GGRNA Home | Help | Advanced search

2025-09-16 21:46:11, GGRNA : RefSeq release 60 (20130726)

LOCUS       NR_073388               1007 bp    RNA     linear   PRI 17-JUL-2013
DEFINITION  Homo sapiens asparagine-linked glycosylation 1-like 9, pseudogene
            (ALG1L9P), transcript variant 1, non-coding RNA.
ACCESSION   NR_073388
VERSION     NR_073388.1  GI:410110941
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1007)
  AUTHORS   Strausberg RL, Feingold EA, Grouse LH, Derge JG, Klausner RD,
            Collins FS, Wagner L, Shenmen CM, Schuler GD, Altschul SF, Zeeberg
            B, Buetow KH, Schaefer CF, Bhat NK, Hopkins RF, Jordan H, Moore T,
            Max SI, Wang J, Hsieh F, Diatchenko L, Marusina K, Farmer AA, Rubin
            GM, Hong L, Stapleton M, Soares MB, Bonaldo MF, Casavant TL,
            Scheetz TE, Brownstein MJ, Usdin TB, Toshiyuki S, Carninci P,
            Prange C, Raha SS, Loquellano NA, Peters GJ, Abramson RD, Mullahy
            SJ, Bosak SA, McEwan PJ, McKernan KJ, Malek JA, Gunaratne PH,
            Richards S, Worley KC, Hale S, Garcia AM, Gay LJ, Hulyk SW,
            Villalon DK, Muzny DM, Sodergren EJ, Lu X, Gibbs RA, Fahey J,
            Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M,
            Madan A, Young AC, Shevchenko Y, Bouffard GG, Blakesley RW,
            Touchman JW, Green ED, Dickson MC, Rodriguez AC, Grimwood J,
            Schmutz J, Myers RM, Butterfield YS, Krzywinski MI, Skalska U,
            Smailus DE, Schnerch A, Schein JE, Jones SJ and Marra MA.
  CONSRTM   Mammalian Gene Collection Program Team
  TITLE     Generation and initial analysis of more than 15,000 full-length
            human and mouse cDNA sequences
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 99 (26), 16899-16903 (2002)
   PUBMED   12477932
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AP002495.3 and R18473.1.
            
            Transcript Variant: This variant (1) represents the shortest
            transcript.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: R18473.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025084, ERS025086 [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-490               AP002495.3         43629-44118         c
            491-597             R18473.1           77-183
            598-629             R18473.1           185-216
            630-722             R18473.1           218-310
            723-1007            AP002495.3         26074-26358         c
FEATURES             Location/Qualifiers
     source          1..1007
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="11"
                     /map="11q13.4"
     gene            1..1007
                     /gene="ALG1L9P"
                     /note="asparagine-linked glycosylation 1-like 9,
                     pseudogene"
                     /pseudo
                     /db_xref="GeneID:285407"
                     /db_xref="HGNC:44378"
     misc_RNA        1..1007
                     /gene="ALG1L9P"
                     /product="asparagine-linked glycosylation 1-like 9,
                     pseudogene, transcript variant 1"
                     /pseudo
                     /db_xref="GeneID:285407"
                     /db_xref="HGNC:44378"
     variation       233
                     /gene="ALG1L9P"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1814920"
ORIGIN      


gggccgggtctccagggaggacctgatttttcttcacccatagttagggaggcgcaatcgccctggctttggggctggggcctccggggaggttccggtaggggcgttggagaggccgctctttttgcaaggcccgagacggcgggccctgcgcaggccgccctattccgcgccctcagggcgtcagtatccgcctgaggccggataccccagctgggcccggatgccgtcgatgggcccggagcatcctcggcgctgccctcccagagccccgcagaggctgaggtggcgcggggggcgggcccggctccgcgagaagcagcggcagcgagggctggaggacccgggctacggggctctggggcgtctggcctgggtgggactgagcccattcggggggactccggggttctggtgtaggtagatccggggcaggctcaggaccaagtccctctccttccaccaaggagcgcccagaggccggcgggagctccaggttcacctcctcctcctccaggaaatcccacttccaactggatgtctggatgaactactgaaagctgctgagtgtcctgcagcagggtcggtggacctgggtgtctgtctggacacatcctccagtggcctggacctgcccatgaaggtggtggacatgttcaggagctgtttgcctgcgtgtgctgtgaacttcaagtgacggtaagggccatgtagaattgaggagcccgctggtgctcccggcaggcagccagcctccgcaggaccccgaccagcgacacgatggcttctgggcaatacagcacgtctacggtgaaagcttcaggttactgaaagggaccagcggacagttccaggtcatgctgacctcagcagaagggcgaggccagagaggcagcggtcatatgagactagtagatgccatttgatcatttgggccattagatggaaaggcaattacttgggtgaaaaaggagaacccttaatagagaaagctgcaaaagactgaa
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.