2025-09-17 18:57:26, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_153716 1443 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens heat shock transcription factor, Y linked 2 (HSFY2), transcript variant 1, mRNA. ACCESSION NM_153716 VERSION NM_153716.1 GI:32526912 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1443) AUTHORS Shinka,T., Sato,Y., Chen,G., Naroda,T., Kinoshita,K., Unemi,Y., Tsuji,K., Toida,K., Iwamoto,T. and Nakahori,Y. TITLE Molecular characterization of heat shock-like factor encoded on the human Y chromosome, and implications for male infertility JOURNAL Biol. Reprod. 71 (1), 297-306 (2004) PUBMED 15044259 REFERENCE 2 (bases 1 to 1443) AUTHORS Tessari,A., Salata,E., Ferlin,A., Bartoloni,L., Slongo,M.L. and Foresta,C. TITLE Characterization of HSFY, a novel AZFb gene on the Y chromosome with a possible role in human spermatogenesis JOURNAL Mol. Hum. Reprod. 10 (4), 253-258 (2004) PUBMED 14985478 REMARK GeneRIF: Could have an important role in human spermatogenesis. REFERENCE 3 (bases 1 to 1443) AUTHORS Skaletsky,H., Kuroda-Kawaguchi,T., Minx,P.J., Cordum,H.S., Hillier,L., Brown,L.G., Repping,S., Pyntikova,T., Ali,J., Bieri,T., Chinwalla,A., Delehaunty,A., Delehaunty,K., Du,H., Fewell,G., Fulton,L., Fulton,R., Graves,T., Hou,S.F., Latrielle,P., Leonard,S., Mardis,E., Maupin,R., McPherson,J., Miner,T., Nash,W., Nguyen,C., Ozersky,P., Pepin,K., Rock,S., Rohlfing,T., Scott,K., Schultz,B., Strong,C., Tin-Wollam,A., Yang,S.P., Waterston,R.H., Wilson,R.K., Rozen,S. and Page,D.C. TITLE The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes JOURNAL Nature 423 (6942), 825-837 (2003) PUBMED 12815422 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK058182.1. Summary: This gene encodes a member of the heat shock factor (HSF) family of transcriptional activators for heat shock proteins. This gene is a candidate gene for azoospermia, since it localizes to a region of chromosome Y that is sometimes deleted in infertile males. The genome has two identical copies of this gene within a palindromic region; this record represents the more telomeric copy. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (1) encodes the longest isoform (1) of this protein. Isoform 1 has an HSF-type DNA-binding motif. ##Evidence-Data-START## Transcript exon combination :: AK058182.1, BG772904.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025084, ERS025085 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. FEATURES Location/Qualifiers source 1..1443 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="Y" /map="Yq11.222" gene 1..1443 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /note="heat shock transcription factor, Y linked 2" /db_xref="GeneID:159119" /db_xref="HGNC:23950" /db_xref="HPRD:13680" exon 1..630 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /inference="alignment:Splign:1.39.8" STS 77..1346 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /db_xref="UniSTS:485995" misc_feature 94..96 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /note="upstream in-frame stop codon" CDS 118..1323 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /note="isoform 1 is encoded by transcript variant 1; heat shock transcription factor, Y-linked; heat shock transcription factor 2-like protein" /codon_start=1 /product="heat shock transcription factor, Y-linked isoform 1" /protein_id="NP_714927.1" /db_xref="GI:32526913" /db_xref="CCDS:CCDS14791.1" /db_xref="GeneID:159119" /db_xref="HGNC:23950" /db_xref="HPRD:13680" /translation="
MAHVSSETQDVSPKDELTASEASTRSPLCEHTFPGDSDLRSMIEEHAFQVLSQGSLLESPSYTVCVSEPDKDDDFLSLNFPRKLWKIVESDQFKSISWDENGTCIVINEELFKKEILETKAPYRIFQTDAIKSFVRQLNLYGFSKIQQNFQRSAFLATFLSEEKESSVLSKLKFYYNPNFKRGYPQLLVRVKRRIGVKNASPISTLFNEDFNKKHFRAGANMENHNSALAAEASEESLFSASKNLNMPLTRESSVRQIIANSSVPIRSGFPPPSPSTSVGPSEQIATDQHAILNQLTTIHMHSHSTYMQARGHIVNFITTTTSQYHIISPLQNGYFGLTVEPSAVPTRYPLVSVNEAPYRNMLPAGNPWLQMPTIADRSAAPHSRLALQPSPLDKYHPNYN
" misc_feature 352..756 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /note="Region: HFS-type DNA-binding domain" misc_feature 355..699 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /note="HSF-type DNA-binding; Region: HSF_DNA-bind; pfam00447" /db_xref="CDD:201233" exon 631..1443 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /inference="alignment:Splign:1.39.8" STS 765..914 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /standard_name="sY1237" /db_xref="UniSTS:478843" variation complement(1027) /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /replace="c" /replace="t" /db_xref="dbSNP:56231517" STS 1147..1281 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /standard_name="RH93149" /db_xref="UniSTS:84040" polyA_signal 1421..1426 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" polyA_site 1443 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" ORIGIN
aaccattgtgatggtctagataagtgtacatgcttaggccttctgaagcagcatttgaagctgcagtcctgaaaaccatgcaggccggaagagtagataaagaaatatttatttgagatggcacatgtttcttcagaaactcaagatgtttcccccaaagatgaattaactgcttcagaagcctccactaggtctccattgtgtgaacacaccttccctggggactcagacttacggtcaatgattgaagaacatgcttttcaggttttgtcacaaggatccttgttagaaagtccaagttacacagtttgtgtctctgagccagataaagatgatgattttctttctctgaactttcccaggaaactttggaaaatagtggaaagtgaccaattcaagtctatttcatgggatgagaatggaacttgcatagtgattaatgaagaactcttcaagaaagaaattttggaaacaaaggctccttacagaatatttcaaactgatgctatcaaaagttttgttcgacagctcaacctttatggatttagtaaaattcaacagaattttcaaagatctgcctttctagccacctttctgtcagaagagaaagaatcgtctgtcttaagcaagttaaagttctattataatccaaatttcaagcgtggctatccccaacttttagtaagagtgaagagaagaattggtgttaaaaatgcttcacctatatctactttattcaacgaagatttcaacaagaagcattttagagcaggggctaacatggagaatcataattctgccttagctgctgaagctagtgaagaaagtttattttcagcctctaaaaatttaaatatgcctctaacaagggaatcttctgtcagacagataattgcaaattcatctgtccccattagaagtggtttccctcctccttcaccttcaacctcagttggaccatcagaacaaattgcaacagatcaacatgctattttaaatcagttgaccactattcatatgcactctcatagtacctacatgcaagcaaggggccacattgtgaattttattacaaccacaacttctcaataccacatcatatctcccttacaaaatggttattttgggctgacagtggaaccatctgctgttcccacacgatatcctctggtatcagtcaatgaggctccatatcgtaacatgctaccagcaggcaacccgtggttgcaaatgcctacgatcgctgatagatcagctgcccctcattccaggctagctcttcaaccatcaccactggacaaatatcaccctaattacaactgatctgccattaaaagaggaccagattatgaatgacaacagagactaacatttacattgacaaaaaaccctaaaaatttctgcaattatcttattgaacaataaaattgcatgtttacttct
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:159119 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:159119 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA GeneID:159119 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:159119 -> Cellular component: GO:0005634 [nucleus] evidence: IEA GeneID:159119 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.