2025-09-19 06:00:56, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_021872 3578 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens cell division cycle 25B (CDC25B), transcript variant 3, mRNA. ACCESSION NM_021872 VERSION NM_021872.2 GI:47078251 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3578) AUTHORS Hsieh,W.L., Lin,Y.K., Tsai,C.N., Wang,T.M., Chen,T.Y. and Pang,J.H. TITLE Indirubin, an acting component of indigo naturalis, inhibits EGFR activation and EGF-induced CDC25B gene expression in epidermal keratinocytes JOURNAL J. Dermatol. Sci. 67 (2), 140-146 (2012) PUBMED 22721997 REMARK GeneRIF: Indirubin, an acting component of indigo naturalis, inhibits EGFR activation and EGF-induced CDC25B gene expression in epidermal ke REFERENCE 2 (bases 1 to 3578) AUTHORS Yu,X.Y., Zhang,Z., Zhang,G.J., Guo,K.F. and Kong,C.Z. TITLE Knockdown of Cdc25B in renal cell carcinoma is associated with decreased malignant features JOURNAL Asian Pac. J. Cancer Prev. 13 (3), 931-935 (2012) PUBMED 22631674 REMARK GeneRIF: downregulation of Cdc25B resulted in slower growth, more G2/M cells, weaker capacity for migration and invasion and induction of apoptosis in renal carcinoma cell line 769-P transfectants; findings suggest an important role of Cdc25B in renal cell carcinoma development REFERENCE 3 (bases 1 to 3578) AUTHORS Liffers,S.T., Munding,J.B., Vogt,M., Kuhlmann,J.D., Verdoodt,B., Nambiar,S., Maghnouj,A., Mirmohammadsadegh,A., Hahn,S.A. and Tannapfel,A. TITLE MicroRNA-148a is down-regulated in human pancreatic ductal adenocarcinomas and regulates cell survival by targeting CDC25B JOURNAL Lab. Invest. 91 (10), 1472-1479 (2011) PUBMED 21709669 REMARK GeneRIF: We identified CDC25B as novel miR-148a target which may confer a proliferative advantage in pancreatic ductal adenocarcinomas. REFERENCE 4 (bases 1 to 3578) AUTHORS Lobjois,V., Froment,C., Braud,E., Grimal,F., Burlet-Schiltz,O., Ducommun,B. and Bouche,J.P. TITLE Study of the docking-dependent PLK1 phosphorylation of the CDC25B phosphatase JOURNAL Biochem. Biophys. Res. Commun. 410 (1), 87-90 (2011) PUBMED 21640712 REMARK GeneRIF: there are 13 sites phosphorylated by PLK1 in CDC25B.This study illustrates the complexity of the phosphorylation pattern and of the subsequent regulation of CDC25B activity. REFERENCE 5 (bases 1 to 3578) AUTHORS Nakamura,S., Nagata,Y., Tan,L., Takemura,T., Shibata,K., Fujie,M., Fujisawa,S., Tanaka,Y., Toda,M., Makita,R., Tsunekawa,K., Yamada,M., Yamaoka,M., Yamashita,J., Ohnishi,K. and Yamashita,M. TITLE Transcriptional repression of Cdc25B by IER5 inhibits the proliferation of leukemic progenitor cells through NF-YB and p300 in acute myeloid leukemia JOURNAL PLoS ONE 6 (11), E28011 (2011) PUBMED 22132193 REMARK GeneRIF: Transcriptional repression mediated by IER5 regulates Cdc25B expression levels via the release of NF-YB and p300 in acute myeloid leukemia. REFERENCE 6 (bases 1 to 3578) AUTHORS Baldin,V., Cans,C., Superti-Furga,G. and Ducommun,B. TITLE Alternative splicing of the human CDC25B tyrosine phosphatase. Possible implications for growth control? JOURNAL Oncogene 14 (20), 2485-2495 (1997) PUBMED 9188863 REFERENCE 7 (bases 1 to 3578) AUTHORS Conklin,D.S., Galaktionov,K. and Beach,D. TITLE 14-3-3 proteins associate with cdc25 phosphatases JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (17), 7892-7896 (1995) PUBMED 7644510 REFERENCE 8 (bases 1 to 3578) AUTHORS Galaktionov,K. and Beach,D. TITLE Specific activation of cdc25 tyrosine phosphatases by B-type cyclins: evidence for multiple roles of mitotic cyclins JOURNAL Cell 67 (6), 1181-1194 (1991) PUBMED 1836978 REFERENCE 9 (bases 1 to 3578) AUTHORS Nagata,A., Igarashi,M., Jinno,S., Suto,K. and Okayama,H. TITLE An additional homolog of the fission yeast cdc25+ gene occurs in humans and is highly expressed in some cancer cells JOURNAL New Biol. 3 (10), 959-968 (1991) PUBMED 1662986 REFERENCE 10 (bases 1 to 3578) AUTHORS Strausfeld,U., Labbe,J.C., Fesquet,D., Cavadore,J.C., Picard,A., Sadhu,K., Russell,P. and Doree,M. TITLE Dephosphorylation and activation of a p34cdc2/cyclin B complex in vitro by human CDC25 protein JOURNAL Nature 351 (6323), 242-245 (1991) PUBMED 1828290 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK092713.1, BC051711.1, S78187.1, Z68092.1 and BX640836.1. On May 7, 2004 this sequence version replaced gi:11641410. Summary: CDC25B is a member of the CDC25 family of phosphatases. CDC25B activates the cyclin dependent kinase CDC2 by removing two phosphate groups and it is required for entry into mitosis. CDC25B shuttles between the nucleus and the cytoplasm due to nuclear localization and nuclear export signals. The protein is nuclear in the M and G1 phases of the cell cycle and moves to the cytoplasm during S and G2. CDC25B has oncogenic properties, although its role in tumor formation has not been determined. Multiple transcript variants for this gene exist. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (3), also known as CDC25B2, lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform 3) compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: Z68092.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025095 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-86 AK092713.1 16-101 87-556 BC051711.1 6-475 557-745 S78187.1 19-207 746-2520 Z68092.1 69-1843 2521-2922 BC051711.1 2564-2965 2923-3543 BX640836.1 1984-2604 3544-3578 S78187.1 3084-3118 FEATURES Location/Qualifiers source 1..3578 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="20" /map="20p13" gene 1..3578 /gene="CDC25B" /note="cell division cycle 25B" /db_xref="GeneID:994" /db_xref="HGNC:1726" /db_xref="HPRD:00307" /db_xref="MIM:116949" exon 1..978 /gene="CDC25B" /inference="alignment:Splign:1.39.8" variation 69 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:183999341" variation 158 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:11569978" variation 251 /gene="CDC25B" /replace="g" /replace="t" /db_xref="dbSNP:374054731" misc_feature 470..472 /gene="CDC25B" /note="upstream in-frame stop codon" variation 568 /gene="CDC25B" /replace="a" /replace="t" /db_xref="dbSNP:6116042" variation 662 /gene="CDC25B" /replace="a" /replace="c" /db_xref="dbSNP:13038734" variation 665..666 /gene="CDC25B" /replace="" /replace="c" /db_xref="dbSNP:11462398" variation 666..667 /gene="CDC25B" /replace="" /replace="c" /db_xref="dbSNP:71678223" variation 772 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:11087603" variation 775 /gene="CDC25B" /replace="c" /replace="g" /db_xref="dbSNP:372029025" CDS 779..2398 /gene="CDC25B" /EC_number="3.1.3.48" /note="isoform 3 is encoded by transcript variant 3; M-phase inducer phosphatase 2; dual specificity phosphatase Cdc25B" /codon_start=1 /product="M-phase inducer phosphatase 2 isoform 3" /protein_id="NP_068658.1" /db_xref="GI:11641411" /db_xref="CCDS:CCDS13066.1" /db_xref="GeneID:994" /db_xref="HGNC:1726" /db_xref="HPRD:00307" /db_xref="MIM:116949" /translation="
MEVPQPEPAPGSALSPAGVCGGAQRPGHLPGLLLGSHGLLGSPVRAAASSPVTTLTQTMHDLAGLGSETPKSQVGTLLFRSRSRLTHLSLSRRASESSLSSESSESSDAGLCMDSPSPMDPHMAEQTFEQAIQAASRIIRNEQFAIRRFQSMPDGFVFKMPWKPTHPSSTHALAEWASRREAFAQRPSSAPDLMCLSPDRKMEVEELSPLALGRFSLTPAEGDTEEDDGFVDILESDLKDDDAVPPGMESLISAPLVKTLEKEEEKDLVMYSKCQRLFRSPSMPCSVIRPILKRLERPQDRDTPVQNKRRRSVTPPEEQQEAEEPKARVLRSKSLCHDEIENLLDSDHRELIGDYSKAFLLQTVDGKHQDLKYISPETMVALLTGKFSNIVDKFVIVDCRYPYEYEGGHIKTAVNLPLERDAESFLLKSPIAPCSLDKRVILIFHCEFSSERGPRMCRFIRERDRAVNDYPSLYYPEMYILKGGYKEFFPQHPNFCEPQDYRPMNHEAFKDELKTFRLKTRSWAGERSRRELCSRLQDQ
" misc_feature 1115..1807 /gene="CDC25B" /note="M-phase inducer phosphatase; Region: M-inducer_phosp; pfam06617" /db_xref="CDD:115287" misc_feature 1616..1618 /gene="CDC25B" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:06119" misc_feature 1712..1714 /gene="CDC25B" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:04066" misc_feature 1889..2248 /gene="CDC25B" /note="Cdc25 phosphatases are members of the Rhodanese Homology Domain superfamily. They activate the cell division kinases throughout the cell cycle progression. Cdc25 phosphatases dephosphorylate phosphotyrosine and phosphothreonine residues, in order to...; Region: Cdc25; cd01530" /db_xref="CDD:29093" misc_feature 2114..2134 /gene="CDC25B" /note="oxyanion binding site; other site" /db_xref="CDD:29093" misc_feature 2114..2116 /gene="CDC25B" /note="active site residue [active]" /db_xref="CDD:29093" variation 820 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:11569979" variation 838 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:375122468" variation 889 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:368274446" variation 953 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:372183442" variation 965 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:145700972" variation 973 /gene="CDC25B" /replace="a" /replace="c" /db_xref="dbSNP:373847564" exon 979..1106 /gene="CDC25B" /inference="alignment:Splign:1.39.8" variation 984 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:373910055" variation 1014 /gene="CDC25B" /replace="g" /replace="t" /db_xref="dbSNP:202156665" variation 1017 /gene="CDC25B" /replace="c" /replace="g" /db_xref="dbSNP:76772959" variation 1023 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:146567070" variation 1031 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:141031701" variation 1038 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:375803588" variation 1039 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:370072424" variation 1063 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:201619391" variation 1069 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:374599445" variation 1078 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:147311787" variation 1081 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:368877264" variation 1091 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:199501910" exon 1107..1158 /gene="CDC25B" /inference="alignment:Splign:1.39.8" variation 1126 /gene="CDC25B" /replace="a" /replace="c" /db_xref="dbSNP:371577332" variation 1149 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:376436608" variation 1150 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:148241851" variation 1154 /gene="CDC25B" /replace="a" /replace="c" /db_xref="dbSNP:141382375" variation 1156 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:139123058" variation 1158 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:370155414" exon 1159..1200 /gene="CDC25B" /inference="alignment:Splign:1.39.8" variation 1159 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:150375046" variation 1187 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:137919521" variation 1188 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:143386679" variation 1197 /gene="CDC25B" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:143369164" exon 1201..1237 /gene="CDC25B" /inference="alignment:Splign:1.39.8" variation 1212 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:111654983" variation 1220 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:147172963" variation 1221 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:371528141" variation 1228 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:61755298" variation 1231 /gene="CDC25B" /replace="a" /replace="t" /db_xref="dbSNP:368675680" variation 1232 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:140433155" variation 1237 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:201436986" exon 1238..1360 /gene="CDC25B" /inference="alignment:Splign:1.39.8" variation 1242 /gene="CDC25B" /replace="c" /replace="g" /db_xref="dbSNP:202155757" variation 1286 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:368042199" variation 1307 /gene="CDC25B" /replace="g" /replace="t" /db_xref="dbSNP:142459784" variation 1325 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:200968688" exon 1361..1495 /gene="CDC25B" /inference="alignment:Splign:1.39.8" variation 1363..1364 /gene="CDC25B" /replace="" /replace="a" /db_xref="dbSNP:35741868" variation 1367 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:111545759" variation 1376 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:202222511" variation 1377 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:201435494" variation 1419 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:151315259" variation 1431 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:372916640" variation 1432 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:375854669" variation 1433 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:202059655" variation 1437 /gene="CDC25B" /replace="a" /replace="c" /db_xref="dbSNP:139531565" variation 1490 /gene="CDC25B" /replace="g" /replace="t" /db_xref="dbSNP:373171092" exon 1496..1576 /gene="CDC25B" /inference="alignment:Splign:1.39.8" variation 1511 /gene="CDC25B" /replace="c" /replace="g" /db_xref="dbSNP:144187197" variation 1565 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:201902192" variation 1575..1576 /gene="CDC25B" /replace="" /replace="a" /db_xref="dbSNP:35824153" exon 1577..1753 /gene="CDC25B" /inference="alignment:Splign:1.39.8" variation 1582 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:145108436" variation 1600 /gene="CDC25B" /replace="c" /replace="g" /db_xref="dbSNP:200104998" variation 1613 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:141314132" variation 1620 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:375465349" variation 1625 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:371407165" variation 1637 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:149795416" variation 1643 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:376224294" variation 1686 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:369403610" variation 1687 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:372954698" variation 1690 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:61746575" variation 1707 /gene="CDC25B" /replace="g" /replace="t" /db_xref="dbSNP:376488245" variation 1708 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:2228465" exon 1754..1849 /gene="CDC25B" /inference="alignment:Splign:1.39.8" variation 1762 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:143612466" variation 1765 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:11570010" variation 1770 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:374005977" variation 1805 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:376924240" variation 1808 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:371158244" variation 1823 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:138180783" exon 1850..1912 /gene="CDC25B" /inference="alignment:Splign:1.39.8" variation 1873 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:371343744" exon 1913..2011 /gene="CDC25B" /inference="alignment:Splign:1.39.8" variation 1922 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:2228464" variation 1929 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:376914644" variation 1930 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:146556613" variation 1949 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:199832947" exon 2012..2145 /gene="CDC25B" /inference="alignment:Splign:1.39.8" variation 2036 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:377681163" variation 2037 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:138651339" variation 2039 /gene="CDC25B" /replace="g" /replace="t" /db_xref="dbSNP:61742036" variation 2041 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:11570015" variation 2044 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:141229949" variation 2069 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:370128666" variation 2071 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:1056720" variation 2073 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:61755297" variation 2113 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:374888909" variation 2137 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:149394412" variation 2141 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:199659921" variation 2142 /gene="CDC25B" /replace="c" /replace="g" /db_xref="dbSNP:200957584" exon 2146..2257 /gene="CDC25B" /inference="alignment:Splign:1.39.8" variation 2227 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:146399677" variation 2251 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:143897481" exon 2258..3552 /gene="CDC25B" /inference="alignment:Splign:1.39.8" variation 2272 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:374526361" variation 2297 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:11570019" variation 2341 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:368410035" variation 2354 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:371947700" variation 2361 /gene="CDC25B" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:514523" variation 2362 /gene="CDC25B" /replace="c" /replace="g" /db_xref="dbSNP:514521" variation 2381 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:369357260" variation 2394 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:200551395" variation 2407 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:371951429" variation 2417 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:372117595" variation 2436 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:375603041" variation 2462 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:41279402" variation 2463 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:2229592" variation 2526 /gene="CDC25B" /replace="" /replace="t" /db_xref="dbSNP:201707296" variation 2609 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:11570020" variation 2620 /gene="CDC25B" /replace="a" /replace="c" /db_xref="dbSNP:368742502" variation 2631 /gene="CDC25B" /replace="g" /replace="t" /db_xref="dbSNP:139271260" variation 2639 /gene="CDC25B" /replace="a" /replace="c" /db_xref="dbSNP:55732615" variation 2668 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:189019990" variation 2748 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:6052085" variation 2768 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:11087604" variation 2774 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:11087605" variation 2842 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:142635163" variation 2883..2884 /gene="CDC25B" /replace="" /replace="a" /db_xref="dbSNP:35980638" variation 2896 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:11570021" STS 2967..3303 /gene="CDC25B" /standard_name="D20S1012" /db_xref="UniSTS:32857" variation 3037 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:181412320" variation 3064..3085 /gene="CDC25B" /replace="" /replace="tacccactcggtcccagttttg" /db_xref="dbSNP:71331068" variation 3065..3086 /gene="CDC25B" /replace="" /replace="acccactcggtcccagttttgt" /db_xref="dbSNP:11570022" variation 3073 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:11570023" variation 3135 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:367792437" variation 3282 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:186687615" variation 3357 /gene="CDC25B" /replace="c" /replace="t" /db_xref="dbSNP:1803263" STS 3404..3528 /gene="CDC25B" /standard_name="SHGC-30160" /db_xref="UniSTS:79344" variation 3427 /gene="CDC25B" /replace="c" /replace="g" /db_xref="dbSNP:8156" variation 3471 /gene="CDC25B" /replace="a" /replace="g" /db_xref="dbSNP:3516" polyA_signal 3527..3532 /gene="CDC25B" polyA_site 3548 /gene="CDC25B" /experiment="experimental evidence, no additional details recorded" polyA_site 3552 /gene="CDC25B" ORIGIN
gcagccagtcgcggaggcggggaggctgcgcggtcagaggcgcctggagcgagcgaatcctggcccaccgcctgcccaaccgcgtgaccttgattgagttaatgaacttcacgcctcagcgtccaggtctgtaaaatggggtgtctaacgcagaccgtacagcccagctgggtttagcaaacttccgggagccagttggagcctctccccatccctagcggtgatcccaggtgacgacatgccgcggggggtcctgcggaggccaccctagggcgttgctgctgcctttgggagtgtggagctccaaaccatgtcgcgagaggcggattttgggaggccgggatcctcgcgccagggggatgtgcgagggtgtgggataaatcttaattcctccggcccacccaaagcctggaaatccagcctccgcgcctcttgccctgcgggccccgccctcagtcccgccctcatctaacccgctaccccattggtggcgtccggcggcgcggctgctgttatttttcgaatatataaggaggtggaagtggcagctgcaactagaggcttccctggctggtgcctgagcccggcgtccctcgccccccgccctccccgcatccctctcctccctcgcgcctggccctgtggctcttcctccctccctccttccccccccccccacccctcgcccgctgcctccctcggcccagccagctgtgccggcgtttgttggctgccctgcgcccggccctccagccagccttctgccggccccgccgcgatggaggtgccccagccggagcccgcgccaggctcggctctcagtccagcaggcgtgtgcggtggcgcccagcgtccgggccacctcccgggcctcctgctgggatctcatggcctcctggggtccccggtgcgggcggccgcttcctcgccggtcaccaccctcacccagaccatgcacgacctcgccgggctcggcagcgaaaccccaaagagtcaggtagggaccctgctcttccgcagccgcagccgcctgacgcacctatccctgtctcgacgggcatccgaatcctccctgtcgtctgaatcctccgaatcttctgatgcaggtctctgcatggattcccccagccctatggacccccacatggcggagcagacgtttgaacaggccatccaggcagccagccggatcattcgaaacgagcagtttgccatcagacgcttccagtctatgccggatggatttgtcttcaagatgccatggaagcccacacatcccagctccacccatgctctggcagagtgggccagccgcagggaagcctttgcccagagacccagctcggcccccgacctgatgtgtctcagtcctgaccggaagatggaagtggaggagctcagccccctggccctaggtcgcttctctctgacccctgcagagggggatactgaggaagatgatggatttgtggacatcctagagagtgacttaaaggatgatgatgcagttcccccaggcatggagagtctcattagtgccccactggtcaagaccttggaaaaggaagaggaaaaggacctcgtcatgtacagcaagtgccagcggctcttccgctctccgtccatgccctgcagcgtgatccggcccatcctcaagaggctggagcggccccaggacagggacacgcccgtgcagaataagcggaggcggagcgtgacccctcctgaggagcagcaggaggctgaggaacctaaagcccgcgtcctccgctcaaaatcactgtgtcacgatgagatcgagaacctcctggacagtgaccaccgagagctgattggagattactctaaggccttcctcctacagacagtagacggaaagcaccaagacctcaagtacatctcaccagaaacgatggtggccctattgacgggcaagttcagcaacatcgtggataagtttgtgattgtagactgcagatacccctatgaatatgaaggcgggcacatcaagactgcggtgaacttgcccctggaacgcgacgccgagagcttcctactgaagagccccatcgcgccctgtagcctggacaagagagtcatcctcattttccactgtgaattctcatctgagcgtgggccccgcatgtgccgtttcatcagggaacgagaccgtgctgtcaacgactaccccagcctctactaccctgagatgtatatcctgaaaggcggctacaaggagttcttccctcagcacccgaacttctgtgaaccccaggactaccggcccatgaaccacgaggccttcaaggatgagctaaagaccttccgcctcaagactcgcagctgggctggggagcggagccggcgggagctctgtagccggctgcaggaccagtgaggggcctgcgccagtcctgctacctcccttgcctttcgaggcctgaagccagctgccctatgggcctgccgggctgagggcctgctggaggcctcaggtgctgtccatgggaaagatggtgtgggtgtcctgcctgtctgccccagcccagattcccctgtgtcatcccatcattttccatatcctggtgccccccacccctggaagagcccagtctgttgagttagttaagttgggttaataccagcttaaaggcagtattttgtgtcctccaggagcttcttgtttccttgttagggttaacccttcatcttcctgtgtcctgaaacgctcctttgtgtgtgtgtcagctgaggctgggggagagccgtggtccctgaggatgggtcagagctaaactccttcctggcctgagagtcagctctctgccctgtgtacttcccgggccagggctgcccctaatctctgtaggaaccgtggtatgtctgccatgttgcccctttctcttttcccctttcctgtcccaccatacgagcacctccagcctgaacagaagctcttactctttcctatttcagtgttacctgtgtgcttggtctgtttgactttacgcccatctcaggacacttccgtagactgtttaggttcccctgtcaaatatcagttacccactcggtcccagttttgttgccccagaaagggatgttattatccttgggggctcccagggcaagggttaaggcctgaatcatgagcctgctggaagcccagcccctactgctgtgaaccctggggcctgactgctcagaacttgctgctgtcttgttgcggatggatggaaggttggatggatgggtggatggccgtggatggccgtggatgcgcagtgccttgcatacccaaaccaggtgggagcgttttgttgagcatgacagcctgcagcaggaatatatgtgtgcctatttgtgtggacaaaaatatttacacttagggtttggagctattcaagaggaaatgtcacagaagcagctaaaccaaggactgagcaccctctggattctgaatctcaagatgggggcagggctgtgcttgaaggccctgctgagtcatctgttagggccttggttcaataaagcactgagcaagttgagaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:994 -> Molecular function: GO:0004725 [protein tyrosine phosphatase activity] evidence: TAS GeneID:994 -> Molecular function: GO:0019901 [protein kinase binding] evidence: IPI GeneID:994 -> Biological process: GO:0000086 [G2/M transition of mitotic cell cycle] evidence: TAS GeneID:994 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS GeneID:994 -> Biological process: GO:0001556 [oocyte maturation] evidence: IEA GeneID:994 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA GeneID:994 -> Biological process: GO:0007067 [mitosis] evidence: IEA GeneID:994 -> Biological process: GO:0007144 [female meiosis I] evidence: IEA GeneID:994 -> Biological process: GO:0008284 [positive regulation of cell proliferation] evidence: TAS GeneID:994 -> Biological process: GO:0032467 [positive regulation of cytokinesis] evidence: IMP GeneID:994 -> Biological process: GO:0035335 [peptidyl-tyrosine dephosphorylation] evidence: TAS GeneID:994 -> Biological process: GO:0045860 [positive regulation of protein kinase activity] evidence: IEA GeneID:994 -> Biological process: GO:0045931 [positive regulation of mitotic cell cycle] evidence: IMP GeneID:994 -> Biological process: GO:0051301 [cell division] evidence: IEA GeneID:994 -> Cellular component: GO:0000922 [spindle pole] evidence: IDA GeneID:994 -> Cellular component: GO:0005622 [intracellular] evidence: NAS GeneID:994 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS GeneID:994 -> Cellular component: GO:0005813 [centrosome] evidence: IDA GeneID:994 -> Cellular component: GO:0005829 [cytosol] evidence: TAS ANNOTATIONS from NCBI Entrez Gene (20130726): NP_068658 -> EC 3.1.3.48
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.