GGRNA Home | Help | Advanced search

2025-11-07 20:25:10, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_013266               3248 bp    mRNA    linear   PRI 24-JUN-2013
DEFINITION  Homo sapiens catenin (cadherin-associated protein), alpha 3
            (CTNNA3), transcript variant 1, mRNA.
ACCESSION   NM_013266
VERSION     NM_013266.2  GI:188497715
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3248)
  AUTHORS   Borglum,A.D., Demontis,D., Grove,J., Pallesen,J., Hollegaard,M.V.,
            Pedersen,C.B., Hedemand,A., Mattheisen,M., Uitterlinden,A.,
            Nyegaard,M., Orntoft,T., Wiuf,C., Didriksen,M., Nordentoft,M.,
            Nothen,M.M., Rietschel,M., Ophoff,R.A., Cichon,S., Yolken,R.H.,
            Hougaard,D.M., Mortensen,P.B. and Mors,O.
  CONSRTM   GROUP investigators
  TITLE     Genome-wide study of association and interaction with maternal
            cytomegalovirus infection suggests new schizophrenia loci
  JOURNAL   Mol. Psychiatry (2013) In press
   PUBMED   23358160
  REMARK    Publication Status: Available-Online prior to print
REFERENCE   2  (bases 1 to 3248)
  AUTHORS   van Hengel,J., Calore,M., Bauce,B., Dazzo,E., Mazzotti,E., De
            Bortoli,M., Lorenzon,A., Li Mura,I.E., Beffagna,G., Rigato,I.,
            Vleeschouwers,M., Tyberghein,K., Hulpiau,P., van Hamme,E.,
            Zaglia,T., Corrado,D., Basso,C., Thiene,G., Daliento,L., Nava,A.,
            van Roy,F. and Rampazzo,A.
  TITLE     Mutations in the area composita protein alphaT-catenin are
            associated with arrhythmogenic right ventricular cardiomyopathy
  JOURNAL   Eur. Heart J. 34 (3), 201-210 (2013)
   PUBMED   23136403
  REMARK    GeneRIF: Results suggest a causal relationship between CTNNA3
            mutations and arrhythmogenic right ventricular cardiomyopathy
REFERENCE   3  (bases 1 to 3248)
  AUTHORS   Shaffer,J.R., Feingold,E., Wang,X., Lee,M., Tcuenco,K., Weeks,D.E.,
            Weyant,R.J., Crout,R., McNeil,D.W. and Marazita,M.L.
  TITLE     GWAS of dental caries patterns in the permanent dentition
  JOURNAL   J. Dent. Res. 92 (1), 38-44 (2013)
   PUBMED   23064961
REFERENCE   4  (bases 1 to 3248)
  AUTHORS   Bernstein,D.I., Kashon,M., Lummus,Z.L., Johnson,V.J., Fluharty,K.,
            Gautrin,D., Malo,J.L., Cartier,A., Boulet,L.P., Sastre,J.,
            Quirce,S., Germolec,D., Tarlo,S.M., Cruz,M.J., Munoz,X.,
            Luster,M.I. and Yucesoy,B.
  TITLE     CTNNA3 (alpha-catenin) gene variants are associated with
            diisocyanate asthma: a replication study in a Caucasian worker
            population
  JOURNAL   Toxicol. Sci. 131 (1), 242-246 (2013)
   PUBMED   22977168
  REMARK    GeneRIF: GWAS study of diisocyanate asthma demonstrates an
            association between two closely linked CTNNA3 gene SNPs and
            diisocyanate asthma.
REFERENCE   5  (bases 1 to 3248)
  AUTHORS   Comuzzie,A.G., Cole,S.A., Laston,S.L., Voruganti,V.S., Haack,K.,
            Gibbs,R.A. and Butte,N.F.
  TITLE     Novel genetic loci identified for the pathophysiology of childhood
            obesity in the Hispanic population
  JOURNAL   PLoS ONE 7 (12), E51954 (2012)
   PUBMED   23251661
REFERENCE   6  (bases 1 to 3248)
  AUTHORS   Deloukas,P., Earthrowl,M.E., Grafham,D.V., Rubenfield,M.,
            French,L., Steward,C.A., Sims,S.K., Jones,M.C., Searle,S.,
            Scott,C., Howe,K., Hunt,S.E., Andrews,T.D., Gilbert,J.G.,
            Swarbreck,D., Ashurst,J.L., Taylor,A., Battles,J., Bird,C.P.,
            Ainscough,R., Almeida,J.P., Ashwell,R.I., Ambrose,K.D.,
            Babbage,A.K., Bagguley,C.L., Bailey,J., Banerjee,R., Bates,K.,
            Beasley,H., Bray-Allen,S., Brown,A.J., Brown,J.Y., Burford,D.C.,
            Burrill,W., Burton,J., Cahill,P., Camire,D., Carter,N.P.,
            Chapman,J.C., Clark,S.Y., Clarke,G., Clee,C.M., Clegg,S., Corby,N.,
            Coulson,A., Dhami,P., Dutta,I., Dunn,M., Faulkner,L., Frankish,A.,
            Frankland,J.A., Garner,P., Garnett,J., Gribble,S., Griffiths,C.,
            Grocock,R., Gustafson,E., Hammond,S., Harley,J.L., Hart,E.,
            Heath,P.D., Ho,T.P., Hopkins,B., Horne,J., Howden,P.J., Huckle,E.,
            Hynds,C., Johnson,C., Johnson,D., Kana,A., Kay,M., Kimberley,A.M.,
            Kershaw,J.K., Kokkinaki,M., Laird,G.K., Lawlor,S., Lee,H.M.,
            Leongamornlert,D.A., Laird,G., Lloyd,C., Lloyd,D.M., Loveland,J.,
            Lovell,J., McLaren,S., McLay,K.E., McMurray,A.,
            Mashreghi-Mohammadi,M., Matthews,L., Milne,S., Nickerson,T.,
            Nguyen,M., Overton-Larty,E., Palmer,S.A., Pearce,A.V., Peck,A.I.,
            Pelan,S., Phillimore,B., Porter,K., Rice,C.M., Rogosin,A.,
            Ross,M.T., Sarafidou,T., Sehra,H.K., Shownkeen,R., Skuce,C.D.,
            Smith,M., Standring,L., Sycamore,N., Tester,J., Thorpe,A.,
            Torcasso,W., Tracey,A., Tromans,A., Tsolas,J., Wall,M., Walsh,J.,
            Wang,H., Weinstock,K., West,A.P., Willey,D.L., Whitehead,S.L.,
            Wilming,L., Wray,P.W., Young,L., Chen,Y., Lovering,R.C.,
            Moschonas,N.K., Siebert,R., Fechtel,K., Bentley,D., Durbin,R.,
            Hubbard,T., Doucette-Stamm,L., Beck,S., Smith,D.R. and Rogers,J.
  TITLE     The DNA sequence and comparative analysis of human chromosome 10
  JOURNAL   Nature 429 (6990), 375-381 (2004)
   PUBMED   15164054
REFERENCE   7  (bases 1 to 3248)
  AUTHORS   Busby,V., Goossens,S., Nowotny,P., Hamilton,G., Smemo,S.,
            Harold,D., Turic,D., Jehu,L., Myers,A., Womick,M., Woo,D.,
            Compton,D., Doil,L.M., Tacey,K.M., Lau,K.F., Al-Saraj,S.,
            Killick,R., Pickering-Brown,S., Moore,P., Hollingworth,P.,
            Archer,N., Foy,C., Walter,S., Lendon,C., Iwatsubo,T., Morris,J.C.,
            Norton,J., Mann,D., Janssens,B., Hardy,J., O'Donovan,M., Jones,L.,
            Williams,J., Holmans,P., Owen,M.J., Grupe,A., Powell,J., van
            Hengel,J., Goate,A., Van Roy,F. and Lovestone,S.
  TITLE     Alpha-T-catenin is expressed in human brain and interacts with the
            Wnt signaling pathway but is not responsible for linkage to
            chromosome 10 in Alzheimer's disease
  JOURNAL   Neuromolecular Med. 5 (2), 133-146 (2004)
   PUBMED   15075440
  REMARK    GeneRIF: We found no association between CTNNA3 and Alzheimer
            disease in subjects showing linkage to chromosome 10, nor were
            these SNPs associated with Abeta deposition in brain. CTNNA3 is
            unlikely to account for the susceptibility locus on chromosome 10
REFERENCE   8  (bases 1 to 3248)
  AUTHORS   Ertekin-Taner,N., Ronald,J., Asahara,H., Younkin,L., Hella,M.,
            Jain,S., Gnida,E., Younkin,S., Fadale,D., Ohyagi,Y., Singleton,A.,
            Scanlin,L., de Andrade,M., Petersen,R., Graff-Radford,N., Hutton,M.
            and Younkin,S.
  TITLE     Fine mapping of the alpha-T catenin gene to a quantitative trait
            locus on chromosome 10 in late-onset Alzheimer's disease pedigrees
  JOURNAL   Hum. Mol. Genet. 12 (23), 3133-3143 (2003)
   PUBMED   14559775
  REMARK    GeneRIF: Alpha-T catenin gene has variants which influence Abeta42
            and contribute to the previously reported linkage for plasma
            Abeta42 in late-onset Alzheimer's disease families.
REFERENCE   9  (bases 1 to 3248)
  AUTHORS   Janssens,B., Mohapatra,B., Vatta,M., Goossens,S., Vanpoucke,G.,
            Kools,P., Montoye,T., van Hengel,J., Bowles,N.E., van Roy,F. and
            Towbin,J.A.
  TITLE     Assessment of the CTNNA3 gene encoding human alpha T-catenin
            regarding its involvement in dilated cardiomyopathy
  JOURNAL   Hum. Genet. 112 (3), 227-236 (2003)
   PUBMED   12596047
  REMARK    GeneRIF: gene localized on chromosome 10q21 and is 1,776 kb in
            length; mutation screening of all 18 exons of the CTNNA3 gene in a
            family showing dilated cardiomyopathy (DCM)linkage to the 10q21-q23
            locus, however, has not detected any DCM-linked CTNNA3 mutations
REFERENCE   10 (bases 1 to 3248)
  AUTHORS   Janssens,B., Goossens,S., Staes,K., Gilbert,B., van Hengel,J.,
            Colpaert,C., Bruyneel,E., Mareel,M. and van Roy,F.
  TITLE     alphaT-catenin: a novel tissue-specific beta-catenin-binding
            protein mediating strong cell-cell adhesion
  JOURNAL   J. Cell. Sci. 114 (PT 17), 3177-3188 (2001)
   PUBMED   11590244
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK313882.1, AF091606.1, BC065819.1 and AK289756.1.
            On May 16, 2008 this sequence version replaced gi:7019570.
            
            Transcript Variant: This variant (1) utilizes an alternate first
            exon resulting in a distinct 5'UTR. Transcript variants 1 and 2
            encode the same protein isoform.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK313882.1, AF091606.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025082, ERS025083 [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-22                AK313882.1         3-24
            23-674              AF091606.1         1-652
            675-1728            BC065819.1         571-1624
            1729-3042           AF091606.1         1707-3020
            3043-3248           AK289756.1         2932-3137
FEATURES             Location/Qualifiers
     source          1..3248
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
                     /map="10q22.2"
     gene            1..3248
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /note="catenin (cadherin-associated protein), alpha 3"
                     /db_xref="GeneID:29119"
                     /db_xref="HGNC:2511"
                     /db_xref="MIM:607667"
     exon            1..192
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(27)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200608088"
     variation       complement(67)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184782437"
     variation       complement(145)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80217385"
     misc_feature    159..161
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /note="upstream in-frame stop codon"
     exon            193..296
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /inference="alignment:Splign:1.39.8"
     CDS             198..2885
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /note="alpha-catenin-like protein; alpha-T-catenin; alpha
                     T-catenin; cadherin-associated protein"
                     /codon_start=1
                     /product="catenin alpha-3"
                     /protein_id="NP_037398.2"
                     /db_xref="GI:188497716"
                     /db_xref="CCDS:CCDS7269.1"
                     /db_xref="GeneID:29119"
                     /db_xref="HGNC:2511"
                     /db_xref="MIM:607667"
                     /translation="
MSAETPITLNIDPQDLQVQTFTVEKLLEPLIIQVTTLVNCPQNPSSRKKGRSKRASVLLASVEEATWNLLDKGEKIAQEATVLKDELTASLEEVRKESEALKVSAERFTDDPCFLPKREAVVQAARALLAAVTRLLILADMIDVMCLLQHVSAFQRTFESLKNVANKSDLQKTYQKLGKELENLDYLAFKRQQDLKSPNQRDEIAGARASLKENSPLLHSICSACLEHSDVASLKASKDTVCEEIQNALNVISNASQGIQNMTTPPEPQAATLGSALDELENLIVLNPLTVTEEEIRPSLEKRLEAIISGAALLADSSCTRDLHRERIIAECNAIRQALQDLLSEYMNNAGKKERSNTLNIALDNMCKKTRDLRRQLRKAIIDHVSDSFLDTTVPLLVLIEAAKNGREKEIKEYAAIFHEHTSRLVEVANLACSMSTNEDGIKIVKIAANHLETLCPQIINAALALAARPKSQAVKNTMEMYKRTWENHIHVLTEAVDDITSIDDFLAVSESHILEDVNKCIIALRDQDADNLDRAAGAIRGRAARVAHIVTGEMDSYEPGAYTEGVMRNVNFLTSTVIPEFVTQVNVALEALSKSSLNVLDDNQFVDISKKIYDTIHDIRCSVMMIRTPEELEDVSDLEEEHEVRSHTSIQTEGKTDRAKMTQLPEAEKEKIAEQVADFKKVKSKLDAEIEIWDDTSNDIIVLAKNMCMIMMEMTDFTRGKGPLKHTTDVIYAAKMISESGSRMDVLARQIANQCPDPSCKQDLLAYLEQIKFYSHQLKICSQVKAEIQNLGGELIMSALDSVTSLIQAAKNLMNAVVQTVKMSYIASTKIIRIQSPAGPRHPVVMWRMKAPAKKPLIKREKPEETCAAVRRGSAKKKIHPLQVMSEFRGRQIY
"
     misc_feature    249..2765
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /note="Vinculin family; Region: Vinculin; pfam01044"
                     /db_xref="CDD:110072"
     misc_feature    2106..2108
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q9UI47.2); phosphorylation site"
     variation       complement(215)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:138580439"
     variation       complement(230)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61735044"
     variation       complement(257)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374611639"
     variation       complement(270)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375607074"
     exon            297..489
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(349)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143725018"
     variation       complement(352)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139105272"
     variation       complement(353)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61759502"
     variation       complement(357)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200409596"
     variation       complement(358)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377158111"
     variation       complement(362)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141527898"
     variation       complement(383)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369638097"
     variation       complement(386)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375304070"
     variation       complement(408)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:10997754"
     variation       complement(411)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371997421"
     variation       complement(415)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141436901"
     variation       complement(429)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201306690"
     exon            490..656
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(509)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201480758"
     variation       complement(545)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61749224"
     variation       complement(573)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373661106"
     variation       complement(584)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143943926"
     variation       complement(590)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:80182543"
     variation       complement(596)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150376558"
     variation       complement(626)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111880127"
     variation       complement(645)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368622093"
     variation       complement(654)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147116577"
     exon            657..776
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(657)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374067925"
     variation       complement(675)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:61749223"
     variation       complement(680)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74142830"
     variation       complement(775)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373233387"
     exon            777..1040
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(799)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372957321"
     variation       complement(802)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138821753"
     variation       complement(820)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369420715"
     variation       complement(833)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200809148"
     variation       complement(841)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146441824"
     variation       complement(846)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374834298"
     variation       complement(851)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371330302"
     variation       complement(915)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367570454"
     variation       complement(939)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192093851"
     variation       complement(943)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146048212"
     variation       complement(946)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372717475"
     variation       complement(957)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368470427"
     variation       complement(965)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140926333"
     variation       complement(976)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190073606"
     variation       complement(991)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151069922"
     variation       complement(993)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199985402"
     variation       complement(1005)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368027975"
     variation       complement(1016)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146622691"
     variation       complement(1029)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143693772"
     exon            1041..1244
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1063)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375250429"
     variation       complement(1064)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149090594"
     variation       complement(1067)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369449859"
     variation       complement(1077)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146475470"
     variation       complement(1087)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201596778"
     variation       complement(1127)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144152750"
     variation       complement(1142)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375992799"
     variation       complement(1156)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139460414"
     variation       complement(1164)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:113836576"
     variation       complement(1170)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369024617"
     variation       complement(1179)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374713975"
     variation       complement(1183)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181929603"
     variation       complement(1184)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372427902"
     variation       complement(1196)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146754105"
     variation       complement(1200)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370088870"
     variation       complement(1203)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375721994"
     variation       complement(1204)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372482202"
     variation       complement(1232)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368211074"
     variation       complement(1233)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143203517"
     variation       complement(1244)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:60262757"
     exon            1245..1325
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1252)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141978685"
     variation       complement(1261)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375610128"
     variation       complement(1294)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201966934"
     variation       complement(1317)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370981751"
     exon            1326..1478
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1329)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187752783"
     variation       complement(1330)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143682596"
     variation       complement(1351)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149348606"
     variation       complement(1372)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146777494"
     variation       complement(1373)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138898184"
     variation       complement(1383)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376091500"
     variation       complement(1389)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145043626"
     variation       complement(1392)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:115276158"
     variation       complement(1395)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374015031"
     variation       complement(1396)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201896157"
     variation       complement(1416)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138643733"
     variation       complement(1417)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369880246"
     variation       complement(1428)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372808360"
     variation       complement(1433)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150167695"
     variation       complement(1460)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140907744"
     variation       complement(1475)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143981286"
     exon            1479..1571
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1500)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377404952"
     variation       complement(1501)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369650832"
     exon            1572..1728
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1587)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367599520"
     variation       complement(1599)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151007312"
     variation       complement(1618)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201810511"
     variation       complement(1619)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372258059"
     variation       complement(1643)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76737066"
     variation       complement(1645)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200282168"
     variation       complement(1647)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200182913"
     variation       complement(1650)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140913916"
     variation       complement(1669)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201173778"
     variation       complement(1673)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182681928"
     variation       complement(1686)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368067642"
     variation       complement(1688)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141098613"
     variation       complement(1704)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147802834"
     variation       complement(1706)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375080368"
     exon            1729..1929
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1736)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377413642"
     variation       complement(1746)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373151978"
     variation       complement(1755)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:144269113"
     variation       complement(1771)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369650158"
     variation       complement(1784)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:74141466"
     variation       complement(1785)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74141465"
     variation       complement(1800)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41274090"
     variation       complement(1801)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139378888"
     variation       complement(1808)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146900023"
     variation       complement(1824)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372758887"
     variation       complement(1825)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369033938"
     variation       complement(1827)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376250417"
     variation       complement(1837)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374703865"
     variation       complement(1852)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61737718"
     variation       complement(1854)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371983729"
     variation       complement(1870)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141429762"
     variation       complement(1872)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367823042"
     variation       complement(1879)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374844431"
     variation       complement(1886)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370247825"
     variation       complement(1889)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138798862"
     variation       complement(1897)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146096912"
     variation       complement(1900)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376984969"
     variation       complement(1918)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375428912"
     variation       complement(1920)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199940048"
     exon            1930..2081
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1932)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375734372"
     variation       complement(1936)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368000502"
     variation       complement(1984)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4548513"
     variation       complement(1989)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187527391"
     variation       complement(1997)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137910578"
     variation       complement(2010)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139661235"
     variation       complement(2020)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:138314889"
     variation       complement(2045)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:182490263"
     variation       complement(2047)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190239785"
     variation       complement(2050)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184992188"
     variation       complement(2062)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367616357"
     variation       complement(2069)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:10997034"
     variation       complement(2079)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149081490"
     exon            2082..2174
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(2097)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77165728"
     variation       complement(2124)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141141746"
     variation       complement(2126)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147760277"
     variation       complement(2130)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370600208"
     variation       complement(2133)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111425421"
     variation       complement(2134)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370269225"
     variation       complement(2136)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376927818"
     variation       complement(2165)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200764970"
     exon            2175..2356
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(2203)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377166040"
     variation       complement(2238)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142116698"
     variation       complement(2250)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199697536"
     variation       complement(2263)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150734357"
     variation       complement(2268)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374172412"
     variation       complement(2294)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142942346"
     variation       complement(2319)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148554495"
     variation       complement(2339)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115972723"
     variation       complement(2355)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143867269"
     exon            2357..2462
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(2369)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:116662854"
     variation       complement(2408)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192848934"
     variation       complement(2438)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113397208"
     variation       complement(2445)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149211186"
     variation       complement(2446)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367848292"
     variation       complement(2457)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:142752710"
     exon            2463..2597
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(2466)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373175781"
     variation       complement(2468)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372746141"
     variation       complement(2480)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372435356"
     variation       complement(2499)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368637046"
     variation       complement(2519)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374450104"
     variation       complement(2575)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188248522"
     variation       complement(2577)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145119798"
     exon            2598..3248
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(2607)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370688983"
     variation       complement(2611)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200392000"
     STS             2656..3162
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /standard_name="CTNNA3_4652"
                     /db_xref="UniSTS:462847"
     variation       complement(2691)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376310020"
     variation       complement(2697)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202196166"
     variation       complement(2698)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373081692"
     variation       complement(2721)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199852825"
     variation       complement(2747)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138237676"
     variation       complement(2750)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115814032"
     variation       complement(2770)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41313840"
     variation       complement(2825)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377740786"
     variation       complement(2826)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374368635"
     variation       complement(2853)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376134614"
     variation       complement(2893)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190581449"
     variation       complement(2900)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369681914"
     variation       complement(2984)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371283856"
     variation       complement(3128)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77424782"
     variation       complement(3140)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185258162"
     variation       complement(3147)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74442277"
     variation       complement(3193)
                     /gene="CTNNA3"
                     /gene_synonym="VR22"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192926725"
ORIGIN      
tttctttcttatcctgggtgaacaacgctcagcgaaattgactgccccactgtcatctgcctctcaatttggtactctgtaactctgtgaccaccaagaagcctttttccgtcccccacaaagctctttttggaaaattccctacgggagctgaattttaagcccatttactttataggaagaaacagaaaggcagcatgtcagctgaaacaccaatcacattgaatatcgatcctcaggatctgcaggtccaaacattcaccgtggagaagctactggagcctctcataatccaggttaccacacttgtaaactgtccccagaacccttccagcaggaaaaaaggacgttcgaaaagagccagtgtccttctagcttctgtggaggaagcaacttggaatttattagacaagggagagaagattgcccaggaagctacagttttaaaggatgagcttacggcttcacttgaggaagttcgcaaagaaagtgaagctctgaaagtatcagctgagagatttacagatgacccctgttttctcccaaaaagggaggctgtggttcaagctgcccgtgccttgctggctgcggtgacgagactccttatccttgcggacatgattgatgtcatgtgcctcttgcaacatgtgtcagcttttcaaaggacatttgagtctctcaaaaatgttgccaacaaatctgacctccagaaaacctaccagaagcttgggaaggagctggaaaatttggattatttagccttcaaacgtcagcaggacttaaaatctccaaatcagagagatgaaattgcaggagcccgagcttcactgaaggagaactctcccctcttgcattcaatttgttcagcttgtttggagcattctgatgttgcttccctcaaagcaagcaaggacacagtttgtgaagaaattcagaatgctctcaatgtaatttcaaatgcttcacaagggatccagaatatgacaaccccaccagaacctcaggcagcaaccctgggaagtgcccttgatgagctggagaatttaattgtcctgaatccactcacagtaactgaggaggaaatacgaccatcactagagaaacgccttgaagccattatcagtggggctgctctgctggcggattcttcatgtacgagggacttacaccgagagcggattatcgcagaatgcaacgccattcgccaggctcttcaggatctgctttcagagtacatgaacaacgctggaaaaaaagaaaggagtaataccctgaatattgctttagacaacatgtgtaagaagacaagagaccttcgcagacagctccgcaaggctattatagatcatgtgtcagactctttcctggatacgacagtccctcttttggttctcattgaagctgctaagaatggccgggaaaaggaaataaaagaatatgctgcgatatttcatgaacacaccagcaggcttgtagaggtggcaaatcttgcttgttccatgtcaacaaatgaagatggaattaaaattgtcaaaattgcagccaatcatttggaaaccttgtgtccacagattattaatgctgcacttgctttggctgcaagacccaaaagtcaagcggtcaaaaacaccatggaaatgtacaagcgtacatgggagaatcatatacatgtcctcactgaagccgtagatgacattacaagcattgatgacttccttgctgtatctgaaagccatatcttggaagatgtcaacaagtgtatcatagccttaagagaccaggatgctgataatttagaccgtgctgcgggtgctatcagaggccgggcagcaagagttgctcacatcgtcacgggtgaaatggacagttacgagccaggggcttacacggaaggtgtaatgagaaatgttaacttccttacaagtactgtaattcctgaatttgtaacacaagtgaatgttgccttggaagccttaagcaaaagctcattgaatgtgttggatgataatcaatttgtggacatctcaaagaagatctatgatacaattcatgatatcagatgttcagtcatgatgattcggaccccagaggaactggaggatgtttctgaccttgaagaggaacacgaggtccgcagtcacaccagcattcagaccgaagggaaaactgatagggctaagatgactcaactgcctgaggcagaaaaagaaaagattgctgagcaagttgctgatttcaagaaagtaaagagtaagctggatgctgagattgagatatgggatgatacaagcaacgacatcattgttctggccaagaacatgtgtatgatcatgatggagatgacagacttcactaggggcaaaggaccactaaagcatacaactgatgtgatctatgcagcgaaaatgatatcagaatcaggatcaaggatggatgtccttgctcggcagattgctaatcagtgcccagatccatcttgtaaacaggacttgttggcctacctggaacagattaagttctactcccaccaactgaaaatctgcagtcaagttaaagctgagatccagaacctgggaggagagctcatcatgtcagctttggacagtgtcacatccctgatccaagcagccaaaaatttaatgaatgctgtagtgcaaacagtgaaaatgtcttacattgcctcaaccaagatcatccgaatccagagtcctgctgggccccggcacccagttgtgatgtggagaatgaaggctcctgcaaaaaaacccttgattaaaagagagaagccagaggaaacgtgtgcagctgtcagacgaggctcagcaaagaaaaaaatccatccattgcaagtcatgagtgaatttagaggaagacaaatctactgaaaccactattctacatatagtgcctatatgacaaaatcctgcctaaccacactgctttattttacacttaagaagttctgtaatttcactaagttttggtgtttaactcacaaataacataaaatattgggcgctaaatcaacaaaagcaatatatatttgggatcatatcactgtcatttctgtatggtcagcacctaatagttaaggaatatttgcttgttgaatgaatgaaattatcacgtgtcattcagcgtttcccatcatagagattatctactattcgttaccaaataaacacaggagaggccagagagtcctgtttatctgtaatacttcatgtacacttatcatccttatcttg
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:29119 -> Molecular function: GO:0005198 [structural molecule activity] evidence: IEA
            GeneID:29119 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:29119 -> Molecular function: GO:0045296 [cadherin binding] evidence: TAS
            GeneID:29119 -> Biological process: GO:0016337 [cell-cell adhesion] evidence: IPI
            GeneID:29119 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
            GeneID:29119 -> Cellular component: GO:0005916 [fascia adherens] evidence: IDA
            GeneID:29119 -> Cellular component: GO:0015629 [actin cytoskeleton] evidence: IEA
            GeneID:29119 -> Cellular component: GO:0030027 [lamellipodium] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.