Home |
Help |
Advanced search
2025-05-09 17:34:54, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_138709 3500 bp mRNA linear PRI 15-JUL-2013
DEFINITION Homo sapiens DAB2 interacting protein (DAB2IP), transcript variant
2, mRNA.
ACCESSION NM_138709
VERSION NM_138709.1 GI:41281682
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3500)
AUTHORS Xu,S., Zhou,Y., Du,W.D., Chen,G., Zhou,F.S., Schneider,M., Ma,X.L.,
Xu,H.Y. and Zhang,X.J.
TITLE Association of the variant rs2243421 of human DOC-2/DAB2
interactive protein gene (hDAB2IP) with gastric cancer in the
Chinese Han population
JOURNAL Gene 515 (1), 200-204 (2013)
PUBMED 23246699
REMARK GeneRIF: Our results for the first time provided new insight into
susceptibility factors of hDAB2IP gene variants in carcinogenesis
of gastric cancer.
REFERENCE 2 (bases 1 to 3500)
AUTHORS Del-Aguila,J.L., Beitelshees,A.L., Cooper-Dehoff,R.M.,
Chapman,A.B., Gums,J.G., Bailey,K., Gong,Y., Turner,S.T.,
Johnson,J.A. and Boerwinkle,E.
TITLE Genome-wide association analyses suggest NELL1 influences adverse
metabolic response to HCTZ in African Americans
JOURNAL Pharmacogenomics J. (2013) In press
PUBMED 23400010
REMARK Publication Status: Available-Online prior to print
REFERENCE 3 (bases 1 to 3500)
AUTHORS Yu,L., Tumati,V., Tseng,S.F., Hsu,F.M., Kim,D.N., Hong,D.,
Hsieh,J.T., Jacobs,C., Kapur,P. and Saha,D.
TITLE DAB2IP regulates autophagy in prostate cancer in response to
combined treatment of radiation and a DNA-PKcs inhibitor
JOURNAL Neoplasia 14 (12), 1203-1212 (2012)
PUBMED 23308052
REMARK GeneRIF: In this study, we show a novel function of DAB2IP in
suppressing radiation-induced and DNA-PKcs-associated autophagy and
promoting apoptosis in prostate cancer cells.
REFERENCE 4 (bases 1 to 3500)
AUTHORS Ji,W., Li,Y., Wan,T., Wang,J., Zhang,H., Chen,H. and Min,W.
TITLE Both internalization and AIP1 association are required for tumor
necrosis factor receptor 2-mediated JNK signaling
JOURNAL Arterioscler. Thromb. Vasc. Biol. 32 (9), 2271-2279 (2012)
PUBMED 22743059
REMARK GeneRIF: Both internalization and ASK1-interacting protein-1
association are required for TNFR2-dependent JNK and apoptotic
signaling in endothelial cells.
REFERENCE 5 (bases 1 to 3500)
AUTHORS Divaris,K., Monda,K.L., North,K.E., Olshan,A.F., Lange,E.M.,
Moss,K., Barros,S.P., Beck,J.D. and Offenbacher,S.
TITLE Genome-wide association study of periodontal pathogen colonization
JOURNAL J. Dent. Res. 91 (7 SUPPL), 21S-28S (2012)
PUBMED 22699663
REFERENCE 6 (bases 1 to 3500)
AUTHORS von Bergh,A.R., Wijers,P.M., Groot,A.J., van Zelderen-Bhola,S.,
Falkenburg,J.H., Kluin,P.M. and Schuuring,E.
TITLE Identification of a novel RAS GTPase-activating protein (RASGAP)
gene at 9q34 as an MLL fusion partner in a patient with de novo
acute myeloid leukemia
JOURNAL Genes Chromosomes Cancer 39 (4), 324-334 (2004)
PUBMED 14978793
REFERENCE 7 (bases 1 to 3500)
AUTHORS Zhang,R., He,X., Liu,W., Lu,M., Hsieh,J.T. and Min,W.
TITLE AIP1 mediates TNF-alpha-induced ASK1 activation by facilitating
dissociation of ASK1 from its inhibitor 14-3-3
JOURNAL J. Clin. Invest. 111 (12), 1933-1943 (2003)
PUBMED 12813029
REFERENCE 8 (bases 1 to 3500)
AUTHORS Chen,H., Toyooka,S., Gazdar,A.F. and Hsieh,J.T.
TITLE Epigenetic regulation of a novel tumor suppressor gene (hDAB2IP) in
prostate cancer cell lines
JOURNAL J. Biol. Chem. 278 (5), 3121-3130 (2003)
PUBMED 12446720
REMARK GeneRIF: Epigenetic regulation of this novel tumor suppressor gene
in prostate cancer cell lines.
REFERENCE 9 (bases 1 to 3500)
AUTHORS Wang,Z., Tseng,C.P., Pong,R.C., Chen,H., McConnell,J.D., Navone,N.
and Hsieh,J.T.
TITLE The mechanism of growth-inhibitory effect of DOC-2/DAB2 in prostate
cancer. Characterization of a novel GTPase-activating protein
associated with N-terminal domain of DOC-2/DAB2
JOURNAL J. Biol. Chem. 277 (15), 12622-12631 (2002)
PUBMED 11812785
REFERENCE 10 (bases 1 to 3500)
AUTHORS Chen,H., Pong,R.C., Wang,Z. and Hsieh,J.T.
TITLE Differential regulation of the human gene DAB2IP in normal and
malignant prostatic epithelia: cloning and characterization
JOURNAL Genomics 79 (4), 573-581 (2002)
PUBMED 11944990
REMARK GeneRIF: Normal prostatic epithelial cells have elevated DAB2IP
mRNA compared with cancer cells, which correlates with increased
DAB2IP promoter activity.
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AY032952.1.
Summary: DAB2IP is a Ras (MIM 190020) GTPase-activating protein
(GAP) that acts as a tumor suppressor. The DAB2IP gene is
inactivated by methylation in prostate and breast cancers (Yano et
al., 2005 [PubMed 15386433]).[supplied by OMIM, May 2010].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AY032952.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084, ERS025088 [ECO:0000348]
##Evidence-Data-END##
FEATURES Location/Qualifiers
source 1..3500
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="9"
/map="9q33.1-q33.3"
gene 1..3500
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/note="DAB2 interacting protein"
/db_xref="GeneID:153090"
/db_xref="HGNC:17294"
/db_xref="HPRD:09903"
/db_xref="MIM:609205"
exon 1..137
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/inference="alignment:Splign:1.39.8"
misc_feature 73..75
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/note="upstream in-frame stop codon"
variation 118
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="g"
/replace="t"
/db_xref="dbSNP:186756127"
exon 138..291
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/inference="alignment:Splign:1.39.8"
variation 140
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:202163855"
CDS 148..3345
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/note="isoform 2 is encoded by transcript variant 2;
ASK1-interacting protein 1; nGAP-like protein; DOC-2/DAB2
interactive protein; disabled homolog 2-interacting
protein; DAB2 interaction protein; DAB2-interacting
protein; ASK-interacting protein 1; DOC-2/DAB-2
interactive protein"
/codon_start=1
/product="disabled homolog 2-interacting protein isoform
2"
/protein_id="NP_619723.1"
/db_xref="GI:41281683"
/db_xref="CCDS:CCDS6832.1"
/db_xref="GeneID:153090"
/db_xref="HGNC:17294"
/db_xref="HPRD:09903"
/db_xref="MIM:609205"
/translation="
MPRLKESRSHESLLSPSSAVEALDLSMEEEVVIKPVHSSILGQDYCFEVTTSSGSKCFSCRSAAERDKWMENLRRAVHPNKDNSRRVEHILKLWVIEAKDLPAKKKYLCELCLDDVLYARTTGKLKTDNVFWGEHFEFHNLPPLRTVTVHLYRETDKKKKKERNSYLGLVSLPAASVAGRQFVEKWYPVVTPNPKGGKGPGPMIRIKARYQTITILPMEMYKEFAEHITNHYLGLCAALEPILSAKTKEEMASALVHILQSTGKVKDFLTDLMMSEVDRCGDNEHLIFRENTLATKAIEEYLKLVGQKYLQDALGEFIKALYESDENCEVDPSKCSAADLPEHQGNLKMCCELAFCKIINSYCVFPRELKEVFASWRQECSSRGRPDISERLISASLFLRFLCPAIMSPSLFNLLQEYPDDRTARTLTLIAKVTQNLANFAKFGSKEEYMSFMNQFLEHEWTNMQRFLLEISNPETLSNTAGFEGYIDLGRELSSLHSLLWEAVSQLEQSIVSKLGPLPRILRDVHTALSTPGSGQLPGTNDLASTPGSGSSSISAGLQKMVIENDLSGLIDFTRLPSPTPENKDLFFVTRSSGVQPSPARSSSYSEANEPDLQMANGGKSLSMVDLQDARTLDGEAGSPAGPDVLPTDGQAAAAQLVAGWPARATPVNLAGLATVRRAGQTPTTPGTSEGAPGRPQLLAPLSFQNPVYQMAAGLPLSPRGLGDSGSEGHSSLSSHSNSEELAAAAKLGSFSTAAEELARRPGELARRQMSLTEKGGQPTVPRQNSAGPQRRIDQPPPPPPPPPPAPRGRTPPNLLSTLQYPRPSSGTLASASPDWVGPSTRLRQQSSSSKGDSPELKPRAVHKQGPSPVSPNALDRTAAWLLTMNAQLLEDEGLGPDPPHRDRLRSKDELSQAEKDLAVLQDKLRISTKKLEEYETLFKCQEETTQKLVLEYQARLEEGEERLRRQQEDKDIQMKGIISRLMSVEEELKKDHAEMQAAVDSKQKIIDAQEKRIASLDAANARLMSALTQLKERYSMQARNGISPTNPTKLQITENGEFRNSSNC
"
misc_feature <202..375
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/note="Pleckstrin homology-like domain; Region: PH-like;
cl00273"
/db_xref="CDD:206947"
misc_feature order(262..273,283..297,316..330,349..375)
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/note="PH-like core; other site"
/db_xref="CDD:176275"
misc_feature 382..801
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/note="C2 domain present in Ras GTPase activating protein
(GAP) family; Region: C2_SynGAP_like; cd04013"
/db_xref="CDD:175980"
misc_feature 802..1722
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/note="The DAB2IP family of Ras GTPase-activating proteins
includes DAB2IP, nGAP, and Syn GAP. Disabled 2 interactive
protein, (DAB2IP; also known as ASK-interacting protein 1
(AIP1)), is a member of the GTPase-activating proteins,
down-regulates Ras-mediated...; Region: RasGAP_DAB2IP;
cd05136"
/db_xref="CDD:88576"
misc_feature order(889..891,1000..1002,1012..1023,1042..1044,
1318..1320,1342..1347,1354..1359,1441..1443,1462..1464,
1468..1470,1483..1488)
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/note="putative GAP/RAS interaction site [polypeptide
binding]; other site"
/db_xref="CDD:88576"
misc_feature 1711..3252
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/note="Domain of unknown function (DUF3498); Region:
DUF3498; pfam12004"
/db_xref="CDD:152439"
variation 152
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:373885033"
variation 153
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:200818458"
variation 157
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:199832930"
variation 158
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:150226818"
variation 166
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:188350283"
variation 169
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:138827521"
variation 170
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201767314"
variation 186
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="g"
/db_xref="dbSNP:377575300"
variation 197
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="g"
/replace="t"
/db_xref="dbSNP:370182641"
variation 205
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:148946129"
variation 212
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:373166769"
variation 213
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:143770081"
variation 219
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:138442421"
variation 252
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="g"
/db_xref="dbSNP:35510547"
variation 271
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201351997"
exon 292..390
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/inference="alignment:Splign:1.39.8"
variation 297
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:190940502"
variation 324
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="c"
/db_xref="dbSNP:370347740"
variation 328
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:147323804"
variation 347
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="c"
/db_xref="dbSNP:200002701"
variation 348
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:374038020"
variation 368
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:368193656"
variation 370
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="c"
/db_xref="dbSNP:114266755"
variation 375
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:3747851"
exon 391..945
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/inference="alignment:Splign:1.39.8"
variation 401
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:150710857"
variation 482
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="g"
/replace="t"
/db_xref="dbSNP:199878386"
variation 533
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:367747884"
variation 540
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:34727342"
variation 555
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:201994635"
variation 572
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:200997326"
variation 578
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:376851410"
variation 594
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="g"
/db_xref="dbSNP:149894049"
variation 606
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:144040487"
variation 613
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:200273040"
variation 624
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:41273440"
variation 627
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:34839326"
variation 648
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:146750250"
variation 674
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:369573008"
variation 675
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:202119015"
variation 681
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:140379738"
variation 685
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:373749384"
variation 702
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:142280608"
variation 711
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:375810712"
variation 715
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201266598"
variation 770
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:201959346"
variation 771
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:34334373"
variation 777
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:41273442"
variation 816
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201057911"
variation 829
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201397224"
variation 847
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="g"
/replace="t"
/db_xref="dbSNP:112361531"
variation 849
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:143033667"
variation 876
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:150428926"
variation 882
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:138506377"
variation 884
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:192522695"
variation 920
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:200565908"
exon 946..1090
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/inference="alignment:Splign:1.39.8"
variation 960
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="g"
/db_xref="dbSNP:375600016"
variation 988
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:142519289"
variation 993
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="c"
/db_xref="dbSNP:370152633"
variation 999
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:372829760"
variation 1012
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370747909"
variation 1014
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:146911285"
variation 1024
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:80008292"
variation 1083
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:149420814"
exon 1091..1235
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/inference="alignment:Splign:1.39.8"
variation 1106
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:371930308"
variation 1108
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:376373696"
variation 1152
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:77220406"
variation 1154
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:76191175"
variation 1155
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:373776876"
variation 1158
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:375557765"
variation 1159
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:141706892"
variation 1171
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:145965964"
variation 1197
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:376330730"
variation 1200
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:139934832"
variation 1208
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:368910721"
exon 1236..1472
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/inference="alignment:Splign:1.39.8"
variation 1242
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:375151401"
variation 1252
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:182562255"
variation 1260
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374953875"
variation 1267
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:145267973"
variation 1271
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:200497980"
variation 1272
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:371966536"
variation 1294
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:373995748"
variation 1295
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:368453566"
variation 1305
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:372045771"
variation 1319
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:141771432"
variation 1329
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:201506332"
variation 1346
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:146233036"
variation 1386
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:375368221"
variation 1394
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:372284148"
variation 1419
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="c"
/db_xref="dbSNP:139420347"
variation 1432
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="g"
/db_xref="dbSNP:374667920"
variation 1440
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:78398519"
exon 1473..1674
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/inference="alignment:Splign:1.39.8"
variation 1485
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:143825896"
variation 1492
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="g"
/replace="t"
/db_xref="dbSNP:113032925"
variation 1497
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="g"
/replace="t"
/db_xref="dbSNP:376629723"
variation 1588
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="g"
/replace="t"
/db_xref="dbSNP:200519908"
variation 1591
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:369754590"
variation 1606
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:376186048"
variation 1642
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:376861447"
variation 1657
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:149945931"
exon 1675..1853
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/inference="alignment:Splign:1.39.8"
variation 1706
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:371856149"
variation 1719
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:374196620"
variation 1731
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:368371667"
variation 1749
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:145735158"
variation 1760
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:148506189"
variation 1787
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:199563033"
variation 1788
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:371535507"
variation 1800
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="c"
/db_xref="dbSNP:376071498"
variation 1821
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:369300184"
variation 1842
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:142889743"
variation 1843
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:147687395"
variation 1850
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="g"
/db_xref="dbSNP:186101367"
exon 1854..2742
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/inference="alignment:Splign:1.39.8"
variation 1870
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:374349526"
variation 1871
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:377052245"
variation 1890
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:146791892"
variation 1926
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:147918500"
variation 1930
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:370343273"
variation 1948
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:200771794"
variation 1957
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="t"
/db_xref="dbSNP:140605079"
variation 1974
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:201508886"
variation 1983
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:150482022"
variation 1998
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:372674684"
variation 2039
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:199732967"
variation 2045
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="t"
/db_xref="dbSNP:200073956"
variation 2049
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="t"
/db_xref="dbSNP:368301140"
variation 2055
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:371971340"
variation 2061
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="g"
/db_xref="dbSNP:74792331"
variation 2069
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:201992293"
variation 2076
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370109988"
variation 2079
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:34301794"
variation 2086
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:372120275"
variation 2094
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="t"
/db_xref="dbSNP:189270684"
variation 2103
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:34923170"
variation 2105
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:373611896"
variation 2116..2117
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace=""
/replace="t"
/db_xref="dbSNP:34632435"
variation 2124
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:377593194"
variation 2171
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370862211"
variation 2177
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:137949148"
variation 2212
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="g"
/replace="t"
/db_xref="dbSNP:149452173"
variation 2220
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:144586865"
variation 2221
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:34458419"
variation 2222
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:141593526"
variation 2250
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:146245060"
variation 2256
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:35706546"
variation 2282
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:141810290"
variation 2283
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="g"
/replace="t"
/db_xref="dbSNP:373684988"
variation 2324
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="g"
/db_xref="dbSNP:376857569"
variation 2346
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="g"
/replace="t"
/db_xref="dbSNP:371528560"
variation 2364
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:150585317"
variation 2371
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:374731021"
variation 2395
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="c"
/db_xref="dbSNP:367690998"
variation 2396
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:139267584"
variation 2409
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370257448"
variation 2410
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:145366203"
variation 2411
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:147657880"
variation 2412
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:368800049"
variation 2433
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:373922763"
variation 2434
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:199598085"
variation 2442
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:113815211"
variation 2446
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:191595599"
variation 2456
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="t"
/db_xref="dbSNP:376519748"
variation 2475
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:368492360"
variation 2486
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:183735294"
variation 2487
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:372787392"
variation 2494
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:56200518"
variation 2572
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201889776"
variation 2621
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:368754133"
variation 2623
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:373299937"
variation 2637
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:200577247"
variation 2671
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:371407818"
variation 2672
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:114838746"
variation 2682
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:376759925"
variation 2688
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:147942555"
variation 2704
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:148978268"
exon 2743..2895
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/inference="alignment:Splign:1.39.8"
variation 2765
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:143836788"
variation 2778
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:151122611"
variation 2784
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:141080470"
variation 2793
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="g"
/db_xref="dbSNP:144609886"
variation 2805
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:138505036"
variation 2808
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:371735785"
variation 2820
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:190856269"
variation 2823
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:199878545"
variation 2828
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="g"
/replace="t"
/db_xref="dbSNP:367742152"
variation 2842
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="c"
/db_xref="dbSNP:141691348"
variation 2846
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="g"
/db_xref="dbSNP:145340237"
variation 2848
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="c"
/db_xref="dbSNP:138053639"
exon 2896..3089
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/inference="alignment:Splign:1.39.8"
variation 2908
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="c"
/db_xref="dbSNP:78083431"
variation 2913
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:183020944"
variation 2933
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:149504970"
variation 2982
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:147553080"
variation 2985
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201092583"
variation 3028
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374129525"
variation 3052
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:368342737"
exon 3090..3177
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/inference="alignment:Splign:1.39.8"
variation 3090..3091
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace=""
/replace="t"
/db_xref="dbSNP:34016532"
variation 3100
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:200849707"
STS 3110..3325
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/standard_name="MARC_10012-10013:996678884:1"
/db_xref="UniSTS:267012"
variation 3126
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:376673781"
variation 3149
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:112159524"
variation 3153
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:373962032"
exon 3178..3500
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/inference="alignment:Splign:1.39.8"
STS 3235..3367
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/standard_name="RH16168"
/db_xref="UniSTS:50704"
variation 3265
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="c"
/replace="t"
/db_xref="dbSNP:117152313"
variation 3366
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:80315580"
variation 3378
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="g"
/db_xref="dbSNP:56186860"
variation 3490
/gene="DAB2IP"
/gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
/replace="a"
/replace="t"
/db_xref="dbSNP:199642322"
ORIGIN
tgttcctcttctttcgtgttgtgtcagaagccatgatttccagtcttctcatctggaagatgaaggaaaagatagacccgaccccacagggttctgaggctcaaactgaaagcctggtggtggggcacctgtgacaggtcccatctgatgccgaggctgaaggagtctcgctcccacgagtccctgctcagccccagcagtgcggtggaggcgctggacctcagcatggaggaagaggtggtcatcaagcccgtgcacagcagcatccttggccaggactactgcttcgaggtgacgacgtcatcaggaagcaagtgcttttcctgccggtctgcagctgagcgggataagtggatggagaacctccggcgagcggtgcatcccaacaaggacaacagccggcgtgtggagcacatcctgaagctgtgggtgatcgaggccaaggacctgccagccaagaagaagtacctgtgcgagctgtgcctggacgatgtgctctatgcccgcaccacgggcaagctcaagacggacaatgttttctggggcgagcacttcgagttccacaacttgccgcctctgcgcacggtcactgtccacctgtaccgggagaccgacaagaagaagaagaaggagcgcaacagttacctgggcctggtgagcctacctgctgcctcggtggccgggcggcagttcgtggagaagtggtacccggtggtgacgcccaaccccaagggcggcaagggccctggacccatgatccgcatcaaggcgcgctaccaaaccatcaccatcctgcccatggagatgtacaaagagttcgctgagcacatcaccaaccactacctggggctgtgtgcagccctcgagcccatcctcagtgccaagaccaaggaggagatggcatctgccctggtgcacatcctgcagagcacgggcaaggtgaaggacttcctgacagacctgatgatgtcagaggtggaccgctgcggggacaacgagcacctcatcttccgggagaacacactggccaccaaggccattgaggagtacctcaagctagtgggccagaagtacctgcaggacgccctaggtgagttcatcaaagcgctgtatgagtcagatgagaactgcgaagtggatcccagcaagtgctcggccgctgacctcccagagcaccagggcaacctcaagatgtgctgcgagctggccttctgcaagatcatcaactcctactgtgtcttcccacgggagttgaaagaggtgtttgcctcgtggaggcaggagtgcagcagtcgcggccgcccggacatcagtgagcggctcatcagcgcctccctcttcctgcgcttcctctgcccagccatcatgtcgccctcactcttcaacctgctgcaggagtaccctgatgaccgcactgcccgcaccctcaccctcatcgccaaggtcacccagaacctggccaactttgccaaatttggcagcaaggaggaatacatgtccttcatgaaccagttcctagagcatgagtggaccaacatgcagcgcttcctgctggagatctccaaccccgagaccctctccaatacagccggcttcgagggctacatcgacctgggccgcgagctctccagcctgcactcactgctctgggaggccgtcagccagctggagcagagcatagtatccaaactgggacccctgcctcggatcctgagggacgtccacacagcactgagcaccccaggtagcgggcagctcccagggaccaatgacctggcctccacaccgggctctggcagcagcagcatctcagctgggctgcagaagatggtgattgagaacgatctttccggtctgatagatttcacccggttaccgtctccaacccccgaaaacaaggacttgttttttgtcacaaggtcctccggggtccagccctcacctgcccgcagctcgagttactcggaagccaacgagcctgatcttcagatggccaacggtggcaagagcctctccatggtggacctccaggacgcccgcacgctggatggggaggcaggctccccggcgggccccgacgtcctccccacagatgggcaggccgctgcagctcagctggtggccgggtggccggcccgggcaaccccagtgaacctggcagggctggccacggtgcggcgggcaggccagacaccaaccacaccaggcacctccgagggcgcgccaggccggccccagctgttggcaccgctctccttccagaaccctgtgtaccagatggcggctggcctgccgctgtcaccccgtggccttggcgactcaggctctgagggccacagctccctgagctcacacagcaacagcgaggagttggcggctgctgccaagctgggaagtttcagcactgccgcggaggagctggctcggcggcccggtgagctggcacggcgacagatgtcactgactgaaaaaggcgggcagcccacggtgccacggcagaacagtgctggcccccagaggaggatcgaccagcctccgcccccacccccgccgccacctcctgccccccgcggccggacgccccccaacctgctgagcaccctgcagtacccaagaccctcaagcggaaccctggcgtcggcctcacctgattgggtgggccccagtacccgcctgaggcagcagtcctcttcctccaagggggacagcccagaactgaagccacgggcagtgcacaagcagggcccttcacctgtgagccccaatgccctggaccgcacagccgcttggctcttgaccatgaacgcgcagttgttagaagacgagggcctgggcccagaccccccccacagggataggctaaggagtaaggacgagctcagccaagcagaaaaggacctggcggtgctgcaggacaagctgcgaatctccaccaagaagctggaggagtatgagaccctgttcaagtgccaggaggagacgacgcagaagctggtgctggagtaccaggcacggctggaggagggcgaggagcggctgcggcggcagcaggaggacaaggacatccagatgaagggcatcatcagcaggttgatgtccgtggaggaagaactgaagaaggaccacgcagagatgcaagcggctgtggactccaaacagaagatcattgatgcccaggagaagcgcattgcctcgttggatgccgccaatgcccgcctcatgagtgccctgacccagctgaaagagaggtacagcatgcaagcccgtaacggcatctcccccaccaaccccaccaaattgcagattactgagaacggcgagttcagaaacagcagcaattgttaacctgcctgaggagggaggaagctacccaaggagagggggactatggtggccaagggcagggtctcggcctggggaggcacccacggttgcagccccagcgcgggtgtcaggaggccgagcctcccctccctgccgctgtccaggaggcggccgca
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:153090 -> Molecular function: GO:0005099 [Ras GTPase activator activity] evidence: IBA
GeneID:153090 -> Molecular function: GO:0005099 [Ras GTPase activator activity] evidence: ISS
GeneID:153090 -> Molecular function: GO:0005123 [death receptor binding] evidence: IPI
GeneID:153090 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:153090 -> Molecular function: GO:0017124 [SH3 domain binding] evidence: IDA
GeneID:153090 -> Molecular function: GO:0019900 [kinase binding] evidence: IPI
GeneID:153090 -> Molecular function: GO:0019901 [protein kinase binding] evidence: IPI
GeneID:153090 -> Molecular function: GO:0031434 [mitogen-activated protein kinase kinase binding] evidence: IPI
GeneID:153090 -> Molecular function: GO:0031435 [mitogen-activated protein kinase kinase kinase binding] evidence: IPI
GeneID:153090 -> Molecular function: GO:0032266 [phosphatidylinositol-3-phosphate binding] evidence: IDA
GeneID:153090 -> Molecular function: GO:0032403 [protein complex binding] evidence: IDA
GeneID:153090 -> Molecular function: GO:0035591 [signaling adaptor activity] evidence: IDA
GeneID:153090 -> Molecular function: GO:0035662 [Toll-like receptor 4 binding] evidence: IDA
GeneID:153090 -> Molecular function: GO:0036312 [phosphatidylinositol 3-kinase regulatory subunit binding] evidence: IDA
GeneID:153090 -> Molecular function: GO:0042802 [identical protein binding] evidence: IPI
GeneID:153090 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IPI
GeneID:153090 -> Molecular function: GO:0043184 [vascular endothelial growth factor receptor 2 binding] evidence: IPI
GeneID:153090 -> Molecular function: GO:0043548 [phosphatidylinositol 3-kinase binding] evidence: IDA
GeneID:153090 -> Molecular function: GO:0051721 [protein phosphatase 2A binding] evidence: IDA
GeneID:153090 -> Molecular function: GO:0070273 [phosphatidylinositol-4-phosphate binding] evidence: IDA
GeneID:153090 -> Molecular function: GO:0071889 [14-3-3 protein binding] evidence: IDA
GeneID:153090 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IDA
GeneID:153090 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IMP
GeneID:153090 -> Biological process: GO:0000185 [activation of MAPKKK activity] evidence: IDA
GeneID:153090 -> Biological process: GO:0001525 [angiogenesis] evidence: IEA
GeneID:153090 -> Biological process: GO:0001933 [negative regulation of protein phosphorylation] evidence: IMP
GeneID:153090 -> Biological process: GO:0001933 [negative regulation of protein phosphorylation] evidence: ISS
GeneID:153090 -> Biological process: GO:0006927 [transformed cell apoptotic process] evidence: TAS
GeneID:153090 -> Biological process: GO:0006954 [inflammatory response] evidence: IEA
GeneID:153090 -> Biological process: GO:0006986 [response to unfolded protein] evidence: IEA
GeneID:153090 -> Biological process: GO:0007049 [cell cycle] evidence: IEA
GeneID:153090 -> Biological process: GO:0007252 [I-kappaB phosphorylation] evidence: ISS
GeneID:153090 -> Biological process: GO:0007257 [activation of JUN kinase activity] evidence: IDA
GeneID:153090 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: IDA
GeneID:153090 -> Biological process: GO:0008625 [extrinsic apoptotic signaling pathway via death domain receptors] evidence: IMP
GeneID:153090 -> Biological process: GO:0010596 [negative regulation of endothelial cell migration] evidence: IMP
GeneID:153090 -> Biological process: GO:0010633 [negative regulation of epithelial cell migration] evidence: IMP
GeneID:153090 -> Biological process: GO:0010633 [negative regulation of epithelial cell migration] evidence: TAS
GeneID:153090 -> Biological process: GO:0010719 [negative regulation of epithelial to mesenchymal transition] evidence: IDA
GeneID:153090 -> Biological process: GO:0010719 [negative regulation of epithelial to mesenchymal transition] evidence: IMP
GeneID:153090 -> Biological process: GO:0010976 [positive regulation of neuron projection development] evidence: ISS
GeneID:153090 -> Biological process: GO:0014067 [negative regulation of phosphatidylinositol 3-kinase cascade] evidence: IDA
GeneID:153090 -> Biological process: GO:0016525 [negative regulation of angiogenesis] evidence: IDA
GeneID:153090 -> Biological process: GO:0021814 [cell motility involved in cerebral cortex radial glia guided migration] evidence: ISS
GeneID:153090 -> Biological process: GO:0021819 [layer formation in cerebral cortex] evidence: ISS
GeneID:153090 -> Biological process: GO:0030948 [negative regulation of vascular endothelial growth factor receptor signaling pathway] evidence: IMP
GeneID:153090 -> Biological process: GO:0032088 [negative regulation of NF-kappaB transcription factor activity] evidence: IMP
GeneID:153090 -> Biological process: GO:0032312 [regulation of ARF GTPase activity] evidence: ISS
GeneID:153090 -> Biological process: GO:0032320 [positive regulation of Ras GTPase activity] evidence: IBA
GeneID:153090 -> Biological process: GO:0034144 [negative regulation of toll-like receptor 4 signaling pathway] evidence: IDA
GeneID:153090 -> Biological process: GO:0034260 [negative regulation of GTPase activity] evidence: ISS
GeneID:153090 -> Biological process: GO:0034261 [negative regulation of Ras GTPase activity] evidence: IMP
GeneID:153090 -> Biological process: GO:0035148 [tube formation] evidence: IMP
GeneID:153090 -> Biological process: GO:0035414 [negative regulation of catenin import into nucleus] evidence: ISS
GeneID:153090 -> Biological process: GO:0035924 [cellular response to vascular endothelial growth factor stimulus] evidence: IDA
GeneID:153090 -> Biological process: GO:0035924 [cellular response to vascular endothelial growth factor stimulus] evidence: ISS
GeneID:153090 -> Biological process: GO:0036324 [vascular endothelial growth factor receptor-2 signaling pathway] evidence: ISS
GeneID:153090 -> Biological process: GO:0040008 [regulation of growth] evidence: IEA
GeneID:153090 -> Biological process: GO:0042059 [negative regulation of epidermal growth factor receptor signaling pathway] evidence: ISS
GeneID:153090 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: IDA
GeneID:153090 -> Biological process: GO:0043122 [regulation of I-kappaB kinase/NF-kappaB cascade] evidence: ISS
GeneID:153090 -> Biological process: GO:0043124 [negative regulation of I-kappaB kinase/NF-kappaB cascade] evidence: IDA
GeneID:153090 -> Biological process: GO:0043254 [regulation of protein complex assembly] evidence: IDA
GeneID:153090 -> Biological process: GO:0043407 [negative regulation of MAP kinase activity] evidence: IDA
GeneID:153090 -> Biological process: GO:0043407 [negative regulation of MAP kinase activity] evidence: IMP
GeneID:153090 -> Biological process: GO:0043410 [positive regulation of MAPK cascade] evidence: IDA
GeneID:153090 -> Biological process: GO:0043507 [positive regulation of JUN kinase activity] evidence: IDA
GeneID:153090 -> Biological process: GO:0043553 [negative regulation of phosphatidylinositol 3-kinase activity] evidence: IDA
GeneID:153090 -> Biological process: GO:0044257 [cellular protein catabolic process] evidence: IDA
GeneID:153090 -> Biological process: GO:0045087 [innate immune response] evidence: IEA
GeneID:153090 -> Biological process: GO:0045732 [positive regulation of protein catabolic process] evidence: ISS
GeneID:153090 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IMP
GeneID:153090 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IDA
GeneID:153090 -> Biological process: GO:0046330 [positive regulation of JNK cascade] evidence: IDA
GeneID:153090 -> Biological process: GO:0046580 [negative regulation of Ras protein signal transduction] evidence: IBA
GeneID:153090 -> Biological process: GO:0046580 [negative regulation of Ras protein signal transduction] evidence: IC
GeneID:153090 -> Biological process: GO:0048147 [negative regulation of fibroblast proliferation] evidence: ISS
GeneID:153090 -> Biological process: GO:0048812 [neuron projection morphogenesis] evidence: ISS
GeneID:153090 -> Biological process: GO:0050680 [negative regulation of epithelial cell proliferation] evidence: IMP
GeneID:153090 -> Biological process: GO:0070059 [intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress] evidence: ISS
GeneID:153090 -> Biological process: GO:0070317 [negative regulation of G0 to G1 transition] evidence: IDA
GeneID:153090 -> Biological process: GO:0070373 [negative regulation of ERK1 and ERK2 cascade] evidence: IDA
GeneID:153090 -> Biological process: GO:0071158 [positive regulation of cell cycle arrest] evidence: IDA
GeneID:153090 -> Biological process: GO:0071222 [cellular response to lipopolysaccharide] evidence: IDA
GeneID:153090 -> Biological process: GO:0071347 [cellular response to interleukin-1] evidence: IDA
GeneID:153090 -> Biological process: GO:0071356 [cellular response to tumor necrosis factor] evidence: IDA
GeneID:153090 -> Biological process: GO:0071364 [cellular response to epidermal growth factor stimulus] evidence: ISS
GeneID:153090 -> Biological process: GO:0071901 [negative regulation of protein serine/threonine kinase activity] evidence: IDA
GeneID:153090 -> Biological process: GO:0071901 [negative regulation of protein serine/threonine kinase activity] evidence: IMP
GeneID:153090 -> Biological process: GO:0071902 [positive regulation of protein serine/threonine kinase activity] evidence: IDA
GeneID:153090 -> Biological process: GO:0071902 [positive regulation of protein serine/threonine kinase activity] evidence: IMP
GeneID:153090 -> Biological process: GO:0072577 [endothelial cell apoptotic process] evidence: TAS
GeneID:153090 -> Biological process: GO:0090090 [negative regulation of canonical Wnt receptor signaling pathway] evidence: IMP
GeneID:153090 -> Biological process: GO:0090129 [positive regulation of synapse maturation] evidence: ISS
GeneID:153090 -> Biological process: GO:1900006 [positive regulation of dendrite development] evidence: ISS
GeneID:153090 -> Biological process: GO:1900744 [regulation of p38MAPK cascade] evidence: ISS
GeneID:153090 -> Biological process: GO:1900747 [negative regulation of vascular endothelial growth factor signaling pathway] evidence: ISS
GeneID:153090 -> Biological process: GO:1901800 [positive regulation of proteasomal protein catabolic process] evidence: IMP
GeneID:153090 -> Biological process: GO:2000599 [negative regulation of cyclin catabolic process] evidence: IDA
GeneID:153090 -> Biological process: GO:2001224 [positive regulation of neuron migration] evidence: ISS
GeneID:153090 -> Biological process: GO:2001235 [positive regulation of apoptotic signaling pathway] evidence: IDA
GeneID:153090 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:153090 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:153090 -> Cellular component: GO:0030139 [endocytic vesicle] evidence: IDA
GeneID:153090 -> Cellular component: GO:0030424 [axon] evidence: ISS
GeneID:153090 -> Cellular component: GO:0030425 [dendrite] evidence: IEA
GeneID:153090 -> Cellular component: GO:0031235 [intrinsic to internal side of plasma membrane] evidence: IBA
GeneID:153090 -> Cellular component: GO:0032809 [neuronal cell body membrane] evidence: ISS
GeneID:153090 -> Cellular component: GO:0043025 [neuronal cell body] evidence: ISS
GeneID:153090 -> Cellular component: GO:0044300 [cerebellar mossy fiber] evidence: ISS
GeneID:153090 -> Cellular component: GO:0044301 [climbing fiber] evidence: ISS
GeneID:153090 -> Cellular component: GO:1990032 [parallel fiber] evidence: ISS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.