GGRNA Home | Help | Advanced search

2025-11-04 12:13:21, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_152467               2009 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens kelch-like family member 10 (KLHL10), mRNA.
ACCESSION   NM_152467
VERSION     NM_152467.3  GI:148664208
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2009)
  AUTHORS   Qiu,Q.M., Liu,G., Li,W.N., Shi,Q.W., Zhu,F.X. and Lu,G.X.
  TITLE     [Mutation of KLHL-10 in idiopathic infertile males with
            azoospermia, oligospermia or asthenospermia]
  JOURNAL   Zhonghua Nan Ke Xue 15 (11), 974-979 (2009)
   PUBMED   20218307
  REMARK    GeneRIF: The KLHL-10 gene is not a major contributor to
            azoospermia, oligospermia or asthenospermia in Chinese population.
            GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   2  (bases 1 to 2009)
  AUTHORS   Yatsenko,A.N., Roy,A., Chen,R., Ma,L., Murthy,L.J., Yan,W.,
            Lamb,D.J. and Matzuk,M.M.
  TITLE     Non-invasive genetic diagnosis of male infertility using
            spermatozoal RNA: KLHL10 mutations in oligozoospermic patients
            impair homodimerization
  JOURNAL   Hum. Mol. Genet. 15 (23), 3411-3419 (2006)
   PUBMED   17047026
REFERENCE   3  (bases 1 to 2009)
  AUTHORS   Yan,W., Ma,L., Burns,K.H. and Matzuk,M.M.
  TITLE     Haploinsufficiency of kelch-like protein homolog 10 causes
            infertility in male mice
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 101 (20), 7793-7798 (2004)
   PUBMED   15136734
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BP371285.1 and AY495339.1.
            On Jun 7, 2007 this sequence version replaced gi:141801763.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY495339.1, BC067753.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025085 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-18                BP371285.1         1-18
            19-2009             AY495339.1         1-1991
FEATURES             Location/Qualifiers
     source          1..2009
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="17"
                     /map="17q21.2"
     gene            1..2009
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /note="kelch-like family member 10"
                     /db_xref="GeneID:317719"
                     /db_xref="HGNC:18829"
                     /db_xref="MIM:608778"
     exon            1..336
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /inference="alignment:Splign:1.39.8"
     variation       63
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371974508"
     variation       104
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371854228"
     misc_feature    107..109
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /note="upstream in-frame stop codon"
     CDS             143..1969
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /note="kelch-like 10"
                     /codon_start=1
                     /product="kelch-like protein 10"
                     /protein_id="NP_689680.2"
                     /db_xref="GI:148664209"
                     /db_xref="CCDS:CCDS42340.1"
                     /db_xref="GeneID:317719"
                     /db_xref="HGNC:18829"
                     /db_xref="MIM:608778"
                     /translation="
MEMESAAASTRFHQPHMERKMSAMACEIFNELRLEGKLCDVVIKVNGFEFSAHKNILCSCSSYFRALFTSGWNNTEKKVYNIPGISPDMMKLIIEYAYTRTVPITPDNVEKLLAAADQFNIMGIVRGCCEFLKSELCLDNCIGICKFTDYYYCPELRQKAYMFILHNFEEMVKVSAEFLELSVTELKDIIEKDELNVKQEDAVFEAILKWISHDPQNRKQHISILLPKVRLALMHAEYFMNNVKMNDYVKDSEECKPVIINALKAMYDLNMNGPSNSDFTNPLTRPRLPYAILFAIGGWSGGSPTNAIEAYDARADRWVNVTCEEESPRAYHGAAYLKGYVYIIGGFDSVDYFNSVKRFDPVKKTWHQVAPMHSRRCYVSVTVLGNFIYAMGGFDGYVRLNTAERYEPETNQWTLIAPMHEQRSDASATTLYGKVYICGGFNGNECLFTAEVYNTESNQWTVIAPMRSRRSGIGVIAYGEHVYAVGGFDGANRLRSAEAYSPVANTWRTIPTMFNPRSNFGIEVVDDLLFVVGGFNGFTTTFNVECYDEKTDEWYDAHDMSIYRSALSCCVVPGLANVEEYAARRDNFPGLALRDEVKYSASTSTLPV
"
     misc_feature    227..541
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /note="BTB/POZ domain; Region: BTB; pfam00651"
                     /db_xref="CDD:201372"
     misc_feature    248..1858
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /note="kelch-like protein; Provisional; Region: PHA03098"
                     /db_xref="CDD:165380"
     misc_feature    563..865
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /note="BTB And C-terminal Kelch; Region: BACK; pfam07707"
                     /db_xref="CDD:149006"
     misc_feature    1016..1159
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q6JEL2.1);
                     Region: Kelch 1"
     misc_feature    1019..1159
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /note="Kelch domain; Region: Kelch; smart00612"
                     /db_xref="CDD:128874"
     misc_feature    1160..1300
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q6JEL2.1);
                     Region: Kelch 2"
     misc_feature    1163..1300
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /note="Kelch domain; Region: Kelch; smart00612"
                     /db_xref="CDD:128874"
     misc_feature    1265..1399
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /note="Kelch motif; Region: Kelch_1; pfam01344"
                     /db_xref="CDD:201739"
     misc_feature    1304..1441
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q6JEL2.1);
                     Region: Kelch 3"
     misc_feature    1442..1582
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /note="Kelch domain; Region: Kelch; smart00612"
                     /db_xref="CDD:128874"
     misc_feature    1442..1582
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q6JEL2.1);
                     Region: Kelch 4"
     misc_feature    1583..1723
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /note="Kelch domain; Region: Kelch; smart00612"
                     /db_xref="CDD:128874"
     misc_feature    1583..1723
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q6JEL2.1);
                     Region: Kelch 5"
     misc_feature    1724..1864
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /note="Kelch domain; Region: Kelch; smart00612"
                     /db_xref="CDD:128874"
     misc_feature    1727..1864
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q6JEL2.1);
                     Region: Kelch 6"
     variation       143
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375478864"
     variation       146..147
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35627442"
     variation       158
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200592199"
     variation       163
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368540358"
     variation       260
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150254995"
     variation       262
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371429407"
     exon            337..826
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /inference="alignment:Splign:1.39.8"
     variation       365
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376803007"
     variation       372
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369676198"
     variation       379
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377742054"
     variation       384
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:36065902"
     variation       390
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202162199"
     variation       396
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115928775"
     variation       403
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1529933"
     variation       404
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374071801"
     variation       421
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375880722"
     variation       460
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370786117"
     variation       517
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192564496"
     variation       530
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201335504"
     variation       589
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369099688"
     variation       625
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202110308"
     variation       651
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200286521"
     variation       658
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200355741"
     variation       736
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147108868"
     variation       749
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199599875"
     variation       764
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201438905"
     variation       769
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374553069"
     variation       779
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371552751"
     variation       789
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:116420871"
     exon            827..1444
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /inference="alignment:Splign:1.39.8"
     variation       830
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376975543"
     variation       843
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200957650"
     variation       847
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369592598"
     variation       851
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374019359"
     variation       885
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190847775"
     variation       946
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376902362"
     variation       954
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141860514"
     variation       966
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372414978"
     variation       993
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375992901"
     variation       1022
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150706383"
     variation       1029
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61752339"
     variation       1065
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377399919"
     variation       1079
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370756367"
     variation       1091
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149895408"
     variation       1108
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34933374"
     variation       1109
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181049067"
     variation       1121
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371705445"
     variation       1141
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199930359"
     variation       1151
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185984794"
     variation       1189
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374708612"
     variation       1212
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200544803"
     variation       1214
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372217780"
     variation       1280
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375231468"
     variation       1294
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199535981"
     variation       1295
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114530188"
     variation       1345
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368599949"
     variation       1364
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371906448"
     variation       1380
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369767656"
     variation       1387
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200538026"
     variation       1408
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372533912"
     variation       1423
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201906870"
     exon            1445..1594
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /inference="alignment:Splign:1.39.8"
     variation       1503
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376438285"
     variation       1524
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371274349"
     variation       1530
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201500660"
     variation       1564
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199786173"
     exon            1595..2009
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /inference="alignment:Splign:1.39.8"
     variation       1655
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201755917"
     variation       1708
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372462204"
     variation       1774
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138673661"
     variation       1823
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375416658"
     variation       1867
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183884459"
     variation       1895
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200952142"
     variation       1903
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200000118"
     variation       1923
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201085147"
     variation       1974
                     /gene="KLHL10"
                     /gene_synonym="SPGF11"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188968821"
ORIGIN      
aggattctggaacttgggttgcctgatagaccctatacaaaagatgtagtagggaaaaggagcgacagctggctaaaggggccccccacaaccctccccgacaccctaggaaagcagcctctctccgctgtcccagggtgccatggagatggagagcgcggcggcctccacacgtttccaccagcctcacatggagaggaagatgagtgcgatggcctgtgagatcttcaacgagcttagactagagggcaagctctgcgacgtggtcatcaaggtcaatggctttgagttcagtgcccataagaacatcctctgtagctgcagttcctactttagagctttgtttacaagtggctggaacaacactgaaaagaaggtatacaacatccctggcatttctcccgacatgatgaagctaatcattgagtatgcatacacccggaccgtgcctatcacaccggacaatgtggagaaactgcttgctgctgcagaccagtttaacatcatgggtatcgtcaggggttgctgcgagttcctcaagtcagagctgtgcttggataattgtatcggcatctgtaagttcacggactactactactgtcctgagctgaggcagaaggcctacatgttcatactgcacaactttgaggagatggtgaaagtctcggcagaatttttagagctctcggtcactgaacttaaggatatcattgagaaagatgagctcaatgtcaaacaggaagatgctgtatttgaggccattttaaagtggatttctcatgacccccaaaatagaaagcagcacatttcaattttgcttcctaaggttcgcctggccctaatgcatgctgagtacttcatgaacaatgttaagatgaatgactatgtcaaagacagtgaggaatgcaaaccagtcatcattaatgccctaaaggccatgtatgacctcaacatgaatggaccctctaattctgatttcaccaacccactcaccagaccacgcttgccctatgccatcctctttgcaattggtggctggagtggtgggagccccaccaatgccattgaggcatatgacgctcgggcagacagatgggtgaatgttacttgtgaggaagagagtccccgtgcctaccatggggcagcctatttgaaaggctatgtgtatatcattggggggtttgatagtgtagactatttcaatagtgttaagcgttttgacccagtcaagaaaacttggcatcaggtggccccgatgcactccagacgttgctatgtcagtgtgacagtcctcggcaattttatttatgccatgggaggatttgatggctacgtgcgtctaaacactgctgaacgttatgagccagagaccaatcaatggacactcatcgcccccatgcacgaacagaggagtgatgcaagcgccacaacactttatgggaaggtctacatatgtggtgggtttaatggaaacgagtgcctgttcacagcagaagtgtataacactgaaagtaatcagtggacagtcatagcacccatgagaagcaggaggagtggaataggcgtgattgcttatggagaacatgtatatgcggtaggtggctttgatggagctaatcgacttaggagtgccgaagcctacagccctgtggctaacacttggcgcacaatccccactatgtttaatcctcgtagcaattttggcatcgaggtggtggatgacctcttgtttgtggtgggtggctttaatggttttaccaccacctttaatgttgagtgctatgatgaaaagaccgatgagtggtatgatgctcatgacatgagtatataccgcagtgctctgagctgctgtgtagtaccagggctggccaatgttgaggaatatgcagctagacgggacaacttcccaggattagcactgcgagatgaagtaaaatattctgcttcgacaagtaccctacctgtatgagcctcttcatttagctaataaaaagtctaagcaataagaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:317719 -> Biological process: GO:0000902 [cell morphogenesis] evidence: IEA
            GeneID:317719 -> Biological process: GO:0007286 [spermatid development] evidence: IEA
            GeneID:317719 -> Biological process: GO:0008584 [male gonad development] evidence: IEA
            GeneID:317719 -> Biological process: GO:0009566 [fertilization] evidence: IEA
            GeneID:317719 -> Biological process: GO:0016567 [protein ubiquitination] evidence: IEA
            GeneID:317719 -> Biological process: GO:0048808 [male genitalia morphogenesis] evidence: IEA
            GeneID:317719 -> Biological process: GO:0048873 [homeostasis of number of cells within a tissue] evidence: IEA
            GeneID:317719 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.