Home |
Help |
Advanced search
2025-12-06 10:35:01, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_031361 5317 bp mRNA linear PRI 04-MAY-2013
DEFINITION Homo sapiens collagen, type IV, alpha 3 (Goodpasture antigen)
binding protein (COL4A3BP), transcript variant 2, mRNA.
ACCESSION NM_031361
VERSION NM_031361.2 GI:194294545
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 5317)
AUTHORS Sugiki,T., Takeuchi,K., Yamaji,T., Takano,T., Tokunaga,Y.,
Kumagai,K., Hanada,K., Takahashi,H. and Shimada,I.
TITLE Structural basis for the Golgi association by the pleckstrin
homology domain of the ceramide trafficking protein (CERT)
JOURNAL J. Biol. Chem. 287 (40), 33706-33718 (2012)
PUBMED 22869376
REMARK GeneRIF: Structural basis for the Golgi association by the
pleckstrin homology domain of the ceramide trafficking protein
(CERT)
REFERENCE 2 (bases 1 to 5317)
AUTHORS Olayioye,M.A. and Hausser,A.
TITLE Integration of non-vesicular and vesicular transport processes at
the Golgi complex by the PKD-CERT network
JOURNAL Biochim. Biophys. Acta 1821 (8), 1096-1103 (2012)
PUBMED 22226883
REMARK GeneRIF: CERT is at a convergence point of non-vesicular and
vesicular transport processes and plays a central role within the
PKD signaling network at the Golgi complex. (Review)
Review article
REFERENCE 3 (bases 1 to 5317)
AUTHORS Heering,J., Weis,N., Holeiter,M., Neugart,F., Staebler,A.,
Fehm,T.N., Bischoff,A., Schiller,J., Duss,S., Schmid,S., Korte,T.,
Herrmann,A. and Olayioye,M.A.
TITLE Loss of the ceramide transfer protein augments EGF receptor
signaling in breast cancer
JOURNAL Cancer Res. 72 (11), 2855-2866 (2012)
PUBMED 22472120
REMARK GeneRIF: Loss of the ceramide transfer protein augments EGF
receptor signaling in breast cancer.
REFERENCE 4 (bases 1 to 5317)
AUTHORS Mencarelli,C., Bode,G.H., Losen,M., Kulharia,M., Molenaar,P.C.,
Veerhuis,R., Steinbusch,H.W., De Baets,M.H., Nicolaes,G.A. and
Martinez-Martinez,P.
TITLE Goodpasture antigen-binding protein/ceramide transporter binds to
human serum amyloid P-component and is present in brain amyloid
plaques
JOURNAL J. Biol. Chem. 287 (18), 14897-14911 (2012)
PUBMED 22396542
REMARK GeneRIF: The START domain in GPBP is important for this
interaction. SAP and GPBP form complexes in blood and partly
colocalize in amyloid plaques from Alzheimer disease patients.
REFERENCE 5 (bases 1 to 5317)
AUTHORS Chandran,S. and Machamer,C.E.
TITLE Inactivation of ceramide transfer protein during pro-apoptotic
stress by Golgi disassembly and caspase cleavage
JOURNAL Biochem. J. 442 (2), 391-401 (2012)
PUBMED 22129459
REMARK GeneRIF: during cellular stress, disassembly of Golgi structure
together with inactivation of CERT by caspases causes a reduction
in ceramide trafficking and sphingomyelin synthesis, and could
contribute to the cellular response to pro-apoptotic stress
REFERENCE 6 (bases 1 to 5317)
AUTHORS Kumagai,K., Yasuda,S., Okemoto,K., Nishijima,M., Kobayashi,S. and
Hanada,K.
TITLE CERT mediates intermembrane transfer of various molecular species
of ceramides
JOURNAL J. Biol. Chem. 280 (8), 6488-6495 (2005)
PUBMED 15596449
REMARK GeneRIF: results indicate that CERT can mediate transfer of various
types of ceramides that naturally exist and their close relatives
REFERENCE 7 (bases 1 to 5317)
AUTHORS Hanada,K., Kumagai,K., Yasuda,S., Miura,Y., Kawano,M., Fukasawa,M.
and Nishijima,M.
TITLE Molecular machinery for non-vesicular trafficking of ceramide
JOURNAL Nature 426 (6968), 803-809 (2003)
PUBMED 14685229
REMARK GeneRIF: CERT mediates the intracellular trafficking of ceramide in
a non-vesicular manner
REFERENCE 8 (bases 1 to 5317)
AUTHORS Raya,A., Revert-Ros,F., Martinez-Martinez,P., Navarro,S.,
Rosello,E., Vieites,B., Granero,F., Forteza,J. and Saus,J.
TITLE Goodpasture antigen-binding protein, the kinase that phosphorylates
the goodpasture antigen, is an alternatively spliced variant
implicated in autoimmune pathogenesis
JOURNAL J. Biol. Chem. 275 (51), 40392-40399 (2000)
PUBMED 11007769
REFERENCE 9 (bases 1 to 5317)
AUTHORS Raya,A., Revert,F., Navarro,S. and Saus,J.
TITLE Characterization of a novel type of serine/threonine kinase that
specifically phosphorylates the human goodpasture antigen
JOURNAL J. Biol. Chem. 274 (18), 12642-12649 (1999)
PUBMED 10212244
REFERENCE 10 (bases 1 to 5317)
AUTHORS Kalluri,R.
TITLE Goodpasture syndrome
JOURNAL Kidney Int. 55 (3), 1120-1122 (1999)
PUBMED 10027952
REMARK Review article
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AK292087.1, AY453385.1,
AK000604.1 and AC008897.7.
On Jul 17, 2008 this sequence version replaced gi:14165451.
Summary: This gene encodes a kinase that specifically
phosphorylates the N-terminal region of the non-collagenous domain
of the alpha 3 chain of type IV collagen, known as the Goodpasture
antigen. Goodpasture disease is the result of an autoimmune
response directed at this antigen. One isoform of this protein is
also involved in ceramide intracellular transport. Three transcript
variants encoding different isoforms have been found for this gene.
[provided by RefSeq, Jul 2008].
Transcript Variant: This variant (2) differs in the 5' UTR and
coding region and lacks an alternate in-frame exon compared to
variant 3. The resulting isoform (2) is shorter at the N-terminus
and lacks an internal segment compared to isoform 3. The absence of
the in-frame exon results in the loss of a protein motif and less
phosphorylation activity. This isoform also mediates intracellular
transport of ceramide from the endoplasmic reticulum to the Golgi
apparatus.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data because no single transcript was available
for the full length of the gene. The extent of this transcript is
supported by transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK292087.1, BC000102.2 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-422 AK292087.1 1-422
423-2219 AY453385.1 1-1797
2220-3150 AK000604.1 1240-2170
3151-5317 AC008897.7 28425-30591
FEATURES Location/Qualifiers
source 1..5317
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="5"
/map="5q13.3"
gene 1..5317
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/note="collagen, type IV, alpha 3 (Goodpasture antigen)
binding protein"
/db_xref="GeneID:10087"
/db_xref="HGNC:2205"
/db_xref="MIM:604677"
exon 1..518
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/inference="alignment:Splign:1.39.8"
misc_feature 33..35
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/note="upstream in-frame stop codon"
variation 174
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/replace="a"
/replace="g"
/db_xref="dbSNP:11549098"
CDS 423..2219
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/EC_number="2.7.11.1"
/note="isoform 2 is encoded by transcript variant 2;
ceramide transporter; StAR-related lipid transfer (START)
domain containing 11; lipid-transfer protein CERTL; hCERT;
ceramide transfer protein"
/codon_start=1
/product="collagen type IV alpha-3-binding protein isoform
2"
/protein_id="NP_112729.1"
/db_xref="GI:14165452"
/db_xref="CCDS:CCDS4029.1"
/db_xref="GeneID:10087"
/db_xref="HGNC:2205"
/db_xref="MIM:604677"
/translation="
MSDNQSWNSSGSEEDPETESGPPVERCGVLSKWTNYIHGWQDRWVVLKNNALSYYKSEDETEYGCRGSICLSKAVITPHDFDECRFDISVNDSVWYLRAQDPDHRQQWIDAIEQHKTESGYGSESSLRRHGSMVSLVSGASGYSATSTSSFKKGHSLREKLAEMETFRDILCRQVDTLQKYFDACADAVSKDELQRDKVVEDDEDDFPTTRSDGDFLHSTNGNKEKLFPHVTPKGINGIDFKGEAITFKATTAGILATLSHCIELMVKREDSWQKRLDKETEKKRRTEEAYKNAMTELKKKSHFGGPDYEEGPNSLINEEEFFDAVEAALDRQDKIEEQSQSEKVRLHWPTSLPSGDAFSSVGTHRFVQKVEEMVQNHMTYSLQDVGGDANWQLVVEEGEMKVYRREVEENGIVLDPLKATHAVKGVTGHEVCNYFWNVDVRNDWETTIENFHVVETLADNAIIIYQTHKRVWPASQRDVLYLSVIRKIPALTENDPETWIVCNFSVDHDSAPLNNRCVRAKINVAMICQTLVSPPEGNQEISRDNILCKITYVANVNPGGWAPASVLRAVAKREYPKFLKRFTSYVQEKTAGKPILF
"
misc_feature 498..767
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/note="Goodpasture antigen binding protein (GPBP)
Pleckstrin homology (PH) domain; Region: PH_GPBP; cd01247"
/db_xref="CDD:176323"
misc_feature order(498..500,504..506,543..545,549..557)
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/note="putative phosphoinositide binding site [chemical
binding]; other site"
/db_xref="CDD:176323"
misc_feature 1365..1367
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1512..2216
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/note="Ceramide-binding START domain of mammalian STARD11
and related domains; Region: START_STARD11-like; cd08872"
/db_xref="CDD:176881"
misc_feature order(1728..1730,1746..1748,1755..1760,1764..1769,
1821..1823,1827..1832,1836..1841,1845..1847,1854..1856,
1860..1862,1866..1868,1932..1934,1983..1985,1989..1991,
1995..1997,2079..2081,2091..2093,2097..2099,2124..2126,
2133..2138,2142..2150,2157..2159)
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/note="ceramide binding site [chemical binding]; other
site"
/db_xref="CDD:176881"
exon 519..653
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/inference="alignment:Splign:1.39.8"
exon 654..770
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/inference="alignment:Splign:1.39.8"
exon 771..878
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/inference="alignment:Splign:1.39.8"
exon 879..1017
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/inference="alignment:Splign:1.39.8"
exon 1018..1101
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/inference="alignment:Splign:1.39.8"
exon 1102..1259
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/inference="alignment:Splign:1.39.8"
exon 1260..1352
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/inference="alignment:Splign:1.39.8"
exon 1353..1439
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/inference="alignment:Splign:1.39.8"
exon 1440..1532
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/inference="alignment:Splign:1.39.8"
exon 1533..1628
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/inference="alignment:Splign:1.39.8"
exon 1629..1761
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/inference="alignment:Splign:1.39.8"
exon 1762..1832
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/inference="alignment:Splign:1.39.8"
exon 1833..1961
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/inference="alignment:Splign:1.39.8"
exon 1962..2091
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/inference="alignment:Splign:1.39.8"
exon 2092..2228
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/inference="alignment:Splign:1.39.8"
exon 2229..5317
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/inference="alignment:Splign:1.39.8"
polyA_signal 5067..5072
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
polyA_site 5087
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
STS 5169..5273
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/standard_name="SHGC-36269"
/db_xref="UniSTS:82739"
polyA_signal 5233..5238
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
polyA_site 5256
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
polyA_signal 5267..5272
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
polyA_signal 5296..5301
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
polyA_site 5315
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
variation 5316
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
/replace="a"
/replace="t"
/db_xref="dbSNP:3180743"
polyA_site 5317
/gene="COL4A3BP"
/gene_synonym="CERT; CERTL; GPBP; STARD11"
ORIGIN
aaatagtgggccaggcaggaagatggcggcggtagcggaggtgtgagtggacgcgggactcagcggccggattttctcttcccttcttttcccttttccttccctatttgaaattggcatcgagggggctaagttcgggtggcagcgccgggcgcaacgcaggggtcacggcgacggcggcggcggctgacggctggaagggtaggcttccttcaccgctcgtcctccttcctcgctccgctcggtgtcaggcgcggcggcggcgcggcgggcggacttcgtccctcctcctgctcccccccacaccggagcgggcactcttcgcttcgccatcccccgacccttcaccccgaggactgggcgcctcctccggcgcagctgagggagcgggggccggtctcctgctcggttgtcgagcctccatgtcggataatcagagctggaactcgtcgggctcggaggaggatccagagacggagtctgggccgcctgtggagcgctgcggggtcctcagtaagtggacaaactacattcatgggtggcaggatcgttgggtagttttgaaaaataatgctctgagttactacaaatctgaagatgaaacagagtatggctgcagaggatccatctgtcttagcaaggctgtcatcacacctcacgattttgatgaatgtcgatttgatattagtgtaaatgatagtgtttggtatcttcgtgctcaggatccagatcatagacagcaatggatagatgccattgaacagcacaagactgaatctggatatggatctgaatccagcttgcgtcgacatggctcaatggtgtccctggtgtctggagcaagtggctactctgcaacatccacctcttcattcaagaaaggccacagtttacgtgagaagttggctgaaatggaaacatttagagacatcttatgtagacaagttgacacgctacagaagtactttgatgcctgtgctgatgctgtctctaaggatgaacttcaaagggataaagtggtagaagatgatgaagatgactttcctacaacgcgttctgatggtgacttcttgcatagtaccaacggcaataaagaaaagttatttccacatgtgacaccaaaaggaattaatggtatagactttaaaggggaagcgataacttttaaagcaactactgctggaatccttgcaacactttctcattgtattgaactaatggttaaacgtgaggacagctggcagaagagactggataaggaaactgagaagaaaagaagaacagaggaagcatataaaaatgcaatgacagaacttaagaaaaaatcccactttggaggaccagattatgaagaaggccctaacagtctgattaatgaagaagagttctttgatgctgttgaagctgctcttgacagacaagataaaatagaagaacagtcacagagtgaaaaggtgagattacattggcctacatccttgccctctggagatgccttttcttctgtggggacacatagatttgtccaaaaggttgaagagatggtgcagaaccacatgacttactcattacaggatgtaggcggagatgccaattggcagttggttgtagaagaaggagaaatgaaggtatacagaagagaagtagaagaaaatgggattgttctggatcctttaaaagctacccatgcagttaaaggcgtcacaggacatgaagtctgcaattatttctggaatgttgacgttcgcaatgactgggaaacaactatagaaaactttcatgtggtggaaacattagctgataatgcaatcatcatttatcaaacacacaagagggtgtggcctgcttctcagcgagacgtattatatctttctgtcattcgaaagataccagccttgactgaaaatgaccctgaaacttggatagtttgtaatttttctgtggatcatgacagtgctcctctaaacaaccgatgtgtccgtgccaaaataaatgttgctatgatttgtcaaaccttggtaagcccaccagagggaaaccaggaaattagcagggacaacattctatgcaagattacatatgtagctaatgtgaaccctggaggatgggcaccagcctcagtgttaagggcagtggcaaagcgagagtatcctaaatttctaaaacgttttacttcttacgtccaagaaaaaactgcaggaaagcctattttgttctagtattaacagtgactgaagcaaggctgtgtgacattccatgttggagaaaaaaagaaaaaaaaaagctgaatgctctaagctggaacgtaggatctatagccttgtctgtggcccaagaccttggccttgtgtacaaaaatgacaaaatattgcaatagcaaagctgaacatctaacactagctatctcttgctagatctccttgctcagcatataactataaatacatgtaaaattacatgtatatggctatatttttatttgcttgctcctagaagagaaaaaaaaatcaactttgaatcacaactaggaattgatgctttaatttttggatactttttcagaatttttaatttactatggtccggcctaagatcctctgttgtatcaggttttgtgcacaaaagaaaagcacaaaagttgaatgcacatggggcatgtgctttctgtgcaccaaatatctggatgaggttcttttttcaggcctacagtcaaatctgtgtccagaattttttgacttttttgctttgtataatcatagaattcattgctgctgatttctataatgattcatgttgtcatgtgtctcttaataactgagggctgtcagtaacctgtgattttgccttttctatagtcttactcccatgaagaaccttggttctgatggagaaagtgaaaagctttatttcttcccctagatatctttatatttctattatattttttagttgtgtactgtgtactagagatttttttcagtttgttatgaacacaatttggtaagccctaaattggttctgcctgtctccaaacagaaacatctgtacaaatcttgttggtatagactactttctggaaaatggtcaagataagttcatgttttcttgaaatttctaagatagtatatggtatcacttgtttaaagcaaatcagactgagtttgacatttaattcaatatttctggtattcagtaacgggtatatatgtttgttcttccagtttgggtcagtttaaaagatatgttgcaaagtatacatagaaaatgtgagcaatgcctctctttgccttttgatcagaaacttcagcagagcggtaaggattccacatgatttaaactgaaatgcttttctttgttgctgtaagaacttaaaatgtaaaatacctttttcagtttaagtcctgtaaacaacattgaagcatggagatgaggcaaggaatagtactcactgaagttgaaatgactgcccacttcaaaatcttcattgtgtttacacaccagtgtatttatacaaatcagaggcattttgtagatgctttgctgacttgttcagctctgtaaaaacacagaaatcagacccattttgtaaagcggaaaatcatgttacatggaacatgtcctgtatatatcacatacatggtaatggagtcttaatgataagtgcaagataataatttaatgatgggattagtctgatcgcttaatatgcacaatcctggaagtgaattacttgcatcagatatagtgatatttattattctgtacagagagaaaaatacatataaaacatatgcttacattacatgcacgcggatttcatgctccataatcttttctattttttaatttacctttctgtaaatgatgtgcatggaatatgccttatagaaaaatgctgttcataatttgactacgtggaaaagtgcctatatggtggtaatgctagtaaggcaaataagacaaattatcatgttggtttactacatcaccagttaacattttatattgtgatgtttaaaaaagaaaaatttatacctcaaatgtgtattttattttacaatcagctgtggggtatggggttgggatgggagaatgggggggttggggagggcaggtttattcaccatagccgctgataagaatcttcaaaaaaattctatatgcgcactataaatgtttctctgtttgccatttctggtaactatcatgaacacagacagttaactctttcataactgaattggatagctttattttacagaagtatggcaagtttacaaagcaatatctaaatctaattatcattagttgcatttggactaaatgtgatgatatacttttgcaattgattctgtaaataaaaggattacactaaaatatttgtattaaaagaagaaaagataacattttacctttagataactgcacttgtacctcactagagttaatcccacccaatcagattgagaaataaattggggaatgtggaaagagtccaaaagaggtcagaatttggagaggtactggccttctggacaacatttagaccctctacaattattttcattaagctgattcctacatcctgaatattcatgttttctcatctacagatatttgtcttcccccaaactaaaagaaaaaaaactaccctttactctcttttctactcagttactcttttgtgctatgttagaaacttgaaatatattggtgatgtggggattttgtccctgactgcccactgtacaggacaagagagtacagtgtttcagttggaattcaggactcctggttttgaggtagaggatgatcactgcagtacttggtttggaattgccacaggggtagctaaaccaaaggagggttatatctgcaagggaggtgtaagaaggcaaaataaggaaaaggaggaatgggttttctatttgttcagtttcatcaactaatttatacacttaatacaacttcagtgtcaattgctattaagaaatttttagttgggctgagctggttctcttgtgaaattgtgctggttatctttaagcttatcagttatttgtccaattaaacacttttcaccagtatttagtccgagttgtacagacgatgtatttggattttgtcatggttcatctacagactcaaaacataatcattttaaagtaccttgggagtgtgtagagtaacttctataatagctttatgatcctgatgatgttttttaaacacaataaagttggatcttccatgttacaatcacagaattaaaaccagtatttaaagtggaaaagtattaaaatattatggacaaata
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:10087 -> Molecular function: GO:0004672 [protein kinase activity] evidence: TAS
GeneID:10087 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:10087 -> Molecular function: GO:0035620 [ceramide transporter activity] evidence: IDA
GeneID:10087 -> Molecular function: GO:0070273 [phosphatidylinositol-4-phosphate binding] evidence: IDA
GeneID:10087 -> Molecular function: GO:0097001 [ceramide binding] evidence: IDA
GeneID:10087 -> Biological process: GO:0000902 [cell morphogenesis] evidence: IEA
GeneID:10087 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA
GeneID:10087 -> Biological process: GO:0003007 [heart morphogenesis] evidence: IEA
GeneID:10087 -> Biological process: GO:0006468 [protein phosphorylation] evidence: TAS
GeneID:10087 -> Biological process: GO:0006665 [sphingolipid metabolic process] evidence: TAS
GeneID:10087 -> Biological process: GO:0006672 [ceramide metabolic process] evidence: IEA
GeneID:10087 -> Biological process: GO:0006936 [muscle contraction] evidence: IEA
GeneID:10087 -> Biological process: GO:0006955 [immune response] evidence: NAS
GeneID:10087 -> Biological process: GO:0007029 [endoplasmic reticulum organization] evidence: IEA
GeneID:10087 -> Biological process: GO:0007165 [signal transduction] evidence: IEA
GeneID:10087 -> Biological process: GO:0008283 [cell proliferation] evidence: IEA
GeneID:10087 -> Biological process: GO:0030148 [sphingolipid biosynthetic process] evidence: TAS
GeneID:10087 -> Biological process: GO:0034976 [response to endoplasmic reticulum stress] evidence: IEA
GeneID:10087 -> Biological process: GO:0035621 [ER to Golgi ceramide transport] evidence: IGI
GeneID:10087 -> Biological process: GO:0035621 [ER to Golgi ceramide transport] evidence: IMP
GeneID:10087 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
GeneID:10087 -> Biological process: GO:0055088 [lipid homeostasis] evidence: IEA
GeneID:10087 -> Biological process: GO:0070584 [mitochondrion morphogenesis] evidence: IEA
GeneID:10087 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:10087 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
GeneID:10087 -> Cellular component: GO:0005739 [mitochondrion] evidence: IEA
GeneID:10087 -> Cellular component: GO:0005789 [endoplasmic reticulum membrane] evidence: TAS
GeneID:10087 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IDA
GeneID:10087 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:10087 -> Cellular component: GO:0048471 [perinuclear region of cytoplasm] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_112729 -> EC 2.7.11.1
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.