Home |
Help |
Advanced search
2025-12-18 22:43:44, GGRNA : RefSeq release 60 (20130726)
LOCUS NR_073388 1007 bp RNA linear PRI 17-JUL-2013
DEFINITION Homo sapiens asparagine-linked glycosylation 1-like 9, pseudogene
(ALG1L9P), transcript variant 1, non-coding RNA.
ACCESSION NR_073388
VERSION NR_073388.1 GI:410110941
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1007)
AUTHORS Strausberg RL, Feingold EA, Grouse LH, Derge JG, Klausner RD,
Collins FS, Wagner L, Shenmen CM, Schuler GD, Altschul SF, Zeeberg
B, Buetow KH, Schaefer CF, Bhat NK, Hopkins RF, Jordan H, Moore T,
Max SI, Wang J, Hsieh F, Diatchenko L, Marusina K, Farmer AA, Rubin
GM, Hong L, Stapleton M, Soares MB, Bonaldo MF, Casavant TL,
Scheetz TE, Brownstein MJ, Usdin TB, Toshiyuki S, Carninci P,
Prange C, Raha SS, Loquellano NA, Peters GJ, Abramson RD, Mullahy
SJ, Bosak SA, McEwan PJ, McKernan KJ, Malek JA, Gunaratne PH,
Richards S, Worley KC, Hale S, Garcia AM, Gay LJ, Hulyk SW,
Villalon DK, Muzny DM, Sodergren EJ, Lu X, Gibbs RA, Fahey J,
Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M,
Madan A, Young AC, Shevchenko Y, Bouffard GG, Blakesley RW,
Touchman JW, Green ED, Dickson MC, Rodriguez AC, Grimwood J,
Schmutz J, Myers RM, Butterfield YS, Krzywinski MI, Skalska U,
Smailus DE, Schnerch A, Schein JE, Jones SJ and Marra MA.
CONSRTM Mammalian Gene Collection Program Team
TITLE Generation and initial analysis of more than 15,000 full-length
human and mouse cDNA sequences
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 99 (26), 16899-16903 (2002)
PUBMED 12477932
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AP002495.3 and R18473.1.
Transcript Variant: This variant (1) represents the shortest
transcript.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
##Evidence-Data-START##
Transcript exon combination :: R18473.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025084, ERS025086 [ECO:0000350]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-490 AP002495.3 43629-44118 c
491-597 R18473.1 77-183
598-629 R18473.1 185-216
630-722 R18473.1 218-310
723-1007 AP002495.3 26074-26358 c
FEATURES Location/Qualifiers
source 1..1007
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="11"
/map="11q13.4"
gene 1..1007
/gene="ALG1L9P"
/note="asparagine-linked glycosylation 1-like 9,
pseudogene"
/pseudo
/db_xref="GeneID:285407"
/db_xref="HGNC:44378"
misc_RNA 1..1007
/gene="ALG1L9P"
/product="asparagine-linked glycosylation 1-like 9,
pseudogene, transcript variant 1"
/pseudo
/db_xref="GeneID:285407"
/db_xref="HGNC:44378"
variation 233
/gene="ALG1L9P"
/replace="a"
/replace="c"
/db_xref="dbSNP:1814920"
ORIGIN
gggccgggtctccagggaggacctgatttttcttcacccatagttagggaggcgcaatcgccctggctttggggctggggcctccggggaggttccggtaggggcgttggagaggccgctctttttgcaaggcccgagacggcgggccctgcgcaggccgccctattccgcgccctcagggcgtcagtatccgcctgaggccggataccccagctgggcccggatgccgtcgatgggcccggagcatcctcggcgctgccctcccagagccccgcagaggctgaggtggcgcggggggcgggcccggctccgcgagaagcagcggcagcgagggctggaggacccgggctacggggctctggggcgtctggcctgggtgggactgagcccattcggggggactccggggttctggtgtaggtagatccggggcaggctcaggaccaagtccctctccttccaccaaggagcgcccagaggccggcgggagctccaggttcacctcctcctcctccaggaaatcccacttccaactggatgtctggatgaactactgaaagctgctgagtgtcctgcagcagggtcggtggacctgggtgtctgtctggacacatcctccagtggcctggacctgcccatgaaggtggtggacatgttcaggagctgtttgcctgcgtgtgctgtgaacttcaagtgacggtaagggccatgtagaattgaggagcccgctggtgctcccggcaggcagccagcctccgcaggaccccgaccagcgacacgatggcttctgggcaatacagcacgtctacggtgaaagcttcaggttactgaaagggaccagcggacagttccaggtcatgctgacctcagcagaagggcgaggccagagaggcagcggtcatatgagactagtagatgccatttgatcatttgggccattagatggaaaggcaattacttgggtgaaaaaggagaacccttaatagagaaagctgcaaaagactgaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.