Home |
Help |
Advanced search
2025-05-09 16:41:55, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_016112 3060 bp mRNA linear PRI 15-JUN-2013
DEFINITION Homo sapiens polycystic kidney disease 2-like 1 (PKD2L1),
transcript variant 1, mRNA.
ACCESSION NM_016112
VERSION NM_016112.2 GI:33598943
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3060)
AUTHORS Wu,J.H., Lemaitre,R.N., Manichaikul,A., Guan,W., Tanaka,T., Foy,M.,
Kabagambe,E.K., Djousse,L., Siscovick,D., Fretts,A.M., Johnson,C.,
King,I.B., Psaty,B.M., McKnight,B., Rich,S.S., Chen,Y.D.,
Nettleton,J.A., Tang,W., Bandinelli,S., Jacobs,D.R. Jr.,
Browning,B.L., Laurie,C.C., Gu,X., Tsai,M.Y., Steffen,L.M.,
Ferrucci,L., Fornage,M. and Mozaffarian,D.
TITLE Genome-wide association study identifies novel loci associated with
concentrations of four plasma phospholipid fatty acids in the de
novo lipogenesis pathway: results from the Cohorts for Heart and
Aging Research in Genomic Epidemiology (CHARGE) consortium
JOURNAL Circ Cardiovasc Genet 6 (2), 171-183 (2013)
PUBMED 23362303
REFERENCE 2 (bases 1 to 3060)
AUTHORS Adachi,R., Sasaki,Y., Morita,H., Komai,M., Shirakawa,H., Goto,T.,
Furuyama,A. and Isono,K.
TITLE Behavioral analysis of Drosophila transformants expressing human
taste receptor genes in the gustatory receptor neurons
JOURNAL J. Neurogenet. 26 (2), 198-205 (2012)
PUBMED 22794107
REMARK GeneRIF: This study demonistrated that human PKD2L play the role of
food preference behavior.
REFERENCE 3 (bases 1 to 3060)
AUTHORS Molland,K.L., Paul,L.N. and Yernool,D.A.
TITLE Crystal structure and characterization of coiled-coil domain of the
transient receptor potential channel PKD2L1
JOURNAL Biochim. Biophys. Acta 1824 (3), 413-421 (2012)
PUBMED 22193359
REMARK GeneRIF: Trimerization may be important for both homo- and possibly
heteromeric assemblies of PKD2L1.
REFERENCE 4 (bases 1 to 3060)
AUTHORS Comuzzie,A.G., Cole,S.A., Laston,S.L., Voruganti,V.S., Haack,K.,
Gibbs,R.A. and Butte,N.F.
TITLE Novel genetic loci identified for the pathophysiology of childhood
obesity in the Hispanic population
JOURNAL PLoS ONE 7 (12), E51954 (2012)
PUBMED 23251661
REFERENCE 5 (bases 1 to 3060)
AUTHORS Demirkan,A., van Duijn,C.M., Ugocsai,P., Isaacs,A.,
Pramstaller,P.P., Liebisch,G., Wilson,J.F., Johansson,A., Rudan,I.,
Aulchenko,Y.S., Kirichenko,A.V., Janssens,A.C., Jansen,R.C.,
Gnewuch,C., Domingues,F.S., Pattaro,C., Wild,S.H., Jonasson,I.,
Polasek,O., Zorkoltseva,I.V., Hofman,A., Karssen,L.C.,
Struchalin,M., Floyd,J., Igl,W., Biloglav,Z., Broer,L., Pfeufer,A.,
Pichler,I., Campbell,S., Zaboli,G., Kolcic,I., Rivadeneira,F.,
Huffman,J., Hastie,N.D., Uitterlinden,A., Franke,L., Franklin,C.S.,
Vitart,V., Nelson,C.P., Preuss,M., Bis,J.C., O'Donnell,C.J.,
Franceschini,N., Witteman,J.C., Axenovich,T., Oostra,B.A.,
Meitinger,T., Hicks,A.A., Hayward,C., Wright,A.F., Gyllensten,U.,
Campbell,H. and Schmitz,G.
CONSRTM DIAGRAM Consortium; CARDIoGRAM Consortium; CHARGE Consortium;
EUROSPAN consortium
TITLE Genome-wide association study identifies novel loci associated with
circulating phospho- and sphingolipid concentrations
JOURNAL PLoS Genet. 8 (2), E1002490 (2012)
PUBMED 22359512
REFERENCE 6 (bases 1 to 3060)
AUTHORS Veldhuisen,B., Spruit,L., Dauwerse,H.G., Breuning,M.H. and
Peters,D.J.
TITLE Genes homologous to the autosomal dominant polycystic kidney
disease genes (PKD1 and PKD2)
JOURNAL Eur. J. Hum. Genet. 7 (8), 860-872 (1999)
PUBMED 10602361
REFERENCE 7 (bases 1 to 3060)
AUTHORS Chen,X.Z., Vassilev,P.M., Basora,N., Peng,J.B., Nomura,H.,
Segal,Y., Brown,E.M., Reeders,S.T., Hediger,M.A. and Zhou,J.
TITLE Polycystin-L is a calcium-regulated cation channel permeable to
calcium ions
JOURNAL Nature 401 (6751), 383-386 (1999)
PUBMED 10517637
REFERENCE 8 (bases 1 to 3060)
AUTHORS Tsiokas,L., Arnould,T., Zhu,C., Kim,E., Walz,G. and Sukhatme,V.P.
TITLE Specific association of the gene product of PKD2 with the TRPC1
channel
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 96 (7), 3934-3939 (1999)
PUBMED 10097141
REFERENCE 9 (bases 1 to 3060)
AUTHORS Wu,G., Hayashi,T., Park,J.H., Dixit,M., Reynolds,D.M., Li,L.,
Maeda,Y., Cai,Y., Coca-Prados,M. and Somlo,S.
TITLE Identification of PKD2L, a human PKD2-related gene: tissue-specific
expression and mapping to chromosome 10q25
JOURNAL Genomics 54 (3), 564-568 (1998)
PUBMED 9878261
REFERENCE 10 (bases 1 to 3060)
AUTHORS Nomura,H., Turco,A.E., Pei,Y., Kalaydjieva,L., Schiavello,T.,
Weremowicz,S., Ji,W., Morton,C.C., Meisler,M., Reeders,S.T. and
Zhou,J.
TITLE Identification of PKDL, a novel polycystic kidney disease 2-like
gene whose murine homologue is deleted in mice with kidney and
retinal defects
JOURNAL J. Biol. Chem. 273 (40), 25967-25973 (1998)
PUBMED 9748274
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AF073481.1 and AF053316.1.
On Aug 12, 2003 this sequence version replaced gi:7706638.
Summary: This gene encodes a member of the polycystin protein
family. The encoded protein contains multiple transmembrane
domains, and cytoplasmic N- and C-termini. The protein may be an
integral membrane protein involved in cell-cell/matrix
interactions. This protein functions as a calcium-regulated
nonselective cation channel. Two transcript variants encoding
different isoforms have been found for this gene. [provided by
RefSeq, Dec 2011].
Transcript Variant: This variant (1) encodes the longer isoform
(1).
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AF073481.1, BC025665.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
FEATURES Location/Qualifiers
source 1..3060
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="10"
/map="10q24"
gene 1..3060
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/note="polycystic kidney disease 2-like 1"
/db_xref="GeneID:9033"
/db_xref="HGNC:9011"
/db_xref="HPRD:16063"
/db_xref="MIM:604532"
exon 1..618
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="alignment:Splign:1.39.8"
misc_feature 339..341
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/note="upstream in-frame stop codon"
CDS 384..2801
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/note="isoform 1 is encoded by transcript variant 1;
transient receptor potential cation channel, subfamily P,
member 3; polycystin-L; polycystic kidney disease 2-like 1
protein; polycystin-L1; polycystin-2L1; polycystin-2
homolog"
/codon_start=1
/product="polycystic kidney disease 2-like 1 protein
isoform 1"
/protein_id="NP_057196.2"
/db_xref="GI:33598944"
/db_xref="CCDS:CCDS7492.1"
/db_xref="GeneID:9033"
/db_xref="HGNC:9011"
/db_xref="HPRD:16063"
/db_xref="MIM:604532"
/translation="
MNAVGSPEGQELQKLGSGAWDNPAYSGPPSPHGTLRVCTISSTGPLQPQPKKPEDEPQETAYRTQVSSCCLHICQGIRGLWGTTLTENTAENRELYIKTTLRELLVYIVFLVDICLLTYGMTSSSAYYYTKVMSELFLHTPSDTGVSFQAISSMADFWDFAQGPLLDSLYWTKWYNNQSLGHGSHSFIYYENMLLGVPRLRQLKVRNDSCVVHEDFREDILSCYDVYSPDKEEQLPFGPFNGTAWTYHSQDELGGFSHWGRLTSYSGGGYYLDLPGSRQGSAEALRALQEGLWLDRGTRVVFIDFSVYNANINLFCVLRLVVEFPATGGAIPSWQIRTVKLIRYVSNWDFFIVGCEVIFCVFIFYYVVEEILELHIHRLRYLSSIWNILDLVVILLSIVAVGFHIFRTLEVNRLMGKLLQQPNTYADFEFLAFWQTQYNNMNAVNLFFAWIKIFKYISFNKTMTQLSSTLARCAKDILGFAVMFFIVFFAYAQLGYLLFGTQVENFSTFIKCIFTQFRIILGDFDYNAIDNANRILGPAYFVTYVFFVFFVLLNMFLAIINDTYSEVKEELAGQKDELQLSDLLKQGYNKTLLRLRLRKERVSDVQKVLQGGEQEIQFEDFTNTLRELGHAEHEITELTATFTKFDRDGNRILDEKEQEKMRQDLEEERVALNTEIEKLGRSIVSSPQGKSGPEAARAGGWVSGEEFYMLTRRVLQLETVLEGVVSQIDAVGSKLKMLERKGWLAPSPGVKEQAIWKHPQPAPAVTPDPWGVQGGQESEVPYKREEEALEERRLSRGEIPTLQRS
"
misc_feature 693..755
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9P0L9.1);
transmembrane region"
misc_feature 819..2084
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/note="Polycystin cation channel; Region: PKD_channel;
pfam08016"
/db_xref="CDD:203839"
misc_feature 966..1004
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9P0L9.1);
Region: Polycystin motif"
misc_feature 1323..1385
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9P0L9.1);
transmembrane region"
misc_feature 1425..1487
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9P0L9.1);
transmembrane region"
misc_feature 1536..1598
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9P0L9.1);
transmembrane region"
misc_feature 1812..1874
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9P0L9.1);
transmembrane region"
misc_feature 2001..2063
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9P0L9.1);
transmembrane region"
variation 581
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:569511"
exon 619..732
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="alignment:Splign:1.39.8"
exon 733..860
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="alignment:Splign:1.39.8"
exon 861..1114
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="alignment:Splign:1.39.8"
variation 999
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/replace="c"
/replace="t"
/db_xref="dbSNP:2305383"
exon 1115..1339
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="alignment:Splign:1.39.8"
exon 1340..1568
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="alignment:Splign:1.39.8"
variation 1560
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/replace="a"
/replace="g"
/db_xref="dbSNP:2278842"
exon 1569..1739
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="alignment:Splign:1.39.8"
exon 1740..1921
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="alignment:Splign:1.39.8"
exon 1922..2042
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="alignment:Splign:1.39.8"
exon 2043..2141
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="alignment:Splign:1.39.8"
exon 2142..2263
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="alignment:Splign:1.39.8"
exon 2264..2390
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="alignment:Splign:1.39.8"
exon 2391..2509
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="alignment:Splign:1.39.8"
exon 2510..2633
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="alignment:Splign:1.39.8"
exon 2634..2718
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="alignment:Splign:1.39.8"
exon 2719..3051
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
/inference="alignment:Splign:1.39.8"
polyA_signal 3029..3034
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
polyA_site 3051
/gene="PKD2L1"
/gene_synonym="PCL; PKD2L; PKDL; TRPP3"
ORIGIN
cagcatcgccttttcctcccgtttctccttccactcccagctccacatcctcctcctattctcccctctcccctcttcaaacccccaccttccagttccctcacctcccctttcggctggtcccctggggcttgcagcaagagggagagagagctcctgacaggattgatggtccttccccaccctgtcctctcatccgctccctccccagcaggcacagacatccccctacaaaaggcaggagcccaggctgtgtggaaacagctgctctcagacgcctttccatttgctctctgctggctaggctgggctgtgcctctgctccctcttcctctagctgagagtgggcacctggggtaccgggcccccccacctcattccccatgaatgctgtgggaagtcctgaggggcaggagctgcaaaagctggggagtggagcctgggacaaccccgcctacagtggtcccccttccccacacgggacgctgagagtctgcaccatctccagcacggggcctctccagccccaacccaagaagcctgaagatgaaccccaggagacggcatacaggacccaggtgtccagctgctgcctccatatctgtcaaggcatcagaggactttggggaacaaccctgactgagaacacagctgagaaccgggaactttatatcaagaccaccctgagggagctgttggtatatattgtgttcctggtggacatctgtctactgacctatggaatgacaagctccagtgcttattactacaccaaagtgatgtctgagctcttcttacatactccatcagacactggagtctcctttcaggccatcagcagcatggcggacttctgggattttgcccagggcccactactggacagtttgtattggaccaaatggtacaacaaccagagcctgggccatggctcccactccttcatctactatgagaacatgctgctgggggttccgaggctgcggcagctaaaggtccgcaatgactcctgtgtggtgcatgaagacttccgggaggacattctgagctgctatgatgtctactctccagacaaagaagaacaactcccctttgggcccttcaatggcacagcgtggacataccactcgcaggatgagttggggggcttctcccactggggcaggctcacaagctacagcggaggtggctactacctggaccttccaggatcccgacagggtagtgcagaggctctccgggcccttcaggaggggctgtggctggacaggggcactcgagtggtgttcatcgacttctcagtctacaatgccaatatcaatcttttctgtgtcctgaggctggtggtggagtttccagctacaggaggtgccatcccatcctggcaaatccgcacagtcaagctgatccgctatgtcagcaactgggacttctttatcgttggctgtgaggtcatcttctgcgtcttcatcttctactatgtggtggaagagatcctggagctccacattcaccggcttcgctacctcagcagcatctggaacatactggacctggtggtcatcttgctctccattgtggctgtgggcttccacatattccgaaccctcgaggtgaatcggctcatggggaagctcctgcagcagccaaacacgtatgcagactttgagttcctcgccttctggcagacacagtacaacaacatgaatgctgtcaacctcttcttcgcctggatcaagatattcaagtacatcagcttcaacaaaaccatgacccagctctcctccacgctggcccgctgtgccaaggacatcctgggcttcgccgtcatgttcttcattgttttcttcgcctatgcccaactcggctacctgcttttcgggacccaagtggaaaactttagcactttcatcaagtgcattttcactcagttccggataatcctcggggactttgactacaatgctatcgacaatgccaaccgcatcctgggccctgcctactttgtcacctatgtcttcttcgtcttcttcgtgctcctgaacatgttcctggccatcatcaatgacacatattcagaggtcaaggaggagctggctggacagaaggatgagctgcaactttctgacctcctgaaacagggctacaacaagaccctactaagactgcgtctgaggaaggagagggtttcggatgtgcagaaggtcctgcagggtggggagcaggagatccagtttgaggatttcaccaacaccttaagggaactgggacacgcagagcatgaaatcactgagctcacggccaccttcaccaagtttgacagagatgggaatcgtattctggatgagaaggaacaggaaaaaatgcgacaggacctggaggaagagagggtggccctcaacactgagattgagaaactaggccgatctattgtgagcagcccacaaggcaaatcgggtccagaggctgccagagcaggaggctgggtttcaggagaagaattctacatgctcacaaggagagttctgcagctggagactgtcctggaaggagtagtgtcccagattgatgctgtaggctcaaagctgaaaatgctggagaggaaggggtggctggctccctccccaggcgtgaaggaacaagctatttggaagcacccgcagccagccccagctgtgaccccagacccctggggagtccagggtgggcaggagagtgaggttccctataaaagagaagaggaagccttagaggagaggagactctcccgtggtgagattccaacgttgcagaggagttaagtgtgaggcactcccggagcaaagtctatgaaggatcttctgcaagaggctgcctcctggtccactgaacctggaaactgagtgggctttaaccaggagataaaaatggagcctgaagggaatcaggcaaggaaatgaactcaggattcagagatctttgaattaatatgtggtgggttctgacattattcttccataagaccatgtgggtttccatggtggctatcaataaaactccttaggaaaacttaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:9033 -> Molecular function: GO:0005227 [calcium activated cation channel activity] evidence: IDA
GeneID:9033 -> Molecular function: GO:0005261 [cation channel activity] evidence: IDA
GeneID:9033 -> Molecular function: GO:0005262 [calcium channel activity] evidence: IBA
GeneID:9033 -> Molecular function: GO:0005272 [sodium channel activity] evidence: IDA
GeneID:9033 -> Molecular function: GO:0005509 [calcium ion binding] evidence: ISS
GeneID:9033 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:9033 -> Molecular function: GO:0008092 [cytoskeletal protein binding] evidence: IPI
GeneID:9033 -> Molecular function: GO:0008324 [cation transmembrane transporter activity] evidence: ISS
GeneID:9033 -> Molecular function: GO:0015269 [calcium-activated potassium channel activity] evidence: IDA
GeneID:9033 -> Molecular function: GO:0033040 [sour taste receptor activity] evidence: ISS
GeneID:9033 -> Molecular function: GO:0042802 [identical protein binding] evidence: ISS
GeneID:9033 -> Molecular function: GO:0051371 [muscle alpha-actinin binding] evidence: IPI
GeneID:9033 -> Molecular function: GO:0051393 [alpha-actinin binding] evidence: IPI
GeneID:9033 -> Biological process: GO:0001581 [detection of chemical stimulus involved in sensory perception of sour taste] evidence: ISS
GeneID:9033 -> Biological process: GO:0006812 [cation transport] evidence: ISS
GeneID:9033 -> Biological process: GO:0035725 [sodium ion transmembrane transport] evidence: IDA
GeneID:9033 -> Biological process: GO:0050982 [detection of mechanical stimulus] evidence: IBA
GeneID:9033 -> Biological process: GO:0070588 [calcium ion transmembrane transport] evidence: IBA
GeneID:9033 -> Biological process: GO:0071468 [cellular response to acidity] evidence: ISS
GeneID:9033 -> Biological process: GO:0071805 [potassium ion transmembrane transport] evidence: IDA
GeneID:9033 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: ISS
GeneID:9033 -> Cellular component: GO:0005886 [plasma membrane] evidence: IMP
GeneID:9033 -> Cellular component: GO:0009986 [cell surface] evidence: ISS
GeneID:9033 -> Cellular component: GO:0016021 [integral to membrane] evidence: NAS
GeneID:9033 -> Cellular component: GO:0043231 [intracellular membrane-bounded organelle] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.