GGRNA | NM_021785.4

LOCUS       NM_021785               2229 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens retinoic acid induced 2 (RAI2), transcript variant 2,
            mRNA.
ACCESSION   NM_021785
VERSION     NM_021785.4  GI:290660716
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2229)
  AUTHORS   Brooks,S., Ebenezer,N., Poopalasundaram,S., Maher,E., Francis,P.,
            Moore,A. and Hardcastle,A.
  TITLE     Refinement of the X-linked cataract locus (CXN) and gene analysis
            for CXN and Nance-Horan syndrome (NHS)
  JOURNAL   Ophthalmic Genet. 25 (2), 121-131 (2004)
   PUBMED   15370543
REFERENCE   2  (bases 1 to 2229)
  AUTHORS   Walpole,S.M., Ronce,N., Grayson,C., Dessay,B., Yates,J.R., Trump,D.
            and Toutain,A.
  TITLE     Exclusion of RAI2 as the causative gene for Nance-Horan syndrome
  JOURNAL   Hum. Genet. 104 (5), 410-411 (1999)
   PUBMED   10394933
REFERENCE   3  (bases 1 to 2229)
  AUTHORS   Walpole,S.M., Hiriyana,K.T., Nicolaou,A., Bingham,E.L., Durham,J.,
            Vaudin,M., Ross,M.T., Yates,J.R., Sieving,P.A. and Trump,D.
  TITLE     Identification and characterization of the human homologue (RAI2)
            of a mouse retinoic acid-induced gene in Xp22
  JOURNAL   Genomics 55 (3), 275-283 (1999)
   PUBMED   10049581
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA648693.1, AK314631.1,
            Z93242.1, AK056214.1 and AI291859.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Mar 5, 2010 this sequence version replaced gi:193788648.
            
            Summary: Retinoic acid plays a critical role in development,
            cellular growth, and differentiation. The specific function of this
            retinoic acid-induced gene has not yet been determined but it may
            play a role in development. The chromosomal location of this gene
            designates it to be a candidate for diseases such as Nance-Horan
            syndrome, sensorineural deafness, non-specific X-linked mental
            retardation, oral-facial-digital syndrome, and Fried syndrome.
            Alternate splicing results in multiple transcript variants.
            [provided by RefSeq, Feb 2010].
            
            Transcript Variant: This variant (2) differs in the 5' UTR compared
            to variant 1. Variants 1, 2 and 3 encode the same isoform (1).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: DA648693.1, AK314631.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025086 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-37                DA648693.1         1-37
            38-790              AK314631.1         1-753
            791-791             Z93242.1           41325-41325
            792-1595            AK314631.1         755-1558
            1596-2224           AK056214.1         1689-2317
            2225-2229           AI291859.1         1-5                 c
FEATURES             Location/Qualifiers
     source          1..2229
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
                     /map="Xp22"
     gene            1..2229
                     /gene="RAI2"
                     /note="retinoic acid induced 2"
                     /db_xref="GeneID:10742"
                     /db_xref="HGNC:9835"
                     /db_xref="MIM:300217"
     exon            1..240
                     /gene="RAI2"
                     /inference="alignment:Splign:1.39.8"
     exon            241..2226
                     /gene="RAI2"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    259..261
                     /gene="RAI2"
                     /note="upstream in-frame stop codon"
     CDS             265..1857
                     /gene="RAI2"
                     /note="isoform 1 is encoded by transcript variant 2;
                     retinoic acid-induced protein 2"
                     /codon_start=1
                     /product="retinoic acid-induced protein 2 isoform 1"
                     /protein_id="NP_068557.3"
                     /db_xref="GI:290660717"
                     /db_xref="CCDS:CCDS14183.1"
                     /db_xref="GeneID:10742"
                     /db_xref="HGNC:9835"
                     /db_xref="MIM:300217"
                     /translation="

MDDLQSQNLSMDMTDSPPALANNRLENGMAQLITTEAWNINSTDLVKKALVTVPAPSILNPPAESQSGMALKVAATVLQPLCLGESPVVMPIHMQVEGSSAPELNPNGNATYVMTTQGPVQLPVVLEQHVFQHLNSPLVLPQEAPCSSSTIHNNLFQGAEDPEAQPQLLDLRIPSQPQEPTLPFEAVLQNLFPSQGTLGPPPCQPPPGYAPVPPQPFSSPLSPLVPPATLLVPYPVIVPLPVPVPIPIPIPVPQSSESKFSSSFPKPPSSFGLHPFKGTQTPLEKDELKPFDILQPKEYFQLSRHTVIKMGSENEALDLSMKSVPWLKAGEVSPPIFQEDAALDLSVAAHRKSEPPPETLYDSGASVDSSGHTVMEKLPSGMEISFAPATSHEAPAMMDSHISSSDAATEMLSQPNHPSGEVKAENNIEMVGESQAAKVIVSVEDAVPTIFCGKIKGLSGVSTKNFSFKREDSVLQGYDINSQGEESMGNAEPLRKPIKNRSIKLKKVNSQEIHMLPIKKQRLATFFPRK

"
     STS             1538..2227
                     /gene="RAI2"
                     /standard_name="RAI2__5640"
                     /db_xref="UniSTS:463847"
     variation       1748
                     /gene="RAI2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2213616"
     STS             1815..2004
                     /gene="RAI2"
                     /standard_name="RH94025"
                     /db_xref="UniSTS:90417"
     polyA_signal    2205..2210
                     /gene="RAI2"
     polyA_site      2226
                     /gene="RAI2"
ORIGIN

cttggtgtatatagtaaaggccgggcgccgcacgcagacacacactcgccaggacacaggcgcacacacgctcacgcacaaccagcagcggcggcggcgacagcgactcggtgacagcggcgacggcggctcccaccgcggcgcacccccttcaggcggccggcggcgaggccagaccggagagttccagcacactcgaccaccccgcggcttcctggaggcggcggccgcgattgcgaggccaagtggcatcagagctgagtgatggacgacctgcagtcccagaacctctccatggacatgactgactcccctcctgccttggctaataacagactggagaatggcatggctcagctgatcaccaccgaggcctggaacatcaactccactgacctggtaaagaaggccctggtgaccgtgccagccccatccattctgaacccccctgccgagtctcagagtggcatggctctgaaggtggcggccactgtgttgcagcccctgtgcctcggggagagcccagtggtgatgcccattcacatgcaggtggagggaagctccgcaccagagctcaatccgaatggcaatgccacctacgtcatgaccacccagggccccgtgcaactgcccgtggtgctggagcagcacgtctttcagcacctcaactcccctctggtcctgccgcaggaggccccatgctcctccagtaccatccacaacaacctcttccagggagcggaggaccccgaggcccagccccagctcctggacctgaggatccccagccagccgcaggagcccactttgccatttgaagctgtgctccagaatttgtttccctcccagggcactctcgggcccccaccctgtcagcctcctcctggctatgcccctgtgcccccacagccttttagctcccccttgtcccccctggtcccaccagccaccctcttggtgccgtatcctgtaatcgtccccttgcctgtgccagtccctattcccatccccatcccggtgcctcagagttctgaatccaagttcagctccagtttccccaagccaccatcttccttcggcctgcacccctttaaaggcacccagacccctctggaaaaagatgaactgaagccctttgacatcctccagcctaaggagtacttccagctcagccgccacacggtcattaagatgggaagtgagaacgaggccctggatctctccatgaagtcagtgccctggctcaaggctggtgaagtcagtcccccaatcttccaggaagatgcagccctagacctgtcagtggcagcccaccggaaatccgagcctccccctgagacactgtatgacagtggtgcatcagtggacagctcaggtcacacagtgatggagaaacttcccagtggcatggaaatttcttttgcccctgccacgtcccatgaggccccagccatgatggatagtcacatcagcagcagtgatgctgctaccgagatgctcagccagcccaaccaccccagcggcgaagtcaaggctgaaaataacattgagatggtgggcgagtcccaggcggccaaggtcattgtctctgtcgaagatgctgtgcctaccatattctgtggcaagatcaaaggcctctcaggggtgtccaccaaaaacttctccttcaaaagagaagactccgtgcttcagggctatgacatcaacagccaaggggaagagtccatgggaaatgcagagccccttaggaaacccatcaaaaaccggagcataaagttaaagaaagtgaactcccaggaaatacacatgctcccaatcaaaaaacaacggctggccaccttttttccaagaaagtaaataacggctttttaaaatttgtatgattataatatggggaaaggtgcattggttttataaaaaggcatttaaaacaaattatctttgttaattattttggggagtagttgggaaatggaaaggtgaattggctctagaggccctgtatgctagtatcattttcttttttaatttttgacttttcacaaatgagtaaataagagcaacctatttttcaagcagattgcacattttttgcagctttaatggaatattgggtgaattagaggggtaaaaaaagctattttcattgccacaaagtgctttgatgatgtaatacctaataaagggtaggatgaatatttcacaataaatgtttgtttgcactaaaaa

//

Annotations: