgccaaactcacactggcagttgtctgatgccaaccgggactacaagatttgtgaaacttaccccagagaactttatgttccccggatagcaagcaaaccaataattgttggtagttccaagttccggagcaagggaagattcccagttctttcctactatcatcaagataaggaggctgccatttgtcgatgtagtcagccactctctggattcagtgccaggtgcctggaggatgaacatttgcttcaagccattagtaaagccaatccagtcaatcgctatatgtacgtcatggataccaggccaaaactgaatgcaatggccaacagagcagctggaaaaggttatgaaaatgaagacaactattccaatattagatttcagtttgttggaattgaaaatattcatgtcatgaggtccagccttcagaaattattggaagtcaatggcactaaagggctttctgtcaatgatttctactccggtttggagagctcgggatggcttcgccatatcaaagctgttatggatgctgcaatcttcttggccaaagcaataacagttgaaaatgcaagtgtgttggtgcattgttccgatggttgggataggacttcccaggtttgttccctgggttctcttttattggattcctactacaggacaatcaaaggattcatggttttaatagaaaaggattggatctcttttggacataaattttcagagaggtgtggccagttggatggtgacccaaaggaagtctcaccagtgtttactcagttcttggaatgtgtgtggcatttgaccgaacagtttccacaagcctttgaattcagtgaagcatttcttcttcagatccatgagcatattcattcatgccagtttggaaacttccttggaaattgtcagaaggaaagagaagagctcaagttgaaggagaagacttattccctgtggccatttcttttggaagaccaaaagaagtacttaaatcctctctacagttccgaatctcacagatttacagttttggagccaaatacagtatctttcaattttaagttttggaggaacatgtaccatcaatttgatcgaacactgcatcctaggcagtctgtatttaatataattatgaatatgaatgagcaaaataaacaattagagaaagatattaaagacctagaatctaaaattaaacaacgcaaaaataagcaaacagatggcatcctcaccaaggaattgttacattcagttcatcctgaatcacctaacctcaaaacttccctgtgttttaaagagcagactctgctacccgtaaatgatgctcttcgaactatagagggcagcagcccggcagataatcgttatagtgaatatgcagaagagttttctaaatcagaacctgctgtggtcagcttagagtatggtgtggcaagaatgacttgttagactcatagagttttttctgcaatgattgcagtacaagaaaaggattattgtgaggatggtctgtaagcataaccaaaaggaatttgtctaataacaattttagggtttaacagtaggctaatagttgaaggaaggataataactacccttgtgagagaaataagtcattttaattgcatttccagcaaggaatgacattcagttctgtaagaaatgagtggtatttgatgtatttactcaaaacacaatttgcactgtacactagtgaattgacgtttatgatttatgttaattcagccaaacataaataaccttccttaagtacaatttaacttcaagaaaacaaaatttgacaacatagtttcttaataaatgatatggcatgtactttcaattatgtagctttgtaactatgaatatttacatattttgccttttagtgatatttaatgttaaagtgccatgaaaaatatttctaagaaagccttaaattcccagtggattctttacccttaagttttacagcctacaacaagattttttgttttgtttttcttctggtcagccttgttttgtttgtaaagaattgtgctctcattactgctgggggtgcatgctacaatacttctatataaacacttgtagaagtacactgttcacgtttagcctgccccacttttgtattcaaaattaatgaaactgaaggtttattctgatcataatttgtttagtgctacatttgataatttattatttacagcttagaatattgatttcttgaatacgtataagcacatttgactgtcttttatatatggattactgcattccattgattcttattttgtggttggctttatttctttcacaactgtgtaagtttaaagagctaaagctctaaaactgttctgagaaacaatgaatagtacatgtatatgtatatttttaaactgccttattgctcaatgagttgctgttcctggagtatctaactttcagtttactcaaaaacttttgggtaaataaaaaagggaagtacagatagtttaggttgtgcatggttgcatgaattttgaagtcatttctatgtggagcattatttttcttcttgttaaatatagaaaaaaaaagagattctagtacaaagttactgtttaacaaaagcaacataaactctgggaaagatttcattttgccatgttatatttactgtttattctgtgtactagtacatatctttaaattaccaaaaaacaagaaacaaaacataaaaaccccaaaactatcacttggaattagcaatatcacccaactggctttaaaattgaaaatttaaataacatggtggcatgaagtacaattcgagtattaggcaatttgcatagtgttcctcatgctactttctgttacacctctattatattagttttgaatataaacatctttttcagaccaaaaaaaactttattgtatgagagcttatcttatcctgtttatttttccaatgcttttctgtaatacattatgtaatttaaaaaatattcctttttaaacagcaacagaaatgcactataaaatatagtatgtgattaaccaatcctgcttccatatttaagcactgggaatggaaacttaatctctgtgactacaaagggaagtttttgtgccttggtgttccagtcactgattgtggttttagaatcttctgtggctgacttcttgtattcaactctggtttattatcttaatcttcaacttcagacatatatttgtgtgtttatatgctcacaggtggactgagaaatcagttacatcttaagtgacctacagggtatatgttggcaaaagcagactgtgtatatgtcttataaagttgaatttatgttcagtgtgtttggaagtgtatagcatgtaaattatttcatatatgatttaaaggtaattaaatgttcacattttactttgaatgtttttcttctggataaaacaaatggaatcaagttgtagttgttttttttttcttctcacctaggcaagtagacttgcccattacattaacataacagcataaggtttgaggagtttattttccaaaagtttgttgataaataatacctgtttcatacaaaaataatttccagaatatttaaaataggtatagtgggctaaaaggcccatcagatgtaggtaataatgtcattaagttttcattttgttcctgtcacttgcttatattacaatcactatttttttgtgcccttgccaacttgatggaaggcagggtccattgagtacaaacattcgaggtgaaatgtctctccaaaggcagatctggatgtaaatatgaggaagaaaataactggctgacaagaggataattttattgagggtgttttgaaaaggtcagctaggctagaagtagctcagggaatcttgagtaaagatgaagggaactcttttaaaacaaattcaatttatttggtcgggtagcagagcagggaggtggtgtcagtcaagcctgttttgaaacattttttgcagaaggtcagctttaaaatattgaaaaatttccagttgacatgctaagttggattaaatgctgatcatttataaaactatatagttgctgcaaaagtaattggggcttttgccattgaaagtgatgacaaaaaccgcaattacttttgcaccaacctaatactacagttgcagacttttattagtgacgctgatcttcattagtcaagttttagttattttgttggcttttccatgtagaattccaagtgacattaacatactttgattaattaaagaaaatttggagactgtttaagatatatgtctagatatcaatgtaaactataagctttaggaacttacatctagaagaaagcctggaatctagaataattatctcaaaaaaaagtatatataccattgtacttgatataagaaaatgtaaacatgaaaccttgacattttaataaacagtatttgtgctactctagttatttctaggaaagtaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:9107 -> Molecular function: GO:0004722 [protein serine/threonine phosphatase activity] evidence: NAS
GeneID:9107 -> Molecular function: GO:0004725 [protein tyrosine phosphatase activity] evidence: NAS
GeneID:9107 -> Molecular function: GO:0015269 [calcium-activated potassium channel activity] evidence: IDA
GeneID:9107 -> Biological process: GO:0006470 [protein dephosphorylation] evidence: NAS
GeneID:9107 -> Biological process: GO:0006644 [phospholipid metabolic process] evidence: TAS
GeneID:9107 -> Biological process: GO:0006661 [phosphatidylinositol biosynthetic process] evidence: TAS
GeneID:9107 -> Biological process: GO:0035335 [peptidyl-tyrosine dephosphorylation] evidence: NAS
GeneID:9107 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
GeneID:9107 -> Cellular component: GO:0005635 [nuclear envelope] evidence: IEA
GeneID:9107 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:9107 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.