2025-09-17 07:32:33, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004849 3244 bp mRNA linear PRI 15-JUL-2013 DEFINITION Homo sapiens autophagy related 5 (ATG5), mRNA. ACCESSION NM_004849 VERSION NM_004849.2 GI:92859692 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3244) AUTHORS Chen,D., Zhu,C., Wang,X., Feng,X., Pang,S., Huang,W., Hawley,R.G. and Yan,B. TITLE A novel and functional variant within the ATG5 gene promoter in sporadic Parkinson's disease JOURNAL Neurosci. Lett. 538, 49-53 (2013) PUBMED 23384565 REMARK GeneRIF: the variant identified in PD patient may change ATG5 protein levels and alter autophagy activities, contributing to Parkinson's disease onset as a risk factor. REFERENCE 2 (bases 1 to 3244) AUTHORS Yang,W., Tang,H., Zhang,Y., Tang,X., Zhang,J., Sun,L., Yang,J., Cui,Y., Zhang,L., Hirankarn,N., Cheng,H., Pan,H.F., Gao,J., Lee,T.L., Sheng,Y., Lau,C.S., Li,Y., Chan,T.M., Yin,X., Ying,D., Lu,Q., Leung,A.M., Zuo,X., Chen,X., Tong,K.L., Zhou,F., Diao,Q., Tse,N.K., Xie,H., Mok,C.C., Hao,F., Wong,S.N., Shi,B., Lee,K.W., Hui,Y., Ho,M.H., Liang,B., Lee,P.P., Cui,H., Guo,Q., Chung,B.H., Pu,X., Liu,Q., Zhang,X., Zhang,C., Chong,C.Y., Fang,H., Wong,R.W., Sun,Y., Mok,M.Y., Li,X.P., Avihingsanon,Y., Zhai,Z., Rianthavorn,P., Deekajorndej,T., Suphapeetiporn,K., Gao,F., Shotelersuk,V., Kang,X., Ying,S.K., Zhang,L., Wong,W.H., Zhu,D., Fung,S.K., Zeng,F., Lai,W.M., Wong,C.M., Ng,I.O., Garcia-Barcelo,M.M., Cherny,S.S., Shen,N., Tam,P.K., Sham,P.C., Ye,D.Q., Yang,S., Zhang,X. and Lau,Y.L. TITLE Meta-analysis followed by replication identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic lupus erythematosus in Asians JOURNAL Am. J. Hum. Genet. 92 (1), 41-51 (2013) PUBMED 23273568 REFERENCE 3 (bases 1 to 3244) AUTHORS Otomo,C., Metlagel,Z., Takaesu,G. and Otomo,T. TITLE Structure of the human ATG12 ATG5 conjugate required for LC3 lipidation in autophagy JOURNAL Nat. Struct. Mol. Biol. 20 (1), 59-66 (2013) PUBMED 23202584 REMARK GeneRIF: study to identify role of conjugation between ATG12 and ATG5 in LC3 lipidation; structural and mutational analyses of ATG12~ATG5-ATG16N revealed the conjugation generates a patch across ATG12 and ATG5 required for E3 activity REFERENCE 4 (bases 1 to 3244) AUTHORS Cho,D.H., Jo,Y.K., Kim,S.C., Park,I.J. and Kim,J.C. TITLE Down-regulated expression of ATG5 in colorectal cancer JOURNAL Anticancer Res. 32 (9), 4091-4096 (2012) PUBMED 22993366 REMARK GeneRIF: Immunohistochemical analysis of colorectal cancer tissues indicated that increased ATG5 expression is associated with lymphovascular invasion. REFERENCE 5 (bases 1 to 3244) AUTHORS Zekri,A.R., Hassan,Z.K., Bahnassy,A.A., Sherif,G.M., ELdahshan,D., Abouelhoda,M., Ali,A. and Hafez,M.M. TITLE Molecular prognostic profile of Egyptian HCC cases infected with hepatitis C virus JOURNAL Asian Pac. J. Cancer Prev. 13 (11), 5433-5438 (2012) PUBMED 23317196 REMARK GeneRIF: ATG-5 down-regulation is associated with hepatocellular carcinoma infected with hepatitis C virus. REFERENCE 6 (bases 1 to 3244) AUTHORS Tanida,I., Tanida-Miyake,E., Ueno,T. and Kominami,E. TITLE The human homolog of Saccharomyces cerevisiae Apg7p is a Protein-activating enzyme for multiple substrates including human Apg12p, GATE-16, GABARAP, and MAP-LC3 JOURNAL J. Biol. Chem. 276 (3), 1701-1706 (2001) PUBMED 11096062 REFERENCE 7 (bases 1 to 3244) AUTHORS Schmeiser,K., Armstrong,S., Hammond,E.M. and Grand,R.J. TITLE Assignment of the yeast APG5 human homologue APG5L to chromosome band 6q21 by fluorescence in situ hybridisation JOURNAL Cytogenet. Cell Genet. 87 (3-4), 213-214 (1999) PUBMED 10702672 REFERENCE 8 (bases 1 to 3244) AUTHORS Mizushima,N., Sugita,H., Yoshimori,T. and Ohsumi,Y. TITLE A new protein conjugation system in human. The counterpart of the yeast Apg12p conjugation system essential for autophagy JOURNAL J. Biol. Chem. 273 (51), 33889-33892 (1998) PUBMED 9852036 REFERENCE 9 (bases 1 to 3244) AUTHORS Hammond,E.M., Brunet,C.L., Johnson,G.D., Parkhill,J., Milner,A.E., Brady,G., Gregory,C.D. and Grand,R.J. TITLE Homology between a human apoptosis specific protein and the product of APG5, a gene involved in autophagy in yeast JOURNAL FEBS Lett. 425 (3), 391-395 (1998) PUBMED 9563500 REFERENCE 10 (bases 1 to 3244) AUTHORS Grand,R.J., Milner,A.E., Mustoe,T., Johnson,G.D., Owen,D., Grant,M.L. and Gregory,C.D. TITLE A novel protein expressed in mammalian cells undergoing apoptosis JOURNAL Exp. Cell Res. 218 (2), 439-451 (1995) PUBMED 7796880 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from BP297166.1, Y11588.1 and BM831472.1. On Apr 19, 2006 this sequence version replaced gi:4757797. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: Y11588.1, AK001899.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-56 BP297166.1 1-56 57-2452 Y11588.1 30-2425 2453-2456 BM831472.1 17-20 2457-3244 Y11588.1 2430-3217 FEATURES Location/Qualifiers source 1..3244 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="6" /map="6q21" gene 1..3244 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /note="autophagy related 5" /db_xref="GeneID:9474" /db_xref="HGNC:589" /db_xref="HPRD:16051" /db_xref="MIM:604261" exon 1..295 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /inference="alignment:Splign:1.39.8" exon 296..461 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /inference="alignment:Splign:1.39.8" misc_feature 321..323 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /note="upstream in-frame stop codon" variation 323 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /replace="a" /replace="g" /db_xref="dbSNP:11541477" CDS 354..1181 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /note="apoptosis specific protein; apoptosis-specific protein; ATG5 autophagy related 5 homolog" /codon_start=1 /product="autophagy protein 5" /protein_id="NP_004840.1" /db_xref="GI:4757798" /db_xref="CCDS:CCDS5055.1" /db_xref="GeneID:9474" /db_xref="HGNC:589" /db_xref="HPRD:16051" /db_xref="MIM:604261" /translation="
MTDDKDVLRDVWFGRIPTCFTLYQDEITEREAEPYYLLLPRVSYLTLVTDKVKKHFQKVMRQEDISEIWFEYEGTPLKWHYPIGLLFDLLASSSALPWNITVHFKSFPEKDLLHCPSKDAIEAHFMSCMKEADALKHKSQVINEMQKKDHKQLWMGLQNDRFDQFWAINRKLMEYPAEENGFRYIPFRIYQTTTERPFIQKLFRPVAADGQLHTLGDLLKEVCPSAIDPEDGEKKNQVMIHGIEPMLETPLQWLSEHLSYPDNFLHISIIPQPTD
" misc_feature 588..1166 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /note="Autophagy protein Apg5; Region: APG5; pfam04106" /db_xref="CDD:202889" exon 462..589 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /inference="alignment:Splign:1.39.8" exon 590..668 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /inference="alignment:Splign:1.39.8" exon 669..831 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /inference="alignment:Splign:1.39.8" STS 729..846 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /standard_name="Atg5" /db_xref="UniSTS:526933" variation 738 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /replace="a" /replace="g" /db_xref="dbSNP:34793250" variation 797 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /replace="a" /replace="g" /db_xref="dbSNP:34601838" exon 832..926 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /inference="alignment:Splign:1.39.8" exon 927..1044 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /inference="alignment:Splign:1.39.8" exon 1045..3244 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /inference="alignment:Splign:1.39.8" STS 1449..1698 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /standard_name="WI-20363" /db_xref="UniSTS:82998" STS 1531..1733 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /standard_name="EST6B12" /db_xref="UniSTS:263392" variation 1743 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /replace="a" /replace="t" /db_xref="dbSNP:14503" STS 1866..1944 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /standard_name="STS-N94345" /db_xref="UniSTS:69927" STS 1877..1961 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /standard_name="RH93335" /db_xref="UniSTS:89477" variation 2576 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /replace="g" /replace="t" /db_xref="dbSNP:1044481" STS 2992..3139 /gene="ATG5" /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5" /standard_name="RH78069" /db_xref="UniSTS:52851" ORIGIN
gtgacgtcatctccgggcgccgagggtgactggacttgtggtgcgctgccagggctccgcagcgttgccggttgtattcgctggataccagagggcggaagtgcagcagggttcagctccgacctccgcgccggtgctttttgcggctgcgcgggcttcctggagtcctgctaccgcgtccccgcaggacagtgtgtcaggcgggcagcttgccccgccgccccaccggagcgcggaatctgggcgtccccaccagtgcggggagccggaaggaggagccatagcttggagtaggtttggctttggttgaaataagaatttagcctgtatgtactgctttaactcctggaagaatgacagatgacaaagatgtgcttcgagatgtgtggtttggacgaattccaacttgtttcacgctatatcaggatgagataactgaaagggaagcagaaccatactatttgcttttgccaagagtaagttatttgacgttggtaactgacaaagtgaaaaagcactttcagaaggttatgagacaagaagacattagtgagatatggtttgaatatgaaggcacaccactgaaatggcattatccaattggtttgctatttgatcttcttgcatcaagttcagctcttccttggaacatcacagtacattttaagagttttccagaaaaagaccttctgcactgtccatctaaggatgcaattgaagctcattttatgtcatgtatgaaagaagctgatgctttaaaacataaaagtcaagtaatcaatgaaatgcagaaaaaagatcacaagcaactctggatgggattgcaaaatgacagatttgaccagttttgggccatcaatcggaaactcatggaatatcctgcagaagaaaatggatttcgttatatcccctttagaatatatcagacaacgactgaaagacctttcattcagaagctgtttcgtcctgtggctgcagatggacagttgcacacactaggagatctcctcaaagaagtttgtccttctgctattgatcctgaagatggggaaaaaaagaatcaagtgatgattcatggaattgagccaatgttggaaacacctctgcagtggctgagtgaacatctgagctacccggataattttcttcatattagtatcatcccacagccaacagattgaaggatcaactatttgcctgaacagaatcatccttaaatgggatttatcagagcatgtcacccttttgcttcaatcaggtttggtggaggcaacctgaccagaaacacttcgctgctgcaagccagacaggaaaaagattccatgtcagataaggcaactgggctggtcttactttgcatcacctctgctttcctccactgccatcattaaacctcagctgtgacatgaaagacttaccggaccactgaaggtcttctgtaaaatataatgaagctgaaacctttggcctaagaagaaaatggaagtatgtgccactcgatttgtatttctgattaacaaataaacaggggtatttcctaaggtgaccatggttgaactttagctcatgaaagtggaaacattggtttaattttcaagagaattaagaaagtaaaagagaaattctgttatcaataacttgcaagtaattttttgtaaaagattgaattacagtaaacccatctttccttaacgaaaatttcctatgtttacagtctgtctattggtatgcaatcttgtaactttgataatgaacagtgagagatttttaaataaagcctctaaatatgttttgtcatttaataacatacagttttgtcacttttcaagtactttctgactcacatacagtagatcactttttactctgtgttaccattttgactggtcgtcattggcatggggtggatatagggcataggattacttgtctcagaagctgtcatagaatttcttgctgccaattaaaaaacctgtgttctttacacactacacgtataaatattgtaactgttcatctttgttgttttatcactgtaagcctgtcaaatcatagtatcctaagcatctgtaaatgctaattttgcatttttggaaaaacccattccttccaagctagtgtttttcattggctccaggtctaatttttcactgtggtccctggcagccagtcttttgaagtttaaagattacctgtctcttgactgcagtaccttttctttaatttttaccaaaaatatccagaggttactggagttcttattcaatataaggaaagtttgctgcactttattaccaagcctctgggattttaccagtcaaacatatttgtgcattacatttcatttcttgtgagctagctggctgtccatattgaatgttgacccatttgagtacgctaaaaggcttacagtatcagacacgatcatggttttagatcccataataaaaatgaatgtttttcttataaaaaattatacaaatgctgaagtgagattctactattgttcattgcttccttttctttttccttttgcgattttcactgattaatagcacatttcttcacaaaattagataaagttggtcaaagaccagatattctggaatggaaattgtaaagcttaatcaaaaagaatagccagtacagcatacaatctcagaaacttagaagcaagtagaaaataattggttgatgtaaacgaaagtgccattttagtaaaggcaggaaaaaaatagcaatatttgagttatgtaaggataaaaaatccactgacttgtatttttgcacaagaggctggtctgaatatgattgttcacattaagagtgtttattcgtcggttcattttggggattttcccccttgatgttttgacagattgaagtgagctttagtgagcaaaaggatcagaatgcagggaacactaagctgtgatgaagaaagtgtggtaaaaagccagagtagttttatacagacaaaaccagtgtcaggcctttgcagtaggcttgagtgaacttctgatctagatttgaaagtaaattttatgaagacattgcccatttttacttcctcattcattattgtaccagcatcatagctttattactctaatcccaggtaagtcaagcctacaatgccctagaggaagagtaaaaccagaaattcatgctggcttaaataatctatttttgtttcttttcatttgaatatttaaattttatggtttattaaaaaattaaataa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:9474 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:9474 -> Biological process: GO:0000045 [autophagic vacuole assembly] evidence: ISS GeneID:9474 -> Biological process: GO:0001974 [blood vessel remodeling] evidence: IEA GeneID:9474 -> Biological process: GO:0002739 [regulation of cytokine secretion involved in immune response] evidence: IEA GeneID:9474 -> Biological process: GO:0006914 [autophagy] evidence: ISS GeneID:9474 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA GeneID:9474 -> Biological process: GO:0009620 [response to fungus] evidence: IEA GeneID:9474 -> Biological process: GO:0031397 [negative regulation of protein ubiquitination] evidence: IEA GeneID:9474 -> Biological process: GO:0032480 [negative regulation of type I interferon production] evidence: TAS GeneID:9474 -> Biological process: GO:0042311 [vasodilation] evidence: IEA GeneID:9474 -> Biological process: GO:0042493 [response to drug] evidence: IEA GeneID:9474 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: IEA GeneID:9474 -> Biological process: GO:0043687 [post-translational protein modification] evidence: ISS GeneID:9474 -> Biological process: GO:0045087 [innate immune response] evidence: TAS GeneID:9474 -> Biological process: GO:0048840 [otolith development] evidence: IEA GeneID:9474 -> Biological process: GO:0055015 [ventricular cardiac muscle cell development] evidence: IEA GeneID:9474 -> Biological process: GO:0060047 [heart contraction] evidence: IEA GeneID:9474 -> Cellular component: GO:0005737 [cytoplasm] evidence: ISS GeneID:9474 -> Cellular component: GO:0005776 [autophagic vacuole] evidence: IDA GeneID:9474 -> Cellular component: GO:0034045 [pre-autophagosomal structure membrane] evidence: ISS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.