Home |
Help |
Advanced search
2025-05-09 17:34:54, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_152467 2009 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens kelch-like family member 10 (KLHL10), mRNA.
ACCESSION NM_152467
VERSION NM_152467.3 GI:148664208
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2009)
AUTHORS Qiu,Q.M., Liu,G., Li,W.N., Shi,Q.W., Zhu,F.X. and Lu,G.X.
TITLE [Mutation of KLHL-10 in idiopathic infertile males with
azoospermia, oligospermia or asthenospermia]
JOURNAL Zhonghua Nan Ke Xue 15 (11), 974-979 (2009)
PUBMED 20218307
REMARK GeneRIF: The KLHL-10 gene is not a major contributor to
azoospermia, oligospermia or asthenospermia in Chinese population.
GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 2 (bases 1 to 2009)
AUTHORS Yatsenko,A.N., Roy,A., Chen,R., Ma,L., Murthy,L.J., Yan,W.,
Lamb,D.J. and Matzuk,M.M.
TITLE Non-invasive genetic diagnosis of male infertility using
spermatozoal RNA: KLHL10 mutations in oligozoospermic patients
impair homodimerization
JOURNAL Hum. Mol. Genet. 15 (23), 3411-3419 (2006)
PUBMED 17047026
REFERENCE 3 (bases 1 to 2009)
AUTHORS Yan,W., Ma,L., Burns,K.H. and Matzuk,M.M.
TITLE Haploinsufficiency of kelch-like protein homolog 10 causes
infertility in male mice
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 101 (20), 7793-7798 (2004)
PUBMED 15136734
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
BP371285.1 and AY495339.1.
On Jun 7, 2007 this sequence version replaced gi:141801763.
##Evidence-Data-START##
Transcript exon combination :: AY495339.1, BC067753.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084, ERS025085 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-18 BP371285.1 1-18
19-2009 AY495339.1 1-1991
FEATURES Location/Qualifiers
source 1..2009
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="17"
/map="17q21.2"
gene 1..2009
/gene="KLHL10"
/gene_synonym="SPGF11"
/note="kelch-like family member 10"
/db_xref="GeneID:317719"
/db_xref="HGNC:18829"
/db_xref="MIM:608778"
exon 1..336
/gene="KLHL10"
/gene_synonym="SPGF11"
/inference="alignment:Splign:1.39.8"
variation 63
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:371974508"
variation 104
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:371854228"
misc_feature 107..109
/gene="KLHL10"
/gene_synonym="SPGF11"
/note="upstream in-frame stop codon"
CDS 143..1969
/gene="KLHL10"
/gene_synonym="SPGF11"
/note="kelch-like 10"
/codon_start=1
/product="kelch-like protein 10"
/protein_id="NP_689680.2"
/db_xref="GI:148664209"
/db_xref="CCDS:CCDS42340.1"
/db_xref="GeneID:317719"
/db_xref="HGNC:18829"
/db_xref="MIM:608778"
/translation="
MEMESAAASTRFHQPHMERKMSAMACEIFNELRLEGKLCDVVIKVNGFEFSAHKNILCSCSSYFRALFTSGWNNTEKKVYNIPGISPDMMKLIIEYAYTRTVPITPDNVEKLLAAADQFNIMGIVRGCCEFLKSELCLDNCIGICKFTDYYYCPELRQKAYMFILHNFEEMVKVSAEFLELSVTELKDIIEKDELNVKQEDAVFEAILKWISHDPQNRKQHISILLPKVRLALMHAEYFMNNVKMNDYVKDSEECKPVIINALKAMYDLNMNGPSNSDFTNPLTRPRLPYAILFAIGGWSGGSPTNAIEAYDARADRWVNVTCEEESPRAYHGAAYLKGYVYIIGGFDSVDYFNSVKRFDPVKKTWHQVAPMHSRRCYVSVTVLGNFIYAMGGFDGYVRLNTAERYEPETNQWTLIAPMHEQRSDASATTLYGKVYICGGFNGNECLFTAEVYNTESNQWTVIAPMRSRRSGIGVIAYGEHVYAVGGFDGANRLRSAEAYSPVANTWRTIPTMFNPRSNFGIEVVDDLLFVVGGFNGFTTTFNVECYDEKTDEWYDAHDMSIYRSALSCCVVPGLANVEEYAARRDNFPGLALRDEVKYSASTSTLPV
"
misc_feature 227..541
/gene="KLHL10"
/gene_synonym="SPGF11"
/note="BTB/POZ domain; Region: BTB; pfam00651"
/db_xref="CDD:201372"
misc_feature 248..1858
/gene="KLHL10"
/gene_synonym="SPGF11"
/note="kelch-like protein; Provisional; Region: PHA03098"
/db_xref="CDD:165380"
misc_feature 563..865
/gene="KLHL10"
/gene_synonym="SPGF11"
/note="BTB And C-terminal Kelch; Region: BACK; pfam07707"
/db_xref="CDD:149006"
misc_feature 1016..1159
/gene="KLHL10"
/gene_synonym="SPGF11"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q6JEL2.1);
Region: Kelch 1"
misc_feature 1019..1159
/gene="KLHL10"
/gene_synonym="SPGF11"
/note="Kelch domain; Region: Kelch; smart00612"
/db_xref="CDD:128874"
misc_feature 1160..1300
/gene="KLHL10"
/gene_synonym="SPGF11"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q6JEL2.1);
Region: Kelch 2"
misc_feature 1163..1300
/gene="KLHL10"
/gene_synonym="SPGF11"
/note="Kelch domain; Region: Kelch; smart00612"
/db_xref="CDD:128874"
misc_feature 1265..1399
/gene="KLHL10"
/gene_synonym="SPGF11"
/note="Kelch motif; Region: Kelch_1; pfam01344"
/db_xref="CDD:201739"
misc_feature 1304..1441
/gene="KLHL10"
/gene_synonym="SPGF11"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q6JEL2.1);
Region: Kelch 3"
misc_feature 1442..1582
/gene="KLHL10"
/gene_synonym="SPGF11"
/note="Kelch domain; Region: Kelch; smart00612"
/db_xref="CDD:128874"
misc_feature 1442..1582
/gene="KLHL10"
/gene_synonym="SPGF11"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q6JEL2.1);
Region: Kelch 4"
misc_feature 1583..1723
/gene="KLHL10"
/gene_synonym="SPGF11"
/note="Kelch domain; Region: Kelch; smart00612"
/db_xref="CDD:128874"
misc_feature 1583..1723
/gene="KLHL10"
/gene_synonym="SPGF11"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q6JEL2.1);
Region: Kelch 5"
misc_feature 1724..1864
/gene="KLHL10"
/gene_synonym="SPGF11"
/note="Kelch domain; Region: Kelch; smart00612"
/db_xref="CDD:128874"
misc_feature 1727..1864
/gene="KLHL10"
/gene_synonym="SPGF11"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q6JEL2.1);
Region: Kelch 6"
variation 143
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:375478864"
variation 146..147
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace=""
/replace="a"
/db_xref="dbSNP:35627442"
variation 158
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:200592199"
variation 163
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:368540358"
variation 260
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:150254995"
variation 262
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:371429407"
exon 337..826
/gene="KLHL10"
/gene_synonym="SPGF11"
/inference="alignment:Splign:1.39.8"
variation 365
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:376803007"
variation 372
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="c"
/db_xref="dbSNP:369676198"
variation 379
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="t"
/db_xref="dbSNP:377742054"
variation 384
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="t"
/db_xref="dbSNP:36065902"
variation 390
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:202162199"
variation 396
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:115928775"
variation 403
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:1529933"
variation 404
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:374071801"
variation 421
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:375880722"
variation 460
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:370786117"
variation 517
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:192564496"
variation 530
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:201335504"
variation 589
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="g"
/db_xref="dbSNP:369099688"
variation 625
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:202110308"
variation 651
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="c"
/db_xref="dbSNP:200286521"
variation 658
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="g"
/replace="t"
/db_xref="dbSNP:200355741"
variation 736
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:147108868"
variation 749
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:199599875"
variation 764
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:201438905"
variation 769
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:374553069"
variation 779
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="c"
/db_xref="dbSNP:371552751"
variation 789
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="c"
/db_xref="dbSNP:116420871"
exon 827..1444
/gene="KLHL10"
/gene_synonym="SPGF11"
/inference="alignment:Splign:1.39.8"
variation 830
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:376975543"
variation 843
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:200957650"
variation 847
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:369592598"
variation 851
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="g"
/db_xref="dbSNP:374019359"
variation 885
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:190847775"
variation 946
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:376902362"
variation 954
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:141860514"
variation 966
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:372414978"
variation 993
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:375992901"
variation 1022
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:150706383"
variation 1029
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:61752339"
variation 1065
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:377399919"
variation 1079
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:370756367"
variation 1091
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:149895408"
variation 1108
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:34933374"
variation 1109
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:181049067"
variation 1121
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="c"
/db_xref="dbSNP:371705445"
variation 1141
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:199930359"
variation 1151
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:185984794"
variation 1189
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:374708612"
variation 1212
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:200544803"
variation 1214
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:372217780"
variation 1280
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:375231468"
variation 1294
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:199535981"
variation 1295
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:114530188"
variation 1345
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:368599949"
variation 1364
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:371906448"
variation 1380
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:369767656"
variation 1387
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="c"
/db_xref="dbSNP:200538026"
variation 1408
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="g"
/db_xref="dbSNP:372533912"
variation 1423
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:201906870"
exon 1445..1594
/gene="KLHL10"
/gene_synonym="SPGF11"
/inference="alignment:Splign:1.39.8"
variation 1503
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:376438285"
variation 1524
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="g"
/db_xref="dbSNP:371274349"
variation 1530
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:201500660"
variation 1564
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:199786173"
exon 1595..2009
/gene="KLHL10"
/gene_synonym="SPGF11"
/inference="alignment:Splign:1.39.8"
variation 1655
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:201755917"
variation 1708
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="g"
/db_xref="dbSNP:372462204"
variation 1774
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:138673661"
variation 1823
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:375416658"
variation 1867
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:183884459"
variation 1895
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:200952142"
variation 1903
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="t"
/db_xref="dbSNP:200000118"
variation 1923
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="a"
/replace="g"
/db_xref="dbSNP:201085147"
variation 1974
/gene="KLHL10"
/gene_synonym="SPGF11"
/replace="c"
/replace="g"
/db_xref="dbSNP:188968821"
ORIGIN
aggattctggaacttgggttgcctgatagaccctatacaaaagatgtagtagggaaaaggagcgacagctggctaaaggggccccccacaaccctccccgacaccctaggaaagcagcctctctccgctgtcccagggtgccatggagatggagagcgcggcggcctccacacgtttccaccagcctcacatggagaggaagatgagtgcgatggcctgtgagatcttcaacgagcttagactagagggcaagctctgcgacgtggtcatcaaggtcaatggctttgagttcagtgcccataagaacatcctctgtagctgcagttcctactttagagctttgtttacaagtggctggaacaacactgaaaagaaggtatacaacatccctggcatttctcccgacatgatgaagctaatcattgagtatgcatacacccggaccgtgcctatcacaccggacaatgtggagaaactgcttgctgctgcagaccagtttaacatcatgggtatcgtcaggggttgctgcgagttcctcaagtcagagctgtgcttggataattgtatcggcatctgtaagttcacggactactactactgtcctgagctgaggcagaaggcctacatgttcatactgcacaactttgaggagatggtgaaagtctcggcagaatttttagagctctcggtcactgaacttaaggatatcattgagaaagatgagctcaatgtcaaacaggaagatgctgtatttgaggccattttaaagtggatttctcatgacccccaaaatagaaagcagcacatttcaattttgcttcctaaggttcgcctggccctaatgcatgctgagtacttcatgaacaatgttaagatgaatgactatgtcaaagacagtgaggaatgcaaaccagtcatcattaatgccctaaaggccatgtatgacctcaacatgaatggaccctctaattctgatttcaccaacccactcaccagaccacgcttgccctatgccatcctctttgcaattggtggctggagtggtgggagccccaccaatgccattgaggcatatgacgctcgggcagacagatgggtgaatgttacttgtgaggaagagagtccccgtgcctaccatggggcagcctatttgaaaggctatgtgtatatcattggggggtttgatagtgtagactatttcaatagtgttaagcgttttgacccagtcaagaaaacttggcatcaggtggccccgatgcactccagacgttgctatgtcagtgtgacagtcctcggcaattttatttatgccatgggaggatttgatggctacgtgcgtctaaacactgctgaacgttatgagccagagaccaatcaatggacactcatcgcccccatgcacgaacagaggagtgatgcaagcgccacaacactttatgggaaggtctacatatgtggtgggtttaatggaaacgagtgcctgttcacagcagaagtgtataacactgaaagtaatcagtggacagtcatagcacccatgagaagcaggaggagtggaataggcgtgattgcttatggagaacatgtatatgcggtaggtggctttgatggagctaatcgacttaggagtgccgaagcctacagccctgtggctaacacttggcgcacaatccccactatgtttaatcctcgtagcaattttggcatcgaggtggtggatgacctcttgtttgtggtgggtggctttaatggttttaccaccacctttaatgttgagtgctatgatgaaaagaccgatgagtggtatgatgctcatgacatgagtatataccgcagtgctctgagctgctgtgtagtaccagggctggccaatgttgaggaatatgcagctagacgggacaacttcccaggattagcactgcgagatgaagtaaaatattctgcttcgacaagtaccctacctgtatgagcctcttcatttagctaataaaaagtctaagcaataagaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:317719 -> Biological process: GO:0000902 [cell morphogenesis] evidence: IEA
GeneID:317719 -> Biological process: GO:0007286 [spermatid development] evidence: IEA
GeneID:317719 -> Biological process: GO:0008584 [male gonad development] evidence: IEA
GeneID:317719 -> Biological process: GO:0009566 [fertilization] evidence: IEA
GeneID:317719 -> Biological process: GO:0016567 [protein ubiquitination] evidence: IEA
GeneID:317719 -> Biological process: GO:0048808 [male genitalia morphogenesis] evidence: IEA
GeneID:317719 -> Biological process: GO:0048873 [homeostasis of number of cells within a tissue] evidence: IEA
GeneID:317719 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.