Home |
Help |
Advanced search
2025-05-09 16:42:48, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004133 4101 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens hepatocyte nuclear factor 4, gamma (HNF4G), mRNA.
ACCESSION NM_004133
VERSION NM_004133.4 GI:115583653
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 4101)
AUTHORS Berndt,S.I., Gustafsson,S., Magi,R., Ganna,A., Wheeler,E.,
Feitosa,M.F., Justice,A.E., Monda,K.L., Croteau-Chonka,D.C.,
Day,F.R., Esko,T., Fall,T., Ferreira,T., Gentilini,D.,
Jackson,A.U., Luan,J., Randall,J.C., Vedantam,S., Willer,C.J.,
Winkler,T.W., Wood,A.R., Workalemahu,T., Hu,Y.J., Lee,S.H.,
Liang,L., Lin,D.Y., Min,J.L., Neale,B.M., Thorleifsson,G., Yang,J.,
Albrecht,E., Amin,N., Bragg-Gresham,J.L., Cadby,G., den Heijer,M.,
Eklund,N., Fischer,K., Goel,A., Hottenga,J.J., Huffman,J.E.,
Jarick,I., Johansson,A., Johnson,T., Kanoni,S., Kleber,M.E.,
Konig,I.R., Kristiansson,K., Kutalik,Z., Lamina,C., Lecoeur,C.,
Li,G., Mangino,M., McArdle,W.L., Medina-Gomez,C.,
Muller-Nurasyid,M., Ngwa,J.S., Nolte,I.M., Paternoster,L.,
Pechlivanis,S., Perola,M., Peters,M.J., Preuss,M., Rose,L.M.,
Shi,J., Shungin,D., Smith,A.V., Strawbridge,R.J., Surakka,I.,
Teumer,A., Trip,M.D., Tyrer,J., Van Vliet-Ostaptchouk,J.V.,
Vandenput,L., Waite,L.L., Zhao,J.H., Absher,D., Asselbergs,F.W.,
Atalay,M., Attwood,A.P., Balmforth,A.J., Basart,H., Beilby,J.,
Bonnycastle,L.L., Brambilla,P., Bruinenberg,M., Campbell,H.,
Chasman,D.I., Chines,P.S., Collins,F.S., Connell,J.M.,
Cookson,W.O., de Faire,U., de Vegt,F., Dei,M., Dimitriou,M.,
Edkins,S., Estrada,K., Evans,D.M., Farrall,M., Ferrario,M.M.,
Ferrieres,J., Franke,L., Frau,F., Gejman,P.V., Grallert,H.,
Gronberg,H., Gudnason,V., Hall,A.S., Hall,P., Hartikainen,A.L.,
Hayward,C., Heard-Costa,N.L., Heath,A.C., Hebebrand,J., Homuth,G.,
Hu,F.B., Hunt,S.E., Hypponen,E., Iribarren,C., Jacobs,K.B.,
Jansson,J.O., Jula,A., Kahonen,M., Kathiresan,S., Kee,F.,
Khaw,K.T., Kivimaki,M., Koenig,W., Kraja,A.T., Kumari,M.,
Kuulasmaa,K., Kuusisto,J., Laitinen,J.H., Lakka,T.A.,
Langenberg,C., Launer,L.J., Lind,L., Lindstrom,J., Liu,J.,
Liuzzi,A., Lokki,M.L., Lorentzon,M., Madden,P.A., Magnusson,P.K.,
Manunta,P., Marek,D., Marz,W., Mateo Leach,I., McKnight,B.,
Medland,S.E., Mihailov,E., Milani,L., Montgomery,G.W., Mooser,V.,
Muhleisen,T.W., Munroe,P.B., Musk,A.W., Narisu,N., Navis,G.,
Nicholson,G., Nohr,E.A., Ong,K.K., Oostra,B.A., Palmer,C.N.,
Palotie,A., Peden,J.F., Pedersen,N., Peters,A., Polasek,O.,
Pouta,A., Pramstaller,P.P., Prokopenko,I., Putter,C.,
Radhakrishnan,A., Raitakari,O., Rendon,A., Rivadeneira,F.,
Rudan,I., Saaristo,T.E., Sambrook,J.G., Sanders,A.R., Sanna,S.,
Saramies,J., Schipf,S., Schreiber,S., Schunkert,H., Shin,S.Y.,
Signorini,S., Sinisalo,J., Skrobek,B., Soranzo,N., Stancakova,A.,
Stark,K., Stephens,J.C., Stirrups,K., Stolk,R.P., Stumvoll,M.,
Swift,A.J., Theodoraki,E.V., Thorand,B., Tregouet,D.A., Tremoli,E.,
Van der Klauw,M.M., van Meurs,J.B., Vermeulen,S.H., Viikari,J.,
Virtamo,J., Vitart,V., Waeber,G., Wang,Z., Widen,E., Wild,S.H.,
Willemsen,G., Winkelmann,B.R., Witteman,J.C., Wolffenbuttel,B.H.,
Wong,A., Wright,A.F., Zillikens,M.C., Amouyel,P., Boehm,B.O.,
Boerwinkle,E., Boomsma,D.I., Caulfield,M.J., Chanock,S.J.,
Cupples,L.A., Cusi,D., Dedoussis,G.V., Erdmann,J., Eriksson,J.G.,
Franks,P.W., Froguel,P., Gieger,C., Gyllensten,U., Hamsten,A.,
Harris,T.B., Hengstenberg,C., Hicks,A.A., Hingorani,A., Hinney,A.,
Hofman,A., Hovingh,K.G., Hveem,K., Illig,T., Jarvelin,M.R.,
Jockel,K.H., Keinanen-Kiukaanniemi,S.M., Kiemeney,L.A., Kuh,D.,
Laakso,M., Lehtimaki,T., Levinson,D.F., Martin,N.G., Metspalu,A.,
Morris,A.D., Nieminen,M.S., Njolstad,I., Ohlsson,C.,
Oldehinkel,A.J., Ouwehand,W.H., Palmer,L.J., Penninx,B., Power,C.,
Province,M.A., Psaty,B.M., Qi,L., Rauramaa,R., Ridker,P.M.,
Ripatti,S., Salomaa,V., Samani,N.J., Snieder,H., Sorensen,T.I.,
Spector,T.D., Stefansson,K., Tonjes,A., Tuomilehto,J.,
Uitterlinden,A.G., Uusitupa,M., van der Harst,P., Vollenweider,P.,
Wallaschofski,H., Wareham,N.J., Watkins,H., Wichmann,H.E.,
Wilson,J.F., Abecasis,G.R., Assimes,T.L., Barroso,I., Boehnke,M.,
Borecki,I.B., Deloukas,P., Fox,C.S., Frayling,T., Groop,L.C.,
Haritunian,T., Heid,I.M., Hunter,D., Kaplan,R.C., Karpe,F.,
Moffatt,M.F., Mohlke,K.L., O'Connell,J.R., Pawitan,Y., Schadt,E.E.,
Schlessinger,D., Steinthorsdottir,V., Strachan,D.P.,
Thorsteinsdottir,U., van Duijn,C.M., Visscher,P.M., Di Blasio,A.M.,
Hirschhorn,J.N., Lindgren,C.M., Morris,A.P., Meyre,D., Scherag,A.,
McCarthy,M.I., Speliotes,E.K., North,K.E., Loos,R.J. and
Ingelsson,E.
TITLE Genome-wide meta-analysis identifies 11 new loci for anthropometric
traits and provides insights into genetic architecture
JOURNAL Nat. Genet. 45 (5), 501-512 (2013)
PUBMED 23563607
REMARK GeneRIF: Single nucleotide polymorphisms in HNF4G gene is
associated with obesity.
REFERENCE 2 (bases 1 to 4101)
AUTHORS Kottgen A, Albrecht E, Teumer A, Vitart V, Krumsiek J, Hundertmark
C, Pistis G, Ruggiero D, O'Seaghdha CM, Haller T, Yang Q, Tanaka T,
Johnson AD, Kutalik Z, Smith AV, Shi J, Struchalin M, Middelberg
RP, Brown MJ, Gaffo AL, Pirastu N, Li G, Hayward C, Zemunik T,
Huffman J, Yengo L, Zhao JH, Demirkan A, Feitosa MF, Liu X, Malerba
G, Lopez LM, van der Harst P, Li X, Kleber ME, Hicks AA, Nolte IM,
Johansson A, Murgia F, Wild SH, Bakker SJ, Peden JF, Dehghan A,
Steri M, Tenesa A, Lagou V, Salo P, Mangino M, Rose LM, Lehtimaki
T, Woodward OM, Okada Y, Tin A, Muller C, Oldmeadow C, Putku M,
Czamara D, Kraft P, Frogheri L, Thun GA, Grotevendt A, Gislason GK,
Harris TB, Launer LJ, McArdle P, Shuldiner AR, Boerwinkle E, Coresh
J, Schmidt H, Schallert M, Martin NG, Montgomery GW, Kubo M,
Nakamura Y, Tanaka T, Munroe PB, Samani NJ, Jacobs DR Jr, Liu K,
D'Adamo P, Ulivi S, Rotter JI, Psaty BM, Vollenweider P, Waeber G,
Campbell S, Devuyst O, Navarro P, Kolcic I, Hastie N, Balkau B,
Froguel P, Esko T, Salumets A, Khaw KT, Langenberg C, Wareham NJ,
Isaacs A, Kraja A, Zhang Q, Wild PS, Scott RJ, Holliday EG, Org E,
Viigimaa M, Bandinelli S, Metter JE, Lupo A, Trabetti E, Sorice R,
Doring A, Lattka E, Strauch K, Theis F, Waldenberger M, Wichmann
HE, Davies G, Gow AJ, Bruinenberg M, Stolk RP, Kooner JS, Zhang W,
Winkelmann BR, Boehm BO, Lucae S, Penninx BW, Smit JH, Curhan G,
Mudgal P, Plenge RM, Portas L, Persico I, Kirin M, Wilson JF, Mateo
Leach I, van Gilst WH, Goel A, Ongen H, Hofman A, Rivadeneira F,
Uitterlinden AG, Imboden M, von Eckardstein A, Cucca F, Nagaraja R,
Piras MG, Nauck M, Schurmann C, Budde K, Ernst F, Farrington SM,
Theodoratou E, Prokopenko I, Stumvoll M, Jula A, Perola M, Salomaa
V, Shin SY, Spector TD, Sala C, Ridker PM, Kahonen M, Viikari J,
Hengstenberg C, Nelson CP, Meschia JF, Nalls MA, Sharma P,
Singleton AB, Kamatani N, Zeller T, Burnier M, Attia J, Laan M,
Klopp N, Hillege HL, Kloiber S, Choi H, Pirastu M, Tore S,
Probst-Hensch NM, Volzke H, Gudnason V, Parsa A, Schmidt R,
Whitfield JB, Fornage M, Gasparini P, Siscovick DS, Polasek O,
Campbell H, Rudan I, Bouatia-Naji N, Metspalu A, Loos RJ, van Duijn
CM, Borecki IB, Ferrucci L, Gambaro G, Deary IJ, Wolffenbuttel BH,
Chambers JC, Marz W, Pramstaller PP, Snieder H, Gyllensten U,
Wright AF, Navis G, Watkins H, Witteman JC, Sanna S, Schipf S,
Dunlop MG, Tonjes A, Ripatti S, Soranzo N, Toniolo D, Chasman DI,
Raitakari O, Kao WH, Ciullo M, Fox CS, Caulfield M, Bochud M and
Gieger C.
CONSRTM LifeLines Cohort Study; CARDIoGRAM Consortium; DIAGRAM Consortium;
ICBP Consortium; MAGIC Consortium
TITLE Genome-wide association analyses identify 18 new loci associated
with serum urate concentrations
JOURNAL Nat. Genet. 45 (2), 145-154 (2013)
PUBMED 23263486
REFERENCE 3 (bases 1 to 4101)
AUTHORS Daigo,K., Kawamura,T., Ohta,Y., Ohashi,R., Katayose,S., Tanaka,T.,
Aburatani,H., Naito,M., Kodama,T., Ihara,S. and Hamakubo,T.
TITLE Proteomic analysis of native hepatocyte nuclear factor-4alpha
(HNF4alpha) isoforms, phosphorylation status, and interactive
cofactors
JOURNAL J. Biol. Chem. 286 (1), 674-686 (2011)
PUBMED 21047794
REMARK GeneRIF: Heterodimerization of HNF4alpha and HNF4gamma was found
REFERENCE 4 (bases 1 to 4101)
AUTHORS Speliotes EK, Willer CJ, Berndt SI, Monda KL, Thorleifsson G,
Jackson AU, Lango Allen H, Lindgren CM, Luan J, Magi R, Randall JC,
Vedantam S, Winkler TW, Qi L, Workalemahu T, Heid IM,
Steinthorsdottir V, Stringham HM, Weedon MN, Wheeler E, Wood AR,
Ferreira T, Weyant RJ, Segre AV, Estrada K, Liang L, Nemesh J, Park
JH, Gustafsson S, Kilpelainen TO, Yang J, Bouatia-Naji N, Esko T,
Feitosa MF, Kutalik Z, Mangino M, Raychaudhuri S, Scherag A, Smith
AV, Welch R, Zhao JH, Aben KK, Absher DM, Amin N, Dixon AL, Fisher
E, Glazer NL, Goddard ME, Heard-Costa NL, Hoesel V, Hottenga JJ,
Johansson A, Johnson T, Ketkar S, Lamina C, Li S, Moffatt MF, Myers
RH, Narisu N, Perry JR, Peters MJ, Preuss M, Ripatti S, Rivadeneira
F, Sandholt C, Scott LJ, Timpson NJ, Tyrer JP, van Wingerden S,
Watanabe RM, White CC, Wiklund F, Barlassina C, Chasman DI, Cooper
MN, Jansson JO, Lawrence RW, Pellikka N, Prokopenko I, Shi J,
Thiering E, Alavere H, Alibrandi MT, Almgren P, Arnold AM, Aspelund
T, Atwood LD, Balkau B, Balmforth AJ, Bennett AJ, Ben-Shlomo Y,
Bergman RN, Bergmann S, Biebermann H, Blakemore AI, Boes T,
Bonnycastle LL, Bornstein SR, Brown MJ, Buchanan TA, Busonero F,
Campbell H, Cappuccio FP, Cavalcanti-Proenca C, Chen YD, Chen CM,
Chines PS, Clarke R, Coin L, Connell J, Day IN, den Heijer M, Duan
J, Ebrahim S, Elliott P, Elosua R, Eiriksdottir G, Erdos MR,
Eriksson JG, Facheris MF, Felix SB, Fischer-Posovszky P, Folsom AR,
Friedrich N, Freimer NB, Fu M, Gaget S, Gejman PV, Geus EJ, Gieger
C, Gjesing AP, Goel A, Goyette P, Grallert H, Grassler J,
Greenawalt DM, Groves CJ, Gudnason V, Guiducci C, Hartikainen AL,
Hassanali N, Hall AS, Havulinna AS, Hayward C, Heath AC,
Hengstenberg C, Hicks AA, Hinney A, Hofman A, Homuth G, Hui J, Igl
W, Iribarren C, Isomaa B, Jacobs KB, Jarick I, Jewell E, John U,
Jorgensen T, Jousilahti P, Jula A, Kaakinen M, Kajantie E, Kaplan
LM, Kathiresan S, Kettunen J, Kinnunen L, Knowles JW, Kolcic I,
Konig IR, Koskinen S, Kovacs P, Kuusisto J, Kraft P, Kvaloy K,
Laitinen J, Lantieri O, Lanzani C, Launer LJ, Lecoeur C, Lehtimaki
T, Lettre G, Liu J, Lokki ML, Lorentzon M, Luben RN, Ludwig B,
Manunta P, Marek D, Marre M, Martin NG, McArdle WL, McCarthy A,
McKnight B, Meitinger T, Melander O, Meyre D, Midthjell K,
Montgomery GW, Morken MA, Morris AP, Mulic R, Ngwa JS, Nelis M,
Neville MJ, Nyholt DR, O'Donnell CJ, O'Rahilly S, Ong KK, Oostra B,
Pare G, Parker AN, Perola M, Pichler I, Pietilainen KH, Platou CG,
Polasek O, Pouta A, Rafelt S, Raitakari O, Rayner NW, Ridderstrale
M, Rief W, Ruokonen A, Robertson NR, Rzehak P, Salomaa V, Sanders
AR, Sandhu MS, Sanna S, Saramies J, Savolainen MJ, Scherag S,
Schipf S, Schreiber S, Schunkert H, Silander K, Sinisalo J,
Siscovick DS, Smit JH, Soranzo N, Sovio U, Stephens J, Surakka I,
Swift AJ, Tammesoo ML, Tardif JC, Teder-Laving M, Teslovich TM,
Thompson JR, Thomson B, Tonjes A, Tuomi T, van Meurs JB, van Ommen
GJ, Vatin V, Viikari J, Visvikis-Siest S, Vitart V, Vogel CI,
Voight BF, Waite LL, Wallaschofski H, Walters GB, Widen E, Wiegand
S, Wild SH, Willemsen G, Witte DR, Witteman JC, Xu J, Zhang Q,
Zgaga L, Ziegler A, Zitting P, Beilby JP, Farooqi IS, Hebebrand J,
Huikuri HV, James AL, Kahonen M, Levinson DF, Macciardi F, Nieminen
MS, Ohlsson C, Palmer LJ, Ridker PM, Stumvoll M, Beckmann JS,
Boeing H, Boerwinkle E, Boomsma DI, Caulfield MJ, Chanock SJ,
Collins FS, Cupples LA, Smith GD, Erdmann J, Froguel P, Gronberg H,
Gyllensten U, Hall P, Hansen T, Harris TB, Hattersley AT, Hayes RB,
Heinrich J, Hu FB, Hveem K, Illig T, Jarvelin MR, Kaprio J, Karpe
F, Khaw KT, Kiemeney LA, Krude H, Laakso M, Lawlor DA, Metspalu A,
Munroe PB, Ouwehand WH, Pedersen O, Penninx BW, Peters A,
Pramstaller PP, Quertermous T, Reinehr T, Rissanen A, Rudan I,
Samani NJ, Schwarz PE, Shuldiner AR, Spector TD, Tuomilehto J, Uda
M, Uitterlinden A, Valle TT, Wabitsch M, Waeber G, Wareham NJ,
Watkins H, Wilson JF, Wright AF, Zillikens MC, Chatterjee N,
McCarroll SA, Purcell S, Schadt EE, Visscher PM, Assimes TL,
Borecki IB, Deloukas P, Fox CS, Groop LC, Haritunians T, Hunter DJ,
Kaplan RC, Mohlke KL, O'Connell JR, Peltonen L, Schlessinger D,
Strachan DP, van Duijn CM, Wichmann HE, Frayling TM,
Thorsteinsdottir U, Abecasis GR, Barroso I, Boehnke M, Stefansson
K, North KE, McCarthy MI, Hirschhorn JN, Ingelsson E and Loos RJ.
CONSRTM MAGIC; Procardis Consortium
TITLE Association analyses of 249,796 individuals reveal 18 new loci
associated with body mass index
JOURNAL Nat. Genet. 42 (11), 937-948 (2010)
PUBMED 20935630
REFERENCE 5 (bases 1 to 4101)
AUTHORS Franke,A., Hampe,J., Rosenstiel,P., Becker,C., Wagner,F.,
Hasler,R., Little,R.D., Huse,K., Ruether,A., Balschun,T.,
Wittig,M., Elsharawy,A., Mayr,G., Albrecht,M., Prescott,N.J.,
Onnie,C.M., Fournier,H., Keith,T., Radelof,U., Platzer,M.,
Mathew,C.G., Stoll,M., Krawczak,M., Nurnberg,P. and Schreiber,S.
TITLE Systematic association mapping identifies NELL1 as a novel IBD
disease gene
JOURNAL PLoS ONE 2 (8), E691 (2007)
PUBMED 17684544
REMARK GeneRIF: Observational study and genome-wide association study of
gene-disease association. (HuGE Navigator)
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 4101)
AUTHORS Nusbaum,C., Mikkelsen,T.S., Zody,M.C., Asakawa,S., Taudien,S.,
Garber,M., Kodira,C.D., Schueler,M.G., Shimizu,A., Whittaker,C.A.,
Chang,J.L., Cuomo,C.A., Dewar,K., FitzGerald,M.G., Yang,X.,
Allen,N.R., Anderson,S., Asakawa,T., Blechschmidt,K., Bloom,T.,
Borowsky,M.L., Butler,J., Cook,A., Corum,B., DeArellano,K.,
DeCaprio,D., Dooley,K.T., Dorris,L. III, Engels,R., Glockner,G.,
Hafez,N., Hagopian,D.S., Hall,J.L., Ishikawa,S.K., Jaffe,D.B.,
Kamat,A., Kudoh,J., Lehmann,R., Lokitsang,T., Macdonald,P.,
Major,J.E., Matthews,C.D., Mauceli,E., Menzel,U., Mihalev,A.H.,
Minoshima,S., Murayama,Y., Naylor,J.W., Nicol,R., Nguyen,C.,
O'Leary,S.B., O'Neill,K., Parker,S.C., Polley,A., Raymond,C.K.,
Reichwald,K., Rodriguez,J., Sasaki,T., Schilhabel,M., Siddiqui,R.,
Smith,C.L., Sneddon,T.P., Talamas,J.A., Tenzin,P., Topham,K.,
Venkataraman,V., Wen,G., Yamazaki,S., Young,S.K., Zeng,Q.,
Zimmer,A.R., Rosenthal,A., Birren,B.W., Platzer,M., Shimizu,N. and
Lander,E.S.
TITLE DNA sequence and analysis of human chromosome 8
JOURNAL Nature 439 (7074), 331-335 (2006)
PUBMED 16421571
REFERENCE 7 (bases 1 to 4101)
AUTHORS Ozeki,T., Takahashi,Y., Nakayama,K., Funayama,M., Nagashima,K.,
Kodama,T. and Kamataki,T.
TITLE Hepatocyte nuclear factor-4 alpha/gamma and hepatocyte nuclear
factor-1 alpha as causal factors of interindividual difference in
the expression of human dihydrodiol dehydrogenase 4 mRNA in human
livers
JOURNAL Pharmacogenetics 13 (1), 49-53 (2003)
PUBMED 12544512
REMARK GeneRIF: results suggest that the expression level of dihydrodiol
dehydrogenase 4 mRNA is cooperatively regulated by the amounts of
HNF-1 alpha, HNF-4 alpha and HNF-4 gamma
REFERENCE 8 (bases 1 to 4101)
AUTHORS Wisely,G.B., Miller,A.B., Davis,R.G., Thornquest,A.D. Jr.,
Johnson,R., Spitzer,T., Sefler,A., Shearer,B., Moore,J.T.,
Miller,A.B., Willson,T.M. and Williams,S.P.
TITLE Hepatocyte nuclear factor 4 is a transcription factor that
constitutively binds fatty acids
JOURNAL Structure 10 (9), 1225-1234 (2002)
PUBMED 12220494
REMARK GeneRIF: 2.7 A X-ray crystalography results suggest that the HNF4s
may be transcription factors that are constitutively bound to fatty
acids
REFERENCE 9 (bases 1 to 4101)
AUTHORS Plengvidhya,N., Antonellis,A., Wogan,L.T., Poleev,A.,
Borgschulze,M., Warram,J.H., Ryffel,G.U., Krolewski,A.S. and
Doria,A.
TITLE Hepatocyte nuclear factor-4gamma: cDNA sequence, gene organization,
and mutation screening in early-onset autosomal-dominant type 2
diabetes
JOURNAL Diabetes 48 (10), 2099-2102 (1999)
PUBMED 10512380
REFERENCE 10 (bases 1 to 4101)
AUTHORS Drewes,T., Senkel,S., Holewa,B. and Ryffel,G.U.
TITLE Human hepatocyte nuclear factor 4 isoforms are encoded by distinct
and differentially expressed genes
JOURNAL Mol. Cell. Biol. 16 (3), 925-931 (1996)
PUBMED 8622695
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
BX571750.1 and AC040917.6.
On Oct 6, 2006 this sequence version replaced gi:40254474.
##Evidence-Data-START##
Transcript exon combination :: BX571750.1, HQ692842.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025082, ERS025084 [ECO:0000350]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-2570 BX571750.1 1-2570
2571-4101 AC040917.6 59518-61048
FEATURES Location/Qualifiers
source 1..4101
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="8"
/map="8q21.11"
gene 1..4101
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/note="hepatocyte nuclear factor 4, gamma"
/db_xref="GeneID:3174"
/db_xref="HGNC:5026"
/db_xref="MIM:605966"
exon 1..113
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/inference="alignment:Splign:1.39.8"
variation 16
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="c"
/db_xref="dbSNP:372721351"
CDS 26..1363
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/note="HNF-4-gamma; nuclear receptor subfamily 2 group A
member 2"
/codon_start=1
/product="hepatocyte nuclear factor 4-gamma"
/protein_id="NP_004124.4"
/db_xref="GI:115583654"
/db_xref="CCDS:CCDS6220.2"
/db_xref="GeneID:3174"
/db_xref="HGNC:5026"
/db_xref="MIM:605966"
/translation="
MDMANYSEVLDPTYTTLEFETMQILYNSSDSSAPETSMNTTDNGVNCLCAICGDRATGKHYGASSCDGCKGFFRRSIRKSHVYSCRFSRQCVVDKDKRNQCRYCRLRKCFRAGMKKEAVQNERDRISTRRSTFDGSNIPSINTLAQAEVRSRQISVSSPGSSTDINVKKIASIGDVCESMKQQLLVLVEWAKYIPAFCELPLDDQVALLRAHAGEHLLLGATKRSMMYKDILLLGNNYVIHRNSCEVEISRVANRVLDELVRPFQEIQIDDNEYACLKAIVFFDPDAKGLSDPVKIKNMRFQVQIGLEDYINDRQYDSRGRFGELLLLLPTLQSITWQMIEQIQFVKLFGMVKIDNLLQEMLLGGASNDGSHLHHPMHPHLSQDPLTGQTILLGPMSTLVHADQISTPETPLPSPPQGSGQEQYKIAANQASVISHQHLSKQKQL
"
misc_feature 170..397
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/note="DNA-binding domain of heptocyte nuclear factor 4
(HNF4) is composed of two C4-type zinc fingers; Region:
NR_DBD_HNF4A; cd06960"
/db_xref="CDD:143518"
misc_feature order(170..172,179..181,221..223,230..232,278..280,
296..298,326..328,335..337)
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/note="zinc binding site [ion binding]; other site"
/db_xref="CDD:143518"
misc_feature order(188..190,200..208,224..229,233..235,239..241,
245..250,257..259,317..322,329..331,338..340,377..385,
389..391)
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/note="DNA binding site [nucleotide binding]"
/db_xref="CDD:143518"
misc_feature order(281..283,320..325,329..331)
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/note="homodimer interface [polypeptide binding]; other
site"
/db_xref="CDD:143518"
misc_feature 443..1108
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/note="The ligand binding domain of heptocyte nuclear
factor 4, which is explosively expanded in nematodes;
Region: NR_LBD_HNF4_like; cd06931"
/db_xref="CDD:132729"
misc_feature order(542..544,560..562,572..574,674..676,686..688,
695..697,725..730,779..781,1049..1054,1061..1063)
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:132729"
misc_feature order(587..589,599..601,629..634,638..643,650..655,
1091..1096,1103..1108)
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/note="coactivator recognition site [polypeptide binding];
other site"
/db_xref="CDD:132729"
misc_feature order(800..802,863..865,881..883,923..928,935..940,
947..952,980..985,989..997,1001..1006,1010..1018,
1022..1027,1034..1036)
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/note="dimer interface [polypeptide binding]; other site"
/db_xref="CDD:132729"
variation 29
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:374803306"
variation 32
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:369058537"
variation 43
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:200724292"
variation 58
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="c"
/db_xref="dbSNP:377418053"
variation 62
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:369885281"
STS 107..1456
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/db_xref="UniSTS:485816"
variation 111
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:2943549"
exon 114..282
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/inference="alignment:Splign:1.39.8"
variation 115
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:375937036"
variation 154
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:201693249"
variation 226
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:144670354"
exon 283..377
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/inference="alignment:Splign:1.39.8"
variation 346
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:148698401"
variation 355
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:188288774"
variation 369
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:372359154"
exon 378..484
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/inference="alignment:Splign:1.39.8"
variation 386
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="c"
/db_xref="dbSNP:371075278"
variation 392
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:141373271"
variation 394
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:201010130"
variation 408
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="c"
/db_xref="dbSNP:373120695"
variation 417
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:374852729"
variation 419
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="c"
/db_xref="dbSNP:374808528"
variation 438..439
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace=""
/replace="c"
/db_xref="dbSNP:34372969"
variation 460
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:368749738"
variation 473
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:147422598"
exon 485..640
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/inference="alignment:Splign:1.39.8"
variation 498
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:139676008"
variation 527
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="t"
/db_xref="dbSNP:200165958"
variation 529
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="g"
/replace="t"
/db_xref="dbSNP:199710439"
variation 542
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:371098188"
variation 550
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:16939095"
variation 562
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="t"
/db_xref="dbSNP:201120200"
variation 564
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="g"
/replace="t"
/db_xref="dbSNP:3765201"
variation 568
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:1805099"
variation 570
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:201472707"
exon 641..728
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/inference="alignment:Splign:1.39.8"
variation 652
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:73692606"
variation 656
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="g"
/replace="t"
/db_xref="dbSNP:370121611"
variation 663
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:75249933"
variation 706
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:1805098"
exon 729..881
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/inference="alignment:Splign:1.39.8"
variation 765
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:201892334"
variation 769
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="g"
/db_xref="dbSNP:148814443"
variation 776
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:201625743"
variation 814..815
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace=""
/replace="t"
/db_xref="dbSNP:34135667"
exon 882..1118
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/inference="alignment:Splign:1.39.8"
variation 896
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="c"
/db_xref="dbSNP:142979219"
variation 924
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:376806020"
variation 941
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:183146707"
variation 949
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:146622279"
variation 996
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:141373967"
variation 1033
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:145103946"
variation 1082
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:61755717"
variation 1092
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:138897994"
variation 1093
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:143897221"
exon 1119..1241
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/inference="alignment:Splign:1.39.8"
variation 1128
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:373673448"
variation 1137
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="g"
/db_xref="dbSNP:199803114"
variation 1145
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:369700596"
variation 1153
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:372960353"
variation 1169
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:375963985"
variation 1174
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="t"
/db_xref="dbSNP:139324425"
variation 1196
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="c"
/db_xref="dbSNP:138158547"
exon 1242..4101
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/inference="alignment:Splign:1.39.8"
variation 1253..1254
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace=""
/replace="c"
/db_xref="dbSNP:34783717"
variation 1253
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:201091500"
variation 1261
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:116212851"
variation 1273
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:61753714"
variation 1288
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="t"
/db_xref="dbSNP:148532560"
variation 1333
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:138203385"
variation 1345
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:188511496"
STS 1361..1477
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/standard_name="STS-Z49826"
/db_xref="UniSTS:69310"
variation 1384
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:142844346"
variation 1398
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:371242252"
variation 1428
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:1805100"
variation 1489
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:2272669"
variation 1500
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="g"
/replace="t"
/db_xref="dbSNP:192940216"
variation 1702
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:2941477"
variation 1716
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="c"
/db_xref="dbSNP:184799012"
variation 1725
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="c"
/db_xref="dbSNP:116190863"
variation 1769
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="c"
/db_xref="dbSNP:2941478"
variation 1871
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:16939104"
variation 1895
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:150642861"
variation 1901
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:13251904"
variation 1937
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:117918767"
variation 1938
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:188803761"
variation 1991
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="c"
/db_xref="dbSNP:2941479"
variation 2003
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:79326815"
variation 2023
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="g"
/replace="t"
/db_xref="dbSNP:180839874"
variation 2154
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:2941480"
variation 2189..2190
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace=""
/replace="t"
/db_xref="dbSNP:35024255"
variation 2199
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:16939105"
variation 2248
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:183958795"
variation 2250
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:139673271"
variation 2319..2323
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace=""
/replace="atatc"
/db_xref="dbSNP:201279175"
variation 2320..2325
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace=""
/replace="tatcat"
/db_xref="dbSNP:202169852"
variation 2383
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="t"
/db_xref="dbSNP:117524236"
variation 2396
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:143615065"
variation 2400
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:2941481"
variation 2412
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:188294689"
variation 2508
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:374801762"
variation 2561
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:17306807"
variation 2607
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="g"
/db_xref="dbSNP:73692613"
variation 2612
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="g"
/replace="t"
/db_xref="dbSNP:77555098"
variation 2616
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace=""
/replace="t"
/db_xref="dbSNP:11292886"
variation 2619
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="t"
/db_xref="dbSNP:199888487"
variation 2621
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="t"
/db_xref="dbSNP:201207943"
variation 2622
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:1515020"
variation 2625
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="g"
/db_xref="dbSNP:191724665"
variation 2660
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:17398054"
variation 2665
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:181843650"
variation 2690
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="c"
/db_xref="dbSNP:146872446"
variation 2884
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="g"
/db_xref="dbSNP:73331898"
variation 2895
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:185409544"
variation 2980
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:190271168"
variation 3027
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="g"
/replace="t"
/db_xref="dbSNP:2941482"
variation 3040
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="g"
/replace="t"
/db_xref="dbSNP:140737476"
variation 3140
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="c"
/db_xref="dbSNP:113612061"
variation 3168..3169
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace=""
/replace="g"
/db_xref="dbSNP:34963256"
variation 3188
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:144392926"
variation 3246..3248
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace=""
/replace="atc"
/db_xref="dbSNP:373915148"
variation 3283..3285
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace=""
/replace="g"
/db_xref="dbSNP:113351166"
variation 3285
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:76997879"
variation 3291..3292
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace=""
/replace="g"
/db_xref="dbSNP:35478074"
variation 3443
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:12682439"
variation 3458
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="c"
/db_xref="dbSNP:184901602"
variation 3478
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:56373371"
variation 3648
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:2941483"
variation 3702
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:2943538"
variation 3770..3771
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace=""
/replace="g"
/db_xref="dbSNP:34772424"
variation 3800
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="c"
/replace="t"
/db_xref="dbSNP:2941484"
variation 3895
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:189760647"
variation 3950
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:183929234"
variation 4023
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace="a"
/replace="g"
/db_xref="dbSNP:11774375"
variation 4092
/gene="HNF4G"
/gene_synonym="NR2A2; NR2A3"
/replace=""
/replace="a"
/db_xref="dbSNP:11309608"
ORIGIN
gagggtatcagaaccaatactggacatggacatggcaaattacagtgaagttttggacccaacttacacaactttggagtttgaaactatgcagattctatataattcaagtgatagttctgccccagagacaagtatgaataccacagacaacggtgtcaactgtctgtgtgctatctgtggggacagagcaacaggaaaacactatggggcatccagctgtgatgggtgcaagggtttcttcagacgcagcattcgtaagagtcacgtttattcttgcaggttcagtcggcaatgtgttgttgacaaggacaaaaggaatcaatgtagatattgtcgattaagaaagtgttttagagcgggaatgaaaaaagaagctgtacaaaatgaacgtgacagaataagcaccagaagaagcacatttgatggcagcaacatcccctccattaacacactggcacaagctgaagttcggtctcgccagatctcagtctcaagccctgggtcaagcactgacataaacgttaagaaaattgcaagtattggtgatgtctgtgaatctatgaaacagcagctcttagtcttggtggaatgggctaaatatattcctgccttctgtgaattaccattggatgatcaggtggcactgttgagagctcacgcaggggagcacttactgcttggagctacaaagagatccatgatgtataaagatattttgcttttgggaaacaactatgttattcaccgcaacagctgtgaagttgagattagccgtgtggccaatcgtgttctagatgagctggttagaccatttcaagaaatccagattgatgacaatgagtatgcttgtttaaaggcaattgtattttttgatccagatgcaaaagggctaagcgatccagtaaaaattaagaacatgaggttccaagtgcagatcggtttggaggactacatcaatgatcggcagtatgactcccgggggaggtttggagagttgcttctgctcctgcccacactgcagagcatcacgtggcaaatgattgagcaaatacagtttgttaaactttttgggatggttaaaattgacaatctacttcaggaaatgctattaggtggggcttccaatgatggcagtcatctccatcatccaatgcatccacatttgtctcaagacccattaactggacaaactatacttttaggtcccatgtcaacactggttcatgcagaccagatctcaactcctgaaaccccactcccttccccaccacaaggctctgggcaagaacagtacaaaatagctgcaaaccaagcatcagtcatttcacaccagcatctctccaaacaaaagcaattgtgaaaatgtgtttacttcagaacggcactacataaatgtgaaaagttgttgatcttgaaatatctcaggatagcacttttggcaaactcttagccaaggcttcttcattggtgctgttataagatggtgtcctattttcttgtttatacgttcattctgtttgttattgctactatgtaaaactttcacatgcaaccaatgtatatctgagtttgaagatgtttatatagggtattttttccaactgcccctgcattgtgcctgaaccaattgaatcttatgtatgagtttcatttgttttattaatgttaatttaaatctgtaaataattgctttattgtgatgtgatacagaacaaagtgttcgtttttgactgaaaatagtagatcagaaatctcagtttaatataaaatgagctaagtttttaaaaataaattataaacttggagattagaaaaataaagcagttgctgtagaataggctgtatctttttcaagaagaatctcttatggacagtctgtggtaaagaagcaactctttgctttagagttaaatattcctatcttaagtttagaaaaatacaaaaaaccattccaaggatgactggatactttttgaaatctgactttctttgaagatgtatgttaagcaaaaacatgttgcttttatcagttaggatacagggtgaactgtaacaaagaaacccctaaaacagtgactaaatcaagagaggaatctatttctttctcctgaaacaatttagaaaatagttatccattgactagaaattagtacatgcccacagctggctcccacggtagccaggagaattatctataggtggaaagtctgtgtcagccaaagccatgtcactctgagagaactgattctgaggacaagttagccatctaccacccatgtcccttatttggtcctcacaataacactttaggagagatatcattatcgctgttttataaataagggaaactttagcttgagggtttaaggaacataaccaaagttcacaaacataacgagtgagagaaacacattcaagcccaggtctagttgactttaatgaatctttggtgtggaatgaaaaatgtgaacttcttactcatagtgtggtttttaaatatatgcagttgagtgatgattggatactattcatcatattgcctataatatatatttaccgataagcagtgagtgtaaaattgttgtagcttgaataagaaaccacttttgtagttttaaccagactttctcttaaaaacattagataaaataaaagattcaccggatggattctgatgaaaacgaaaacaaagtaaaatgactggcttagcagattctttgaaatgtagcagcccagggatgtaccaaatgtcgaattctagactgaggagtagagttcattggagtcttaaactctctgatatcacttaaagctggagtttattttaaaacaaatgaagcatgggccacctcatgatgcagtggctcctctctggttgaggagagggaaaattggaaaaactggtcgagtaattatcaataattttttttaaaaagaggatcccaaactgtaaaagattgaaataatctttctcaggattttttaaatgtctaagattatgatgtcatatctcccacttaccttataagtaaaaaggttaatatcaagtaacttattagctcttaaagtaaaattgaacttattaaaagctatctatgatttaatagatttaataaaattccttcacgacctggtacccttgtgaaactgtaaaatatatcatatggggggagttttttaactcttattttttgaaaatttactgtagcttctatttcgtgaataagaatgttttgattttgatcatacaaataacttttgtagatttttgtttacttttgggggggttcccttagaagacattaaaaaaaaatactgccttggtctgtgcaggctgctgtaatgaaatactatgaacttggcagcttataaacaacagaaatttatttctcgctgttctcaatggtgggaagtccaagattaagggatcaacaaattaggcctctggatcatacatggcattttctagctgtgtccttatacataaaaggaaaaaggtagctctctcgagtctctttaataaagatactaattctcatgactgaatcaccctccaaaggccccacctcctaataccatcactctggggactaggtgtcagcatgtgaattttggaaaacacaaaaattcagaacatagcaaatacctttgaagtataaaagataaaattcatttttagtgaaccctgtaatttattcgtgtatatttactaaacagctgtatctttgaaattgttagtaatgattctgcttcaataactatggtcagggaatttataatattatatttttatatactgaactgccatagatgctggaaaaaaggaactgatgttttcagcatattttcaaaatattgataagggaagttattacttttatatagtattcaacttttttcaggtaatagaagtgaataatttattgtgaaataattcattttataaatgtataattatttttataaattttattgttggaaatcaaaaattagtagattttttaccatgttaaattatagtgagattaaagtattactaaactgtgatgctatgtttgtttcactaaactttctaaataaaaactgagaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:3174 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: TAS
GeneID:3174 -> Molecular function: GO:0003707 [steroid hormone receptor activity] evidence: IEA
GeneID:3174 -> Molecular function: GO:0004879 [ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity] evidence: IEA
GeneID:3174 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA
GeneID:3174 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
GeneID:3174 -> Biological process: GO:0006357 [regulation of transcription from RNA polymerase II promoter] evidence: TAS
GeneID:3174 -> Biological process: GO:0006367 [transcription initiation from RNA polymerase II promoter] evidence: TAS
GeneID:3174 -> Biological process: GO:0010467 [gene expression] evidence: TAS
GeneID:3174 -> Biological process: GO:0031018 [endocrine pancreas development] evidence: TAS
GeneID:3174 -> Biological process: GO:0045893 [positive regulation of transcription, DNA-dependent] evidence: IEA
GeneID:3174 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.