Home |
Help |
Advanced search
2025-05-09 16:36:31, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001700 912 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens azurocidin 1 (AZU1), mRNA.
ACCESSION NM_001700
VERSION NM_001700.3 GI:28416954
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 912)
AUTHORS Daigo,K., Yamaguchi,N., Kawamura,T., Matsubara,K., Jiang,S.,
Ohashi,R., Sudou,Y., Kodama,T., Naito,M., Inoue,K. and Hamakubo,T.
TITLE The proteomic profile of circulating pentraxin 3 (PTX3) complex in
sepsis demonstrates the interaction with azurocidin 1 and other
components of neutrophil extracellular traps
JOURNAL Mol. Cell Proteomics 11 (6), M111 (2012)
PUBMED 22278372
REMARK GeneRIF: AZU1 exhibited high affinity binding to PTX3 in a calcium
ion-dependent manner
REFERENCE 2 (bases 1 to 912)
AUTHORS Chew,M.S., Linder,A., Santen,S., Ersson,A., Herwald,H. and
Thorlacius,H.
TITLE Increased plasma levels of heparin-binding protein in patients with
shock: a prospective, cohort study
JOURNAL Inflamm. Res. 61 (4), 375-379 (2012)
PUBMED 22207392
REMARK GeneRIF: Heparin-binding protein is elevated in patients with shock
from septic and non-septic etiologies.
REFERENCE 3 (bases 1 to 912)
AUTHORS Schou,M., Djurup,R., Norris,K. and Flodgaard,H.
TITLE Identifying the functional part of heparin-binding protein (HBP) as
a monocyte stimulator and the novel role of monocytes as HBP
producers
JOURNAL Innate Immun 17 (1), 60-69 (2011)
PUBMED 20083497
REMARK GeneRIF: The TAASC motif in a cyclizised 20-44 amino acid peptide
is part of the ligand in HBP responsible for activation of the HBP
receptor on monocytes. Monocytes release HBP constitutively in
small amounts and more so in the presence of lipopolysaccharide.
REFERENCE 4 (bases 1 to 912)
AUTHORS Changho,S. and Ahmed,A.A.
TITLE Neutrophils in biliary atresia. A study on their morphologic
distribution and expression of CAP37
JOURNAL Pathol. Res. Pract. 206 (5), 314-317 (2010)
PUBMED 20399025
REMARK GeneRIF: Proliferating bile ductules may play a role in the
inflammatory response in biliary atresia through expression of
CAP37.
REFERENCE 5 (bases 1 to 912)
AUTHORS Linder,A., Johansson,L., Thulin,P., Hertzen,E., Morgelin,M.,
Christensson,B., Bjorck,L., Norrby-Teglund,A. and Akesson,P.
TITLE Erysipelas caused by group A streptococcus activates the contact
system and induces the release of heparin-binding protein
JOURNAL J. Invest. Dermatol. 130 (5), 1365-1372 (2010)
PUBMED 20107486
REMARK GeneRIF: group A streptococci induce contact activation and HBP
release during skin infection, which likely contribute to the
symptoms seen in erysipelas: fever, pain, erythema, and edema
REFERENCE 6 (bases 1 to 912)
AUTHORS Zimmer,M., Medcalf,R.L., Fink,T.M., Mattmann,C., Lichter,P. and
Jenne,D.E.
TITLE Three human elastase-like genes coordinately expressed in the
myelomonocyte lineage are organized as a single genetic locus on
19pter
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (17), 8215-8219 (1992)
PUBMED 1518849
REFERENCE 7 (bases 1 to 912)
AUTHORS Morgan,J.G., Sukiennicki,T., Pereira,H.A., Spitznagel,J.K.,
Guerra,M.E. and Larrick,J.W.
TITLE Cloning of the cDNA for the serine protease homolog
CAP37/azurocidin, a microbicidal and chemotactic protein from human
granulocytes
JOURNAL J. Immunol. 147 (9), 3210-3214 (1991)
PUBMED 1919011
REFERENCE 8 (bases 1 to 912)
AUTHORS Almeida,R.P., Melchior,M., Campanelli,D., Nathan,C. and Gabay,J.E.
TITLE Complementary DNA sequence of human neutrophil azurocidin, an
antibiotic with extensive homology to serine proteases
JOURNAL Biochem. Biophys. Res. Commun. 177 (2), 688-695 (1991)
PUBMED 2049091
REFERENCE 9 (bases 1 to 912)
AUTHORS Green,B.G., Weston,H., Ashe,B.M., Doherty,J., Finke,P., Hagmann,W.,
Lark,M., Mao,J., Maycock,A., Moore,V. et al.
TITLE PMN elastases: a comparison of the specificity of human isozymes
and the enzyme from other species toward substrates and inhibitors
JOURNAL Arch. Biochem. Biophys. 286 (1), 284-292 (1991)
PUBMED 1897955
REFERENCE 10 (bases 1 to 912)
AUTHORS Pohl,J., Pereira,H.A., Martin,N.M. and Spitznagel,J.K.
TITLE Amino acid sequence of CAP37, a human neutrophil granule-derived
antibacterial and monocyte-specific chemotactic glycoprotein
structurally similar to neutrophil elastase
JOURNAL FEBS Lett. 272 (1-2), 200-204 (1990)
PUBMED 2226832
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from M96326.1.
On Feb 19, 2003 this sequence version replaced gi:27881413.
Summary: Azurophil granules, specialized lysosomes of the
neutrophil, contain at least 10 proteins implicated in the killing
of microorganisms. The protein encoded by this gene is an azurophil
granule antibiotic protein, with monocyte chemotactic and
antibacterial activity. It is also an important multifunctional
inflammatory mediator. This encoded protein is a member of the
serine protease gene family but it is not a serine proteinase,
because the active site serine and histidine residues are replaced.
The genes encoding this protein, neutrophil elastase 2, and
proteinase 3 are in a cluster located at chromosome 19pter. All 3
genes are expressed coordinately and their protein products are
packaged together into azurophil granules during neutrophil
differentiation. [provided by RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: X58794.1, BC093931.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025081, ERS025093 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
FEATURES Location/Qualifiers
source 1..912
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="19"
/map="19p13.3"
gene 1..912
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/note="azurocidin 1"
/db_xref="GeneID:566"
/db_xref="HGNC:913"
/db_xref="HPRD:01221"
/db_xref="MIM:162815"
STS 1..822
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/db_xref="UniSTS:480558"
exon 1..74
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/inference="alignment:Splign:1.39.8"
CDS 17..772
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/note="cationic antimicrobial protein 37; heparin-binding
protein; neutrophil azurocidin; cationic antimicrobial
protein CAP37"
/codon_start=1
/product="azurocidin preproprotein"
/protein_id="NP_001691.1"
/db_xref="GI:11342670"
/db_xref="CCDS:CCDS12044.1"
/db_xref="GeneID:566"
/db_xref="HGNC:913"
/db_xref="HPRD:01221"
/db_xref="MIM:162815"
/translation="
MTRLTVLALLAGLLASSRAGSSPLLDIVGGRKARPRQFPFLASIQNQGRHFCGGALIHARFVMTAASCFQSQNPGVSTVVLGAYDLRRRERQSRQTFSISSMSENGYDPQQNLNDLMLLQLDREANLTSSVTILPLPLQNATVEAGTRCQVAGWGSQRSGGRLSRFPRFVNVTVTPEDQCRPNNVCTGVLTRRGGICNGDGGTPLVCEGLAHGVASFSLGPCGRGPDFFTRVALFRDWIDGVLNNPGPGPA
"
sig_peptide 17..94
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
proprotein 95..769
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/product="azurocidin proprotein"
mat_peptide 95..760
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/product="azurocidin"
misc_feature 95..736
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/note="Trypsin-like serine protease; Many of these are
synthesized as inactive precursor zymogens that are
cleaved during limited proteolysis to generate their
active forms. Alignment contains also inactive enzymes
that have substitutions of the catalytic triad...; Region:
Tryp_SPc; cd00190"
/db_xref="CDD:29152"
misc_feature 95..97
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/note="cleavage site"
/db_xref="CDD:29152"
misc_feature 152..226
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P20160.3);
Region: Possesses antibiotic activity"
misc_feature 170..268
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P20160.3);
Region: Hydrophobic"
misc_feature order(215..217,359..361,617..619)
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/note="active site"
/db_xref="CDD:29152"
misc_feature order(599..601,662..664,668..670)
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/note="substrate binding sites [chemical binding]; other
site"
/db_xref="CDD:29152"
variation 61
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:34124897"
variation 67
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:146182220"
variation 71
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="g"
/db_xref="dbSNP:139128406"
variation 73
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="g"
/db_xref="dbSNP:375208692"
variation 74
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:201600404"
exon 75..231
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/inference="alignment:Splign:1.39.8"
variation 75
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:200732632"
variation 82
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace=""
/replace="c"
/db_xref="dbSNP:36002066"
variation 91
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:112635330"
misc_feature 95..772
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/note="Region: azurocidin 1 proprotein"
variation 103
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:184057116"
variation 108
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:144130932"
variation 114
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:376406973"
variation 163
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="g"
/db_xref="dbSNP:370446425"
variation 177
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="g"
/db_xref="dbSNP:113510125"
variation 216
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="g"
/replace="t"
/db_xref="dbSNP:377499337"
exon 232..376
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/inference="alignment:Splign:1.39.8"
variation 238
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:12460890"
variation 278
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:202068638"
variation 281
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:370082761"
variation 282
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:148652041"
variation 296
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:374411584"
variation 304
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:201771664"
variation 320
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:377346707"
variation 334
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:57230903"
variation 338
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="g"
/replace="t"
/db_xref="dbSNP:142169722"
exon 377..610
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/inference="alignment:Splign:1.39.8"
variation 393
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:151205721"
variation 407
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="g"
/db_xref="dbSNP:376150747"
variation 411
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:140987452"
variation 412
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:368212768"
variation 422
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:372031493"
variation 436
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:376674305"
variation 437
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:28664760"
variation 441
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:147872987"
variation 442
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:141563771"
variation 443
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="g"
/replace="t"
/db_xref="dbSNP:78165561"
variation 474
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:371000929"
variation 488
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:368496402"
variation 489
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:28626600"
variation 498
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:61732997"
variation 501
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:149180756"
variation 510
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:61732996"
variation 523
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:595844"
variation 526
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:376967352"
variation 529
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="g"
/db_xref="dbSNP:141614223"
variation 530
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:145363133"
variation 544
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:201821197"
variation 557
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:201652896"
variation 577
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:372443381"
variation 578
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:371203310"
variation 594
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:138374662"
variation 601
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:137867622"
exon 611..912
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/inference="alignment:Splign:1.39.8"
variation 632
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:201462708"
variation 655
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:150578187"
variation 668
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="g"
/replace="t"
/db_xref="dbSNP:139615484"
variation 671
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="c"
/db_xref="dbSNP:149335820"
variation 676
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="g"
/replace="t"
/db_xref="dbSNP:186978911"
variation 695
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:144535481"
variation 705
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="c"
/db_xref="dbSNP:200419489"
variation 706
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:588442"
variation 711
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace=""
/replace="t"
/db_xref="dbSNP:372854624"
variation 720
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="g"
/replace="t"
/db_xref="dbSNP:144687782"
variation 722
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:112572343"
variation 753
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:370044905"
variation 754
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:200997500"
variation 761
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="g"
/db_xref="dbSNP:147909830"
variation 778
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:201350539"
STS 780..904
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/standard_name="STS-M96326"
/db_xref="UniSTS:75203"
variation 806
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="a"
/replace="g"
/db_xref="dbSNP:376815060"
variation 812
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="g"
/db_xref="dbSNP:371079321"
variation 856..857
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace=""
/replace="c"
/db_xref="dbSNP:368866282"
variation 866
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/replace="c"
/replace="t"
/db_xref="dbSNP:148173821"
polyA_signal 888..893
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
polyA_site 912
/gene="AZU1"
/gene_synonym="AZAMP; AZU; CAP37; HBP; HUMAZUR; NAZC"
/experiment="experimental evidence, no additional details
recorded"
ORIGIN
acagacctgccccgccatgacccggctgacagtcctggccctgctggctggtctgctggcgtcctcgagggccggctccagcccccttttggacatcgttggcggccggaaggcgaggccccgccagttcccgttcctggcctccattcagaatcaaggcaggcacttctgcgggggtgccctgatccatgcccgcttcgtgatgaccgcggccagctgcttccaaagccagaaccccggggttagcaccgtggtgctgggtgcctatgacctgaggcggcgggagaggcagtcccgccagacgttttccatcagcagcatgagcgagaatggctacgacccccagcagaacctgaacgacctgatgctgcttcagctggaccgtgaggccaacctcaccagcagcgtgacgatactgccactgcctctgcagaacgccacggtggaagccggcaccagatgccaggtggccggctgggggagccagcgcagtggggggcgtctctcccgttttcccaggtttgtcaacgtgactgtgacccccgaggaccagtgtcgccccaacaacgtgtgcaccggtgtgctcacccgccgcggtggcatctgcaatggggacgggggcacccccctcgtctgcgagggcctggcccacggcgtggcctccttttccctggggccctgtggccgaggccctgacttcttcacccgagtggcgctcttccgagactggatcgatggtgttctcaacaacccgggaccggggccagcctaggggggcctgtgacctcccatggagcccagccccgccctccacacctccggcgctccgcacccacctcccacggccccgcccctgcccccgctccggccagaggggccctggctgtaataaagaagccgatctctcctctg
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:566 -> Molecular function: GO:0004252 [serine-type endopeptidase activity] evidence: IEA
GeneID:566 -> Molecular function: GO:0008201 [heparin binding] evidence: NAS
GeneID:566 -> Molecular function: GO:0015643 [toxic substance binding] evidence: NAS
GeneID:566 -> Biological process: GO:0001774 [microglial cell activation] evidence: IEP
GeneID:566 -> Biological process: GO:0006508 [proteolysis] evidence: IEA
GeneID:566 -> Biological process: GO:0006954 [inflammatory response] evidence: NAS
GeneID:566 -> Biological process: GO:0007205 [protein kinase C-activating G-protein coupled receptor signaling pathway] evidence: TAS
GeneID:566 -> Biological process: GO:0008347 [glial cell migration] evidence: IDA
GeneID:566 -> Biological process: GO:0042117 [monocyte activation] evidence: TAS
GeneID:566 -> Biological process: GO:0042535 [positive regulation of tumor necrosis factor biosynthetic process] evidence: IDA
GeneID:566 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: NAS
GeneID:566 -> Biological process: GO:0043114 [regulation of vascular permeability] evidence: NAS
GeneID:566 -> Biological process: GO:0045123 [cellular extravasation] evidence: NAS
GeneID:566 -> Biological process: GO:0045348 [positive regulation of MHC class II biosynthetic process] evidence: IEP
GeneID:566 -> Biological process: GO:0045785 [positive regulation of cell adhesion] evidence: IDA
GeneID:566 -> Biological process: GO:0048246 [macrophage chemotaxis] evidence: NAS
GeneID:566 -> Biological process: GO:0050725 [positive regulation of interleukin-1 beta biosynthetic process] evidence: IDA
GeneID:566 -> Biological process: GO:0050754 [positive regulation of fractalkine biosynthetic process] evidence: IDA
GeneID:566 -> Biological process: GO:0050766 [positive regulation of phagocytosis] evidence: IDA
GeneID:566 -> Biological process: GO:0050829 [defense response to Gram-negative bacterium] evidence: TAS
GeneID:566 -> Biological process: GO:0050930 [induction of positive chemotaxis] evidence: NAS
GeneID:566 -> Cellular component: GO:0005576 [extracellular region] evidence: NAS
GeneID:566 -> Cellular component: GO:0042582 [azurophil granule] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.