Home |
Help |
Advanced search
2025-12-24 06:55:09, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004849 3244 bp mRNA linear PRI 15-JUL-2013
DEFINITION Homo sapiens autophagy related 5 (ATG5), mRNA.
ACCESSION NM_004849
VERSION NM_004849.2 GI:92859692
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3244)
AUTHORS Chen,D., Zhu,C., Wang,X., Feng,X., Pang,S., Huang,W., Hawley,R.G.
and Yan,B.
TITLE A novel and functional variant within the ATG5 gene promoter in
sporadic Parkinson's disease
JOURNAL Neurosci. Lett. 538, 49-53 (2013)
PUBMED 23384565
REMARK GeneRIF: the variant identified in PD patient may change ATG5
protein levels and alter autophagy activities, contributing to
Parkinson's disease onset as a risk factor.
REFERENCE 2 (bases 1 to 3244)
AUTHORS Yang,W., Tang,H., Zhang,Y., Tang,X., Zhang,J., Sun,L., Yang,J.,
Cui,Y., Zhang,L., Hirankarn,N., Cheng,H., Pan,H.F., Gao,J.,
Lee,T.L., Sheng,Y., Lau,C.S., Li,Y., Chan,T.M., Yin,X., Ying,D.,
Lu,Q., Leung,A.M., Zuo,X., Chen,X., Tong,K.L., Zhou,F., Diao,Q.,
Tse,N.K., Xie,H., Mok,C.C., Hao,F., Wong,S.N., Shi,B., Lee,K.W.,
Hui,Y., Ho,M.H., Liang,B., Lee,P.P., Cui,H., Guo,Q., Chung,B.H.,
Pu,X., Liu,Q., Zhang,X., Zhang,C., Chong,C.Y., Fang,H., Wong,R.W.,
Sun,Y., Mok,M.Y., Li,X.P., Avihingsanon,Y., Zhai,Z.,
Rianthavorn,P., Deekajorndej,T., Suphapeetiporn,K., Gao,F.,
Shotelersuk,V., Kang,X., Ying,S.K., Zhang,L., Wong,W.H., Zhu,D.,
Fung,S.K., Zeng,F., Lai,W.M., Wong,C.M., Ng,I.O.,
Garcia-Barcelo,M.M., Cherny,S.S., Shen,N., Tam,P.K., Sham,P.C.,
Ye,D.Q., Yang,S., Zhang,X. and Lau,Y.L.
TITLE Meta-analysis followed by replication identifies loci in or near
CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic
lupus erythematosus in Asians
JOURNAL Am. J. Hum. Genet. 92 (1), 41-51 (2013)
PUBMED 23273568
REFERENCE 3 (bases 1 to 3244)
AUTHORS Otomo,C., Metlagel,Z., Takaesu,G. and Otomo,T.
TITLE Structure of the human ATG12 ATG5 conjugate required for LC3
lipidation in autophagy
JOURNAL Nat. Struct. Mol. Biol. 20 (1), 59-66 (2013)
PUBMED 23202584
REMARK GeneRIF: study to identify role of conjugation between ATG12 and
ATG5 in LC3 lipidation; structural and mutational analyses of
ATG12~ATG5-ATG16N revealed the conjugation generates a patch across
ATG12 and ATG5 required for E3 activity
REFERENCE 4 (bases 1 to 3244)
AUTHORS Cho,D.H., Jo,Y.K., Kim,S.C., Park,I.J. and Kim,J.C.
TITLE Down-regulated expression of ATG5 in colorectal cancer
JOURNAL Anticancer Res. 32 (9), 4091-4096 (2012)
PUBMED 22993366
REMARK GeneRIF: Immunohistochemical analysis of colorectal cancer tissues
indicated that increased ATG5 expression is associated with
lymphovascular invasion.
REFERENCE 5 (bases 1 to 3244)
AUTHORS Zekri,A.R., Hassan,Z.K., Bahnassy,A.A., Sherif,G.M., ELdahshan,D.,
Abouelhoda,M., Ali,A. and Hafez,M.M.
TITLE Molecular prognostic profile of Egyptian HCC cases infected with
hepatitis C virus
JOURNAL Asian Pac. J. Cancer Prev. 13 (11), 5433-5438 (2012)
PUBMED 23317196
REMARK GeneRIF: ATG-5 down-regulation is associated with hepatocellular
carcinoma infected with hepatitis C virus.
REFERENCE 6 (bases 1 to 3244)
AUTHORS Tanida,I., Tanida-Miyake,E., Ueno,T. and Kominami,E.
TITLE The human homolog of Saccharomyces cerevisiae Apg7p is a
Protein-activating enzyme for multiple substrates including human
Apg12p, GATE-16, GABARAP, and MAP-LC3
JOURNAL J. Biol. Chem. 276 (3), 1701-1706 (2001)
PUBMED 11096062
REFERENCE 7 (bases 1 to 3244)
AUTHORS Schmeiser,K., Armstrong,S., Hammond,E.M. and Grand,R.J.
TITLE Assignment of the yeast APG5 human homologue APG5L to chromosome
band 6q21 by fluorescence in situ hybridisation
JOURNAL Cytogenet. Cell Genet. 87 (3-4), 213-214 (1999)
PUBMED 10702672
REFERENCE 8 (bases 1 to 3244)
AUTHORS Mizushima,N., Sugita,H., Yoshimori,T. and Ohsumi,Y.
TITLE A new protein conjugation system in human. The counterpart of the
yeast Apg12p conjugation system essential for autophagy
JOURNAL J. Biol. Chem. 273 (51), 33889-33892 (1998)
PUBMED 9852036
REFERENCE 9 (bases 1 to 3244)
AUTHORS Hammond,E.M., Brunet,C.L., Johnson,G.D., Parkhill,J., Milner,A.E.,
Brady,G., Gregory,C.D. and Grand,R.J.
TITLE Homology between a human apoptosis specific protein and the product
of APG5, a gene involved in autophagy in yeast
JOURNAL FEBS Lett. 425 (3), 391-395 (1998)
PUBMED 9563500
REFERENCE 10 (bases 1 to 3244)
AUTHORS Grand,R.J., Milner,A.E., Mustoe,T., Johnson,G.D., Owen,D.,
Grant,M.L. and Gregory,C.D.
TITLE A novel protein expressed in mammalian cells undergoing apoptosis
JOURNAL Exp. Cell Res. 218 (2), 439-451 (1995)
PUBMED 7796880
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
BP297166.1, Y11588.1 and BM831472.1.
On Apr 19, 2006 this sequence version replaced gi:4757797.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: Y11588.1, AK001899.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-56 BP297166.1 1-56
57-2452 Y11588.1 30-2425
2453-2456 BM831472.1 17-20
2457-3244 Y11588.1 2430-3217
FEATURES Location/Qualifiers
source 1..3244
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="6"
/map="6q21"
gene 1..3244
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/note="autophagy related 5"
/db_xref="GeneID:9474"
/db_xref="HGNC:589"
/db_xref="HPRD:16051"
/db_xref="MIM:604261"
exon 1..295
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/inference="alignment:Splign:1.39.8"
exon 296..461
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/inference="alignment:Splign:1.39.8"
misc_feature 321..323
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/note="upstream in-frame stop codon"
variation 323
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/replace="a"
/replace="g"
/db_xref="dbSNP:11541477"
CDS 354..1181
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/note="apoptosis specific protein; apoptosis-specific
protein; ATG5 autophagy related 5 homolog"
/codon_start=1
/product="autophagy protein 5"
/protein_id="NP_004840.1"
/db_xref="GI:4757798"
/db_xref="CCDS:CCDS5055.1"
/db_xref="GeneID:9474"
/db_xref="HGNC:589"
/db_xref="HPRD:16051"
/db_xref="MIM:604261"
/translation="
MTDDKDVLRDVWFGRIPTCFTLYQDEITEREAEPYYLLLPRVSYLTLVTDKVKKHFQKVMRQEDISEIWFEYEGTPLKWHYPIGLLFDLLASSSALPWNITVHFKSFPEKDLLHCPSKDAIEAHFMSCMKEADALKHKSQVINEMQKKDHKQLWMGLQNDRFDQFWAINRKLMEYPAEENGFRYIPFRIYQTTTERPFIQKLFRPVAADGQLHTLGDLLKEVCPSAIDPEDGEKKNQVMIHGIEPMLETPLQWLSEHLSYPDNFLHISIIPQPTD
"
misc_feature 588..1166
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/note="Autophagy protein Apg5; Region: APG5; pfam04106"
/db_xref="CDD:202889"
exon 462..589
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/inference="alignment:Splign:1.39.8"
exon 590..668
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/inference="alignment:Splign:1.39.8"
exon 669..831
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/inference="alignment:Splign:1.39.8"
STS 729..846
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/standard_name="Atg5"
/db_xref="UniSTS:526933"
variation 738
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/replace="a"
/replace="g"
/db_xref="dbSNP:34793250"
variation 797
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/replace="a"
/replace="g"
/db_xref="dbSNP:34601838"
exon 832..926
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/inference="alignment:Splign:1.39.8"
exon 927..1044
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/inference="alignment:Splign:1.39.8"
exon 1045..3244
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/inference="alignment:Splign:1.39.8"
STS 1449..1698
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/standard_name="WI-20363"
/db_xref="UniSTS:82998"
STS 1531..1733
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/standard_name="EST6B12"
/db_xref="UniSTS:263392"
variation 1743
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/replace="a"
/replace="t"
/db_xref="dbSNP:14503"
STS 1866..1944
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/standard_name="STS-N94345"
/db_xref="UniSTS:69927"
STS 1877..1961
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/standard_name="RH93335"
/db_xref="UniSTS:89477"
variation 2576
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/replace="g"
/replace="t"
/db_xref="dbSNP:1044481"
STS 2992..3139
/gene="ATG5"
/gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
/standard_name="RH78069"
/db_xref="UniSTS:52851"
ORIGIN
gtgacgtcatctccgggcgccgagggtgactggacttgtggtgcgctgccagggctccgcagcgttgccggttgtattcgctggataccagagggcggaagtgcagcagggttcagctccgacctccgcgccggtgctttttgcggctgcgcgggcttcctggagtcctgctaccgcgtccccgcaggacagtgtgtcaggcgggcagcttgccccgccgccccaccggagcgcggaatctgggcgtccccaccagtgcggggagccggaaggaggagccatagcttggagtaggtttggctttggttgaaataagaatttagcctgtatgtactgctttaactcctggaagaatgacagatgacaaagatgtgcttcgagatgtgtggtttggacgaattccaacttgtttcacgctatatcaggatgagataactgaaagggaagcagaaccatactatttgcttttgccaagagtaagttatttgacgttggtaactgacaaagtgaaaaagcactttcagaaggttatgagacaagaagacattagtgagatatggtttgaatatgaaggcacaccactgaaatggcattatccaattggtttgctatttgatcttcttgcatcaagttcagctcttccttggaacatcacagtacattttaagagttttccagaaaaagaccttctgcactgtccatctaaggatgcaattgaagctcattttatgtcatgtatgaaagaagctgatgctttaaaacataaaagtcaagtaatcaatgaaatgcagaaaaaagatcacaagcaactctggatgggattgcaaaatgacagatttgaccagttttgggccatcaatcggaaactcatggaatatcctgcagaagaaaatggatttcgttatatcccctttagaatatatcagacaacgactgaaagacctttcattcagaagctgtttcgtcctgtggctgcagatggacagttgcacacactaggagatctcctcaaagaagtttgtccttctgctattgatcctgaagatggggaaaaaaagaatcaagtgatgattcatggaattgagccaatgttggaaacacctctgcagtggctgagtgaacatctgagctacccggataattttcttcatattagtatcatcccacagccaacagattgaaggatcaactatttgcctgaacagaatcatccttaaatgggatttatcagagcatgtcacccttttgcttcaatcaggtttggtggaggcaacctgaccagaaacacttcgctgctgcaagccagacaggaaaaagattccatgtcagataaggcaactgggctggtcttactttgcatcacctctgctttcctccactgccatcattaaacctcagctgtgacatgaaagacttaccggaccactgaaggtcttctgtaaaatataatgaagctgaaacctttggcctaagaagaaaatggaagtatgtgccactcgatttgtatttctgattaacaaataaacaggggtatttcctaaggtgaccatggttgaactttagctcatgaaagtggaaacattggtttaattttcaagagaattaagaaagtaaaagagaaattctgttatcaataacttgcaagtaattttttgtaaaagattgaattacagtaaacccatctttccttaacgaaaatttcctatgtttacagtctgtctattggtatgcaatcttgtaactttgataatgaacagtgagagatttttaaataaagcctctaaatatgttttgtcatttaataacatacagttttgtcacttttcaagtactttctgactcacatacagtagatcactttttactctgtgttaccattttgactggtcgtcattggcatggggtggatatagggcataggattacttgtctcagaagctgtcatagaatttcttgctgccaattaaaaaacctgtgttctttacacactacacgtataaatattgtaactgttcatctttgttgttttatcactgtaagcctgtcaaatcatagtatcctaagcatctgtaaatgctaattttgcatttttggaaaaacccattccttccaagctagtgtttttcattggctccaggtctaatttttcactgtggtccctggcagccagtcttttgaagtttaaagattacctgtctcttgactgcagtaccttttctttaatttttaccaaaaatatccagaggttactggagttcttattcaatataaggaaagtttgctgcactttattaccaagcctctgggattttaccagtcaaacatatttgtgcattacatttcatttcttgtgagctagctggctgtccatattgaatgttgacccatttgagtacgctaaaaggcttacagtatcagacacgatcatggttttagatcccataataaaaatgaatgtttttcttataaaaaattatacaaatgctgaagtgagattctactattgttcattgcttccttttctttttccttttgcgattttcactgattaatagcacatttcttcacaaaattagataaagttggtcaaagaccagatattctggaatggaaattgtaaagcttaatcaaaaagaatagccagtacagcatacaatctcagaaacttagaagcaagtagaaaataattggttgatgtaaacgaaagtgccattttagtaaaggcaggaaaaaaatagcaatatttgagttatgtaaggataaaaaatccactgacttgtatttttgcacaagaggctggtctgaatatgattgttcacattaagagtgtttattcgtcggttcattttggggattttcccccttgatgttttgacagattgaagtgagctttagtgagcaaaaggatcagaatgcagggaacactaagctgtgatgaagaaagtgtggtaaaaagccagagtagttttatacagacaaaaccagtgtcaggcctttgcagtaggcttgagtgaacttctgatctagatttgaaagtaaattttatgaagacattgcccatttttacttcctcattcattattgtaccagcatcatagctttattactctaatcccaggtaagtcaagcctacaatgccctagaggaagagtaaaaccagaaattcatgctggcttaaataatctatttttgtttcttttcatttgaatatttaaattttatggtttattaaaaaattaaataa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:9474 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:9474 -> Biological process: GO:0000045 [autophagic vacuole assembly] evidence: ISS
GeneID:9474 -> Biological process: GO:0001974 [blood vessel remodeling] evidence: IEA
GeneID:9474 -> Biological process: GO:0002739 [regulation of cytokine secretion involved in immune response] evidence: IEA
GeneID:9474 -> Biological process: GO:0006914 [autophagy] evidence: ISS
GeneID:9474 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:9474 -> Biological process: GO:0009620 [response to fungus] evidence: IEA
GeneID:9474 -> Biological process: GO:0031397 [negative regulation of protein ubiquitination] evidence: IEA
GeneID:9474 -> Biological process: GO:0032480 [negative regulation of type I interferon production] evidence: TAS
GeneID:9474 -> Biological process: GO:0042311 [vasodilation] evidence: IEA
GeneID:9474 -> Biological process: GO:0042493 [response to drug] evidence: IEA
GeneID:9474 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: IEA
GeneID:9474 -> Biological process: GO:0043687 [post-translational protein modification] evidence: ISS
GeneID:9474 -> Biological process: GO:0045087 [innate immune response] evidence: TAS
GeneID:9474 -> Biological process: GO:0048840 [otolith development] evidence: IEA
GeneID:9474 -> Biological process: GO:0055015 [ventricular cardiac muscle cell development] evidence: IEA
GeneID:9474 -> Biological process: GO:0060047 [heart contraction] evidence: IEA
GeneID:9474 -> Cellular component: GO:0005737 [cytoplasm] evidence: ISS
GeneID:9474 -> Cellular component: GO:0005776 [autophagic vacuole] evidence: IDA
GeneID:9474 -> Cellular component: GO:0034045 [pre-autophagosomal structure membrane] evidence: ISS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.