GGRNA Home | Help | Advanced search

2025-10-21 21:20:56, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_030810               3231 bp    mRNA    linear   PRI 07-JUL-2013
DEFINITION  Homo sapiens thioredoxin domain containing 5 (endoplasmic
            reticulum) (TXNDC5), transcript variant 1, mRNA.
ACCESSION   NM_030810
VERSION     NM_030810.3  GI:313482856
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3231)
  AUTHORS   Funkner,A., Parthier,C., Schutkowski,M., Zerweck,J., Lilie,H.,
            Gyrych,N., Fischer,G., Stubbs,M.T. and Ferrari,D.M.
  TITLE     Peptide binding by catalytic domains of the protein disulfide
            isomerase-related protein ERp46
  JOURNAL   J. Mol. Biol. 425 (8), 1340-1362 (2013)
   PUBMED   23376096
  REMARK    GeneRIF: Authors show that ERp46 is able to bind to a large pool of
            peptides containing aromatic and basic residues via all three of
            its catalytic domains (a(0), a and a'), though the a(0) domain may
            contain the primary binding site.
REFERENCE   2  (bases 1 to 3231)
  AUTHORS   Wang,L., Zheng,Y., Xu,H., Yan,X. and Chang,X.
  TITLE     Investigate pathogenic mechanism of TXNDC5 in rheumatoid arthritis
  JOURNAL   PLoS ONE 8 (1), E53301 (2013)
   PUBMED   23326410
  REMARK    GeneRIF: Hypoxia induced TXCNDC5 expression, which contributed to
            adiponectin expression, cytokine production and the cellular
            proliferation and migration of fibroblasts in rheumatoid arthritis.
REFERENCE   3  (bases 1 to 3231)
  AUTHORS   Gulerez,I.E., Kozlov,G., Rosenauer,A. and Gehring,K.
  TITLE     Structure of the third catalytic domain of the protein disulfide
            isomerase ERp46
  JOURNAL   Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 68 (PT 4),
            378-381 (2012)
   PUBMED   22505402
  REMARK    GeneRIF: crystal structure of the third catalytic domain of protein
            disulfide isomerase ERp46 (also known as protein disulfide
            isomerase A5 and TXNDC5) was determined to 2.0 A resolution
REFERENCE   4  (bases 1 to 3231)
  AUTHORS   Vincent,E.E., Elder,D.J., Phillips,L., Heesom,K.J., Pawade,J.,
            Luckett,M., Sohail,M., May,M.T., Hetzel,M.R. and Tavare,J.M.
  TITLE     Overexpression of the TXNDC5 protein in non-small cell lung
            carcinoma
  JOURNAL   Anticancer Res. 31 (5), 1577-1582 (2011)
   PUBMED   21617212
  REMARK    GeneRIF: Overexpression of the TXNDC5 protein is associated with
            non-small cell lung carcinoma.
REFERENCE   5  (bases 1 to 3231)
  AUTHORS   Chang,X., Zhao,Y., Yan,X., Pan,J., Fang,K. and Wang,L.
  TITLE     Investigating a pathogenic role for TXNDC5 in rheumatoid arthritis
  JOURNAL   Arthritis Res. Ther. 13 (4), R124 (2011)
   PUBMED   21801346
  REMARK    GeneRIF: TXNDC5 has a genetic effect on the risk of rheumatoid
            arthritis and ankylosing spondylitis
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 3231)
  AUTHORS   So,H.C., Fong,P.Y., Chen,R.Y., Hui,T.C., Ng,M.Y., Cherny,S.S.,
            Mak,W.W., Cheung,E.F., Chan,R.C., Chen,E.Y., Li,T. and Sham,P.C.
  TITLE     Identification of neuroglycan C and interacting partners as
            potential susceptibility genes for schizophrenia in a Southern
            Chinese population
  JOURNAL   Am. J. Med. Genet. B Neuropsychiatr. Genet. 153B (1), 103-113
            (2010)
   PUBMED   19367581
  REMARK    GeneRIF: Observational study of gene-disease association and
            gene-gene interaction. (HuGE Navigator)
REFERENCE   7  (bases 1 to 3231)
  AUTHORS   Wang,Y., Ma,Y., Lu,B., Xu,E., Huang,Q. and Lai,M.
  TITLE     Differential expression of mimecan and thioredoxin
            domain-containing protein 5 in colorectal adenoma and cancer: a
            proteomic study
  JOURNAL   Exp. Biol. Med. (Maywood) 232 (9), 1152-1159 (2007)
   PUBMED   17895523
  REMARK    GeneRIF: upregulation of TXNDC5 are involved in the early
            development of colorectal cancer
REFERENCE   8  (bases 1 to 3231)
  AUTHORS   Nissom,P.M., Lo,S.L., Lo,J.C., Ong,P.F., Lim,J.W., Ou,K.,
            Liang,R.C., Seow,T.K. and Chung,M.C.
  TITLE     Hcc-2, a novel mammalian ER thioredoxin that is differentially
            expressed in hepatocellular carcinoma
  JOURNAL   FEBS Lett. 580 (9), 2216-2226 (2006)
   PUBMED   16574106
REFERENCE   9  (bases 1 to 3231)
  AUTHORS   Sullivan,D.C., Huminiecki,L., Moore,J.W., Boyle,J.J., Poulsom,R.,
            Creamer,D., Barker,J. and Bicknell,R.
  TITLE     EndoPDI, a novel protein-disulfide isomerase-like protein that is
            preferentially expressed in endothelial cells acts as a stress
            survival factor
  JOURNAL   J. Biol. Chem. 278 (47), 47079-47088 (2003)
   PUBMED   12963716
  REMARK    GeneRIF: Member of the protein disulphide isomerase family and
            highly expressed in endothelial cells.  Protects endothelial cells
            from apoptosis under hypoxia.
REFERENCE   10 (bases 1 to 3231)
  AUTHORS   Knoblach,B., Keller,B.O., Groenendyk,J., Aldred,S., Zheng,J.,
            Lemire,B.D., Li,L. and Michalak,M.
  TITLE     ERp19 and ERp46, new members of the thioredoxin family of
            endoplasmic reticulum proteins
  JOURNAL   Mol. Cell Proteomics 2 (10), 1104-1119 (2003)
   PUBMED   12930873
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BF726049.1, AY358646.1 and
            AY326464.1.
            On Dec 3, 2010 this sequence version replaced gi:42794770.
            
            Summary: This gene encodes a protein-disulfide isomerase. Its
            expression is induced by hypoxia and its role may be to protect
            hypoxic cells from apoptosis. Alternative splicing results in
            multiple transcript variants. Read-through transcription also
            exists between this gene and the neighboring upstream MUTED (muted
            homolog) gene. [provided by RefSeq, Dec 2010].
            
            Transcript Variant: This variant (1) represents the longer
            transcript and encodes the longer isoform (1).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY326464.1, AY358646.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025098 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-6                 BF726049.1         1-6
            7-2962              AY358646.1         1-2956
            2963-3231           AY326464.1         2971-3239
FEATURES             Location/Qualifiers
     source          1..3231
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="6"
                     /map="6p24.3"
     gene            1..3231
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /note="thioredoxin domain containing 5 (endoplasmic
                     reticulum)"
                     /db_xref="GeneID:81567"
                     /db_xref="HGNC:21073"
                     /db_xref="HPRD:18249"
     exon            1..301
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /inference="alignment:Splign:1.39.8"
     CDS             39..1337
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /note="isoform 1 precursor is encoded by transcript
                     variant 1; thioredoxin related protein; protein disulfide
                     isomerase family A, member 15; endothelial protein
                     disulphide isomerase; thioredoxin-like protein p46;
                     endoplasmic reticulum protein ERp46; ER protein 46;
                     endoplasmic reticulum resident protein 46"
                     /codon_start=1
                     /product="thioredoxin domain-containing protein 5 isoform
                     1 precursor"
                     /protein_id="NP_110437.2"
                     /db_xref="GI:42794771"
                     /db_xref="CCDS:CCDS4505.1"
                     /db_xref="GeneID:81567"
                     /db_xref="HGNC:21073"
                     /db_xref="HPRD:18249"
                     /translation="
MPARPGRLLPLLARPAALTALLLLLLGHGGGGRWGARAQEAAAAAADGPPAADGEDGQDPHSKHLYTADMFTHGIQSAAHFVMFFAPWCGHCQRLQPTWNDLGDKYNSMEDAKVYVAKVDCTAHSDVCSAQGVRGYPTLKLFKPGQEAVKYQGPRDFQTLENWMLQTLNEEPVTPEPEVEPPSAPELKQGLYELSASNFELHVAQGDHFIKFFAPWCGHCKALAPTWEQLALGLEHSETVKIGKVDCTQHYELCSGNQVRGYPTLLWFRDGKKVDQYKGKRDLESLREYVESQLQRTETGATETVTPSEAPVLAAEPEADKGTVLALTENNFDDTIAEGITFIKFYAPWCGHCKTLAPTWEELSKKEFPGLAGVKIAEVDCTAERNICSKYSVRGYPTLLLFRGGKKVSEHSGGRDLDSLHRFVLSQAKDEL
"
     sig_peptide     39..134
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     mat_peptide     135..1334
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /product="thioredoxin domain-containing protein 5 isoform
                     1"
     misc_feature    219..530
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /note="PDIa family, endoplasmic reticulum protein 46
                     (ERp46) subfamily; ERp46 is an ER-resident protein
                     containing three redox active TRX domains. Yeast
                     complementation studies show that ERp46 can substitute for
                     protein disulfide isomerase (PDI) function in...; Region:
                     PDI_a_ERp46; cd03005"
                     /db_xref="CDD:48554"
     misc_feature    order(303..305,312..314,501..503)
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /note="catalytic residues [active]"
                     /db_xref="CDD:48554"
     misc_feature    606..908
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /note="PDIa family, endoplasmic reticulum protein 46
                     (ERp46) subfamily; ERp46 is an ER-resident protein
                     containing three redox active TRX domains. Yeast
                     complementation studies show that ERp46 can substitute for
                     protein disulfide isomerase (PDI) function in...; Region:
                     PDI_a_ERp46; cd03005"
                     /db_xref="CDD:48554"
     misc_feature    order(687..689,696..698,879..881)
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /note="catalytic residues [active]"
                     /db_xref="CDD:48554"
     misc_feature    1005..1310
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /note="PDIa family, endoplasmic reticulum protein 46
                     (ERp46) subfamily; ERp46 is an ER-resident protein
                     containing three redox active TRX domains. Yeast
                     complementation studies show that ERp46 can substitute for
                     protein disulfide isomerase (PDI) function in...; Region:
                     PDI_a_ERp46; cd03005"
                     /db_xref="CDD:48554"
     misc_feature    order(1086..1088,1095..1097,1281..1283)
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /note="catalytic residues [active]"
                     /db_xref="CDD:48554"
     misc_feature    1323..1334
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8NBS9.2);
                     Region: Prevents secretion from ER (Potential)"
     variation       66
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11541845"
     exon            302..451
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /inference="alignment:Splign:1.39.8"
     exon            452..557
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /inference="alignment:Splign:1.39.8"
     exon            558..654
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /inference="alignment:Splign:1.39.8"
     exon            655..770
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /inference="alignment:Splign:1.39.8"
     exon            771..857
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /inference="alignment:Splign:1.39.8"
     exon            858..1001
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /inference="alignment:Splign:1.39.8"
     exon            1002..1084
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /inference="alignment:Splign:1.39.8"
     exon            1085..1214
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /inference="alignment:Splign:1.39.8"
     exon            1215..3231
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /inference="alignment:Splign:1.39.8"
     variation       1588
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11541846"
     variation       1641
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:8643"
     variation       2216
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1062680"
     STS             2653..2875
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /standard_name="NIB594"
                     /db_xref="UniSTS:19406"
     STS             2686..2802
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /standard_name="A002L04"
                     /db_xref="UniSTS:3730"
     variation       2783
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043784"
     STS             2812..2915
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /standard_name="WI-13193"
                     /db_xref="UniSTS:6694"
     variation       2850..2851
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:3031019"
     variation       2853..2861
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /replace=""
                     /replace="tacacacaa"
                     /db_xref="dbSNP:3031020"
     polyA_signal    2943..2948
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
     variation       2951
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200877924"
     polyA_site      2964
                     /gene="TXNDC5"
                     /gene_synonym="ENDOPDI; ERP46; HCC-2; PDIA15; STRF8;
                     UNQ364"
                     /note="This is an internal polyA site. The 3'-most polyA
                     site has not yet been determined."
ORIGIN      
ccggaggccgcggcgagagcgcgcccagccccgccgcgatgcccgcgcgcccaggacgcctcctcccgctgctggcccggccggcggccctgactgcgctgctgctgctgctgctgggccatggcggcggcgggcgctggggcgcccgggcccaggaggcggcggcggcggcggcggacgggccccccgcggcagacggcgaggacggacaggacccgcacagcaagcacctgtacacggccgacatgttcacgcacgggatccagagcgccgcgcacttcgtcatgttcttcgcgccctggtgtggacactgccagcggctgcagccgacttggaatgacctgggagacaaatacaacagcatggaagatgccaaagtctatgtggctaaagtggactgcacggcccactccgacgtgtgctccgcccagggggtgcgaggataccccaccttaaagcttttcaagccaggccaagaagctgtgaagtaccagggtcctcgggacttccagacactggaaaactggatgctgcagacactgaacgaggagccagtgacaccagagccggaagtggaaccgcccagtgcccccgagctcaagcaagggctgtatgagctctcagcaagcaactttgagctgcacgttgcacaaggcgaccactttatcaagttcttcgctccgtggtgtggtcactgcaaagccctggctccaacctgggagcagctggctctgggccttgaacattccgaaactgtcaagattggcaaggttgattgtacacagcactatgaactctgctccggaaaccaggttcgtggctatcccactcttctctggttccgagatgggaaaaaggtggatcagtacaagggaaagcgggatttggagtcactgagggagtacgtggagtcgcagctgcagcgcacagagactggagcgacggagaccgtcacgccctcagaggccccggtgctggcagctgagcccgaggctgacaagggcactgtgttggcactcactgaaaataacttcgatgacaccattgcagaaggaataaccttcatcaagttttatgctccatggtgtggtcattgtaagactctggctcctacttgggaggaactctctaaaaaggaattccctggtctggcgggggtcaagatcgccgaagtagactgcactgctgaacggaatatctgcagcaagtattcggtacgaggctaccccacgttattgcttttccgaggagggaagaaagtcagtgagcacagtggaggcagagaccttgactcgttacaccgctttgtcctgagccaagcgaaagacgaactttaggaacacagttggaggtcacctctcctgcccagctcccgcaccctgcgtttaggagttcagtcccacagaggccactgggttcccagtggtggctgttcagaaagcagaacatactaagcgtgaggtatcttctttgtgtgtgtgttttccaagccaacacactctacagattctttattaagttaagtttctctaagtaaatgtgtaactcatggtcactgtgtaaacattttcagtggcgatatatcccctttgaccttctcttgatgaaatttacatggtttcctttgagactaaaatagcgttgagggaaatgaaattgctggactatttgtggctcctgagttgagtgattttggtgaaagaaagcacatccaaagcatagtttacctgcccacgagttctggaaaggtggccttgtggcagtattgacgttcctctgatcttaaggtcacagttgactcaatactgtgttggtccgtagcatggagcagattgaaatgcaaaaacccacacctctggaagataccttcacggccgctgctggagcttctgttgctgtgaatacttctctcagtgtgagaggttagccgtgatgaaagcagcgttacttctgaccgtgcctgagtaagagaatgctgatgccataactttatgtgtcgatacttgtcaaatcagttactgttcaggggatccttctgtttctcacggggtgaaacatgtctttagttcctcatgttaacacgaagccagagcccacatgaactgttggatgtcttccttagaaagggtaggcatggaaaattccacgaggctcattctcagtatctcattaactcattgaaagattccagttgtatttgtcacctggggtgacaagaccagacaggctttcccaggcctgggtatccagggaggctctgcagccctgctgaagggccctaactagagttctagagtttctgattctgtttctcagtagtccttttagaggcttgctatacttggtctgcttcaaggaggtcgaccttctaatgtatgaagaatgggatgcatttgatctcaagaccaaagacagatgtcagtgggctgctctggccctggtgtgcacggctgtggcagctgttgatgccagtgtcctctaactcatgctgtccttgtgattaaacacctctatctcccttgggaataagcacatacaggcttaagctctaagatagataggtgtttgtccttttaccatcgagctacttcccataataaccactttgcatccaacactcttcacccacctcccatacgcaaggggatgtggatacttggcccaaagtaactggtggtaggaatcttagaaacaagaccacttatactgtctgtctgaggcagaagataacagcagcatctcgaccagcctctgccttaaaggaaatctttattaatcacgtatggttcacagataattctttttttaaaaaaacccaacctcctagagaagcacaactgtcaagagtcttgtacacacaacttcagctttgcatcacgagtcttgtattccaagaaaatcaaagtggtacaatttgtttgtttacactatgatactttctaaataaactctttttttttaaaagtctggtctttccttcaatgttacagcaaaacagatataaaatagacaataaattatagtttatatttacaaaaaaagctgtaagtgcaaacagttgtagattataaatgtattatttaatcagtttagtatgaaattgccttcccagtacatgattgtgaaaaagacatttagaaaatattctaaaatttaatctgagcctcactttctacaagggaaatcatgatttccgttcataaacagcatgctcatccccctaacaccatt
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:81567 -> Molecular function: GO:0009055 [electron carrier activity] evidence: IEA
            GeneID:81567 -> Molecular function: GO:0015035 [protein disulfide oxidoreductase activity] evidence: IEA
            GeneID:81567 -> Molecular function: GO:0016853 [isomerase activity] evidence: IEA
            GeneID:81567 -> Biological process: GO:0006662 [glycerol ether metabolic process] evidence: IEA
            GeneID:81567 -> Biological process: GO:0006892 [post-Golgi vesicle-mediated transport] evidence: TAS
            GeneID:81567 -> Biological process: GO:0016044 [cellular membrane organization] evidence: TAS
            GeneID:81567 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: TAS
            GeneID:81567 -> Biological process: GO:0045454 [cell redox homeostasis] evidence: IEA
            GeneID:81567 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: TAS
            GeneID:81567 -> Cellular component: GO:0005788 [endoplasmic reticulum lumen] evidence: IEA
            GeneID:81567 -> Cellular component: GO:0043202 [lysosomal lumen] evidence: TAS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.