Home |
Help |
Advanced search
2025-05-09 16:25:24, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_013266 3248 bp mRNA linear PRI 24-JUN-2013
DEFINITION Homo sapiens catenin (cadherin-associated protein), alpha 3
(CTNNA3), transcript variant 1, mRNA.
ACCESSION NM_013266
VERSION NM_013266.2 GI:188497715
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3248)
AUTHORS Borglum,A.D., Demontis,D., Grove,J., Pallesen,J., Hollegaard,M.V.,
Pedersen,C.B., Hedemand,A., Mattheisen,M., Uitterlinden,A.,
Nyegaard,M., Orntoft,T., Wiuf,C., Didriksen,M., Nordentoft,M.,
Nothen,M.M., Rietschel,M., Ophoff,R.A., Cichon,S., Yolken,R.H.,
Hougaard,D.M., Mortensen,P.B. and Mors,O.
CONSRTM GROUP investigators
TITLE Genome-wide study of association and interaction with maternal
cytomegalovirus infection suggests new schizophrenia loci
JOURNAL Mol. Psychiatry (2013) In press
PUBMED 23358160
REMARK Publication Status: Available-Online prior to print
REFERENCE 2 (bases 1 to 3248)
AUTHORS van Hengel,J., Calore,M., Bauce,B., Dazzo,E., Mazzotti,E., De
Bortoli,M., Lorenzon,A., Li Mura,I.E., Beffagna,G., Rigato,I.,
Vleeschouwers,M., Tyberghein,K., Hulpiau,P., van Hamme,E.,
Zaglia,T., Corrado,D., Basso,C., Thiene,G., Daliento,L., Nava,A.,
van Roy,F. and Rampazzo,A.
TITLE Mutations in the area composita protein alphaT-catenin are
associated with arrhythmogenic right ventricular cardiomyopathy
JOURNAL Eur. Heart J. 34 (3), 201-210 (2013)
PUBMED 23136403
REMARK GeneRIF: Results suggest a causal relationship between CTNNA3
mutations and arrhythmogenic right ventricular cardiomyopathy
REFERENCE 3 (bases 1 to 3248)
AUTHORS Shaffer,J.R., Feingold,E., Wang,X., Lee,M., Tcuenco,K., Weeks,D.E.,
Weyant,R.J., Crout,R., McNeil,D.W. and Marazita,M.L.
TITLE GWAS of dental caries patterns in the permanent dentition
JOURNAL J. Dent. Res. 92 (1), 38-44 (2013)
PUBMED 23064961
REFERENCE 4 (bases 1 to 3248)
AUTHORS Bernstein,D.I., Kashon,M., Lummus,Z.L., Johnson,V.J., Fluharty,K.,
Gautrin,D., Malo,J.L., Cartier,A., Boulet,L.P., Sastre,J.,
Quirce,S., Germolec,D., Tarlo,S.M., Cruz,M.J., Munoz,X.,
Luster,M.I. and Yucesoy,B.
TITLE CTNNA3 (alpha-catenin) gene variants are associated with
diisocyanate asthma: a replication study in a Caucasian worker
population
JOURNAL Toxicol. Sci. 131 (1), 242-246 (2013)
PUBMED 22977168
REMARK GeneRIF: GWAS study of diisocyanate asthma demonstrates an
association between two closely linked CTNNA3 gene SNPs and
diisocyanate asthma.
REFERENCE 5 (bases 1 to 3248)
AUTHORS Comuzzie,A.G., Cole,S.A., Laston,S.L., Voruganti,V.S., Haack,K.,
Gibbs,R.A. and Butte,N.F.
TITLE Novel genetic loci identified for the pathophysiology of childhood
obesity in the Hispanic population
JOURNAL PLoS ONE 7 (12), E51954 (2012)
PUBMED 23251661
REFERENCE 6 (bases 1 to 3248)
AUTHORS Deloukas,P., Earthrowl,M.E., Grafham,D.V., Rubenfield,M.,
French,L., Steward,C.A., Sims,S.K., Jones,M.C., Searle,S.,
Scott,C., Howe,K., Hunt,S.E., Andrews,T.D., Gilbert,J.G.,
Swarbreck,D., Ashurst,J.L., Taylor,A., Battles,J., Bird,C.P.,
Ainscough,R., Almeida,J.P., Ashwell,R.I., Ambrose,K.D.,
Babbage,A.K., Bagguley,C.L., Bailey,J., Banerjee,R., Bates,K.,
Beasley,H., Bray-Allen,S., Brown,A.J., Brown,J.Y., Burford,D.C.,
Burrill,W., Burton,J., Cahill,P., Camire,D., Carter,N.P.,
Chapman,J.C., Clark,S.Y., Clarke,G., Clee,C.M., Clegg,S., Corby,N.,
Coulson,A., Dhami,P., Dutta,I., Dunn,M., Faulkner,L., Frankish,A.,
Frankland,J.A., Garner,P., Garnett,J., Gribble,S., Griffiths,C.,
Grocock,R., Gustafson,E., Hammond,S., Harley,J.L., Hart,E.,
Heath,P.D., Ho,T.P., Hopkins,B., Horne,J., Howden,P.J., Huckle,E.,
Hynds,C., Johnson,C., Johnson,D., Kana,A., Kay,M., Kimberley,A.M.,
Kershaw,J.K., Kokkinaki,M., Laird,G.K., Lawlor,S., Lee,H.M.,
Leongamornlert,D.A., Laird,G., Lloyd,C., Lloyd,D.M., Loveland,J.,
Lovell,J., McLaren,S., McLay,K.E., McMurray,A.,
Mashreghi-Mohammadi,M., Matthews,L., Milne,S., Nickerson,T.,
Nguyen,M., Overton-Larty,E., Palmer,S.A., Pearce,A.V., Peck,A.I.,
Pelan,S., Phillimore,B., Porter,K., Rice,C.M., Rogosin,A.,
Ross,M.T., Sarafidou,T., Sehra,H.K., Shownkeen,R., Skuce,C.D.,
Smith,M., Standring,L., Sycamore,N., Tester,J., Thorpe,A.,
Torcasso,W., Tracey,A., Tromans,A., Tsolas,J., Wall,M., Walsh,J.,
Wang,H., Weinstock,K., West,A.P., Willey,D.L., Whitehead,S.L.,
Wilming,L., Wray,P.W., Young,L., Chen,Y., Lovering,R.C.,
Moschonas,N.K., Siebert,R., Fechtel,K., Bentley,D., Durbin,R.,
Hubbard,T., Doucette-Stamm,L., Beck,S., Smith,D.R. and Rogers,J.
TITLE The DNA sequence and comparative analysis of human chromosome 10
JOURNAL Nature 429 (6990), 375-381 (2004)
PUBMED 15164054
REFERENCE 7 (bases 1 to 3248)
AUTHORS Busby,V., Goossens,S., Nowotny,P., Hamilton,G., Smemo,S.,
Harold,D., Turic,D., Jehu,L., Myers,A., Womick,M., Woo,D.,
Compton,D., Doil,L.M., Tacey,K.M., Lau,K.F., Al-Saraj,S.,
Killick,R., Pickering-Brown,S., Moore,P., Hollingworth,P.,
Archer,N., Foy,C., Walter,S., Lendon,C., Iwatsubo,T., Morris,J.C.,
Norton,J., Mann,D., Janssens,B., Hardy,J., O'Donovan,M., Jones,L.,
Williams,J., Holmans,P., Owen,M.J., Grupe,A., Powell,J., van
Hengel,J., Goate,A., Van Roy,F. and Lovestone,S.
TITLE Alpha-T-catenin is expressed in human brain and interacts with the
Wnt signaling pathway but is not responsible for linkage to
chromosome 10 in Alzheimer's disease
JOURNAL Neuromolecular Med. 5 (2), 133-146 (2004)
PUBMED 15075440
REMARK GeneRIF: We found no association between CTNNA3 and Alzheimer
disease in subjects showing linkage to chromosome 10, nor were
these SNPs associated with Abeta deposition in brain. CTNNA3 is
unlikely to account for the susceptibility locus on chromosome 10
REFERENCE 8 (bases 1 to 3248)
AUTHORS Ertekin-Taner,N., Ronald,J., Asahara,H., Younkin,L., Hella,M.,
Jain,S., Gnida,E., Younkin,S., Fadale,D., Ohyagi,Y., Singleton,A.,
Scanlin,L., de Andrade,M., Petersen,R., Graff-Radford,N., Hutton,M.
and Younkin,S.
TITLE Fine mapping of the alpha-T catenin gene to a quantitative trait
locus on chromosome 10 in late-onset Alzheimer's disease pedigrees
JOURNAL Hum. Mol. Genet. 12 (23), 3133-3143 (2003)
PUBMED 14559775
REMARK GeneRIF: Alpha-T catenin gene has variants which influence Abeta42
and contribute to the previously reported linkage for plasma
Abeta42 in late-onset Alzheimer's disease families.
REFERENCE 9 (bases 1 to 3248)
AUTHORS Janssens,B., Mohapatra,B., Vatta,M., Goossens,S., Vanpoucke,G.,
Kools,P., Montoye,T., van Hengel,J., Bowles,N.E., van Roy,F. and
Towbin,J.A.
TITLE Assessment of the CTNNA3 gene encoding human alpha T-catenin
regarding its involvement in dilated cardiomyopathy
JOURNAL Hum. Genet. 112 (3), 227-236 (2003)
PUBMED 12596047
REMARK GeneRIF: gene localized on chromosome 10q21 and is 1,776 kb in
length; mutation screening of all 18 exons of the CTNNA3 gene in a
family showing dilated cardiomyopathy (DCM)linkage to the 10q21-q23
locus, however, has not detected any DCM-linked CTNNA3 mutations
REFERENCE 10 (bases 1 to 3248)
AUTHORS Janssens,B., Goossens,S., Staes,K., Gilbert,B., van Hengel,J.,
Colpaert,C., Bruyneel,E., Mareel,M. and van Roy,F.
TITLE alphaT-catenin: a novel tissue-specific beta-catenin-binding
protein mediating strong cell-cell adhesion
JOURNAL J. Cell. Sci. 114 (PT 17), 3177-3188 (2001)
PUBMED 11590244
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AK313882.1, AF091606.1, BC065819.1 and AK289756.1.
On May 16, 2008 this sequence version replaced gi:7019570.
Transcript Variant: This variant (1) utilizes an alternate first
exon resulting in a distinct 5'UTR. Transcript variants 1 and 2
encode the same protein isoform.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK313882.1, AF091606.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025082, ERS025083 [ECO:0000350]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-22 AK313882.1 3-24
23-674 AF091606.1 1-652
675-1728 BC065819.1 571-1624
1729-3042 AF091606.1 1707-3020
3043-3248 AK289756.1 2932-3137
FEATURES Location/Qualifiers
source 1..3248
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="10"
/map="10q22.2"
gene 1..3248
/gene="CTNNA3"
/gene_synonym="VR22"
/note="catenin (cadherin-associated protein), alpha 3"
/db_xref="GeneID:29119"
/db_xref="HGNC:2511"
/db_xref="MIM:607667"
exon 1..192
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(27)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:200608088"
variation complement(67)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:184782437"
variation complement(145)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:80217385"
misc_feature 159..161
/gene="CTNNA3"
/gene_synonym="VR22"
/note="upstream in-frame stop codon"
exon 193..296
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
CDS 198..2885
/gene="CTNNA3"
/gene_synonym="VR22"
/note="alpha-catenin-like protein; alpha-T-catenin; alpha
T-catenin; cadherin-associated protein"
/codon_start=1
/product="catenin alpha-3"
/protein_id="NP_037398.2"
/db_xref="GI:188497716"
/db_xref="CCDS:CCDS7269.1"
/db_xref="GeneID:29119"
/db_xref="HGNC:2511"
/db_xref="MIM:607667"
/translation="
MSAETPITLNIDPQDLQVQTFTVEKLLEPLIIQVTTLVNCPQNPSSRKKGRSKRASVLLASVEEATWNLLDKGEKIAQEATVLKDELTASLEEVRKESEALKVSAERFTDDPCFLPKREAVVQAARALLAAVTRLLILADMIDVMCLLQHVSAFQRTFESLKNVANKSDLQKTYQKLGKELENLDYLAFKRQQDLKSPNQRDEIAGARASLKENSPLLHSICSACLEHSDVASLKASKDTVCEEIQNALNVISNASQGIQNMTTPPEPQAATLGSALDELENLIVLNPLTVTEEEIRPSLEKRLEAIISGAALLADSSCTRDLHRERIIAECNAIRQALQDLLSEYMNNAGKKERSNTLNIALDNMCKKTRDLRRQLRKAIIDHVSDSFLDTTVPLLVLIEAAKNGREKEIKEYAAIFHEHTSRLVEVANLACSMSTNEDGIKIVKIAANHLETLCPQIINAALALAARPKSQAVKNTMEMYKRTWENHIHVLTEAVDDITSIDDFLAVSESHILEDVNKCIIALRDQDADNLDRAAGAIRGRAARVAHIVTGEMDSYEPGAYTEGVMRNVNFLTSTVIPEFVTQVNVALEALSKSSLNVLDDNQFVDISKKIYDTIHDIRCSVMMIRTPEELEDVSDLEEEHEVRSHTSIQTEGKTDRAKMTQLPEAEKEKIAEQVADFKKVKSKLDAEIEIWDDTSNDIIVLAKNMCMIMMEMTDFTRGKGPLKHTTDVIYAAKMISESGSRMDVLARQIANQCPDPSCKQDLLAYLEQIKFYSHQLKICSQVKAEIQNLGGELIMSALDSVTSLIQAAKNLMNAVVQTVKMSYIASTKIIRIQSPAGPRHPVVMWRMKAPAKKPLIKREKPEETCAAVRRGSAKKKIHPLQVMSEFRGRQIY
"
misc_feature 249..2765
/gene="CTNNA3"
/gene_synonym="VR22"
/note="Vinculin family; Region: Vinculin; pfam01044"
/db_xref="CDD:110072"
misc_feature 2106..2108
/gene="CTNNA3"
/gene_synonym="VR22"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UI47.2); phosphorylation site"
variation complement(215)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:138580439"
variation complement(230)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:61735044"
variation complement(257)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:374611639"
variation complement(270)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:375607074"
exon 297..489
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(349)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:143725018"
variation complement(352)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:139105272"
variation complement(353)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:61759502"
variation complement(357)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:200409596"
variation complement(358)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:377158111"
variation complement(362)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:141527898"
variation complement(383)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:369638097"
variation complement(386)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:375304070"
variation complement(408)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:10997754"
variation complement(411)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:371997421"
variation complement(415)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:141436901"
variation complement(429)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:201306690"
exon 490..656
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(509)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:201480758"
variation complement(545)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:61749224"
variation complement(573)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:373661106"
variation complement(584)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:143943926"
variation complement(590)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:80182543"
variation complement(596)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:150376558"
variation complement(626)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:111880127"
variation complement(645)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:368622093"
variation complement(654)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:147116577"
exon 657..776
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(657)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:374067925"
variation complement(675)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:61749223"
variation complement(680)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:74142830"
variation complement(775)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:373233387"
exon 777..1040
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(799)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:372957321"
variation complement(802)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:138821753"
variation complement(820)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:369420715"
variation complement(833)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:200809148"
variation complement(841)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:146441824"
variation complement(846)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:374834298"
variation complement(851)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:371330302"
variation complement(915)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:367570454"
variation complement(939)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:192093851"
variation complement(943)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:146048212"
variation complement(946)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:372717475"
variation complement(957)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:368470427"
variation complement(965)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:140926333"
variation complement(976)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:190073606"
variation complement(991)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:151069922"
variation complement(993)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:199985402"
variation complement(1005)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:368027975"
variation complement(1016)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:146622691"
variation complement(1029)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:143693772"
exon 1041..1244
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(1063)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:375250429"
variation complement(1064)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:149090594"
variation complement(1067)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:369449859"
variation complement(1077)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:146475470"
variation complement(1087)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:201596778"
variation complement(1127)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:144152750"
variation complement(1142)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:375992799"
variation complement(1156)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:139460414"
variation complement(1164)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:113836576"
variation complement(1170)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:369024617"
variation complement(1179)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:374713975"
variation complement(1183)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:181929603"
variation complement(1184)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:372427902"
variation complement(1196)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:146754105"
variation complement(1200)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:370088870"
variation complement(1203)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:375721994"
variation complement(1204)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:372482202"
variation complement(1232)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:368211074"
variation complement(1233)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:143203517"
variation complement(1244)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:60262757"
exon 1245..1325
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(1252)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:141978685"
variation complement(1261)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:375610128"
variation complement(1294)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:201966934"
variation complement(1317)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:370981751"
exon 1326..1478
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(1329)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:187752783"
variation complement(1330)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:143682596"
variation complement(1351)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:149348606"
variation complement(1372)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:146777494"
variation complement(1373)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:138898184"
variation complement(1383)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:376091500"
variation complement(1389)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:145043626"
variation complement(1392)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:115276158"
variation complement(1395)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:374015031"
variation complement(1396)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:201896157"
variation complement(1416)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:138643733"
variation complement(1417)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:369880246"
variation complement(1428)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:372808360"
variation complement(1433)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:150167695"
variation complement(1460)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:140907744"
variation complement(1475)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:143981286"
exon 1479..1571
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(1500)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:377404952"
variation complement(1501)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:369650832"
exon 1572..1728
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(1587)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:367599520"
variation complement(1599)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:151007312"
variation complement(1618)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:201810511"
variation complement(1619)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:372258059"
variation complement(1643)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:76737066"
variation complement(1645)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:200282168"
variation complement(1647)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:200182913"
variation complement(1650)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:140913916"
variation complement(1669)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:201173778"
variation complement(1673)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:182681928"
variation complement(1686)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:368067642"
variation complement(1688)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:141098613"
variation complement(1704)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:147802834"
variation complement(1706)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:375080368"
exon 1729..1929
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(1736)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:377413642"
variation complement(1746)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:373151978"
variation complement(1755)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:144269113"
variation complement(1771)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:369650158"
variation complement(1784)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:74141466"
variation complement(1785)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:74141465"
variation complement(1800)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:41274090"
variation complement(1801)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:139378888"
variation complement(1808)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:146900023"
variation complement(1824)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:372758887"
variation complement(1825)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:369033938"
variation complement(1827)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:376250417"
variation complement(1837)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:374703865"
variation complement(1852)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:61737718"
variation complement(1854)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:371983729"
variation complement(1870)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:141429762"
variation complement(1872)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:367823042"
variation complement(1879)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:374844431"
variation complement(1886)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:370247825"
variation complement(1889)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:138798862"
variation complement(1897)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:146096912"
variation complement(1900)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:376984969"
variation complement(1918)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:375428912"
variation complement(1920)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:199940048"
exon 1930..2081
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(1932)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:375734372"
variation complement(1936)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:368000502"
variation complement(1984)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:4548513"
variation complement(1989)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:187527391"
variation complement(1997)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:137910578"
variation complement(2010)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:139661235"
variation complement(2020)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:138314889"
variation complement(2045)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:182490263"
variation complement(2047)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:190239785"
variation complement(2050)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:184992188"
variation complement(2062)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:367616357"
variation complement(2069)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:10997034"
variation complement(2079)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:149081490"
exon 2082..2174
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(2097)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:77165728"
variation complement(2124)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:141141746"
variation complement(2126)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:147760277"
variation complement(2130)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:370600208"
variation complement(2133)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:111425421"
variation complement(2134)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:370269225"
variation complement(2136)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:376927818"
variation complement(2165)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:200764970"
exon 2175..2356
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(2203)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:377166040"
variation complement(2238)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:142116698"
variation complement(2250)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:199697536"
variation complement(2263)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:150734357"
variation complement(2268)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:374172412"
variation complement(2294)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:142942346"
variation complement(2319)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:148554495"
variation complement(2339)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:115972723"
variation complement(2355)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:143867269"
exon 2357..2462
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(2369)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:116662854"
variation complement(2408)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:192848934"
variation complement(2438)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:113397208"
variation complement(2445)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:149211186"
variation complement(2446)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:367848292"
variation complement(2457)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:142752710"
exon 2463..2597
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(2466)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:373175781"
variation complement(2468)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:372746141"
variation complement(2480)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:372435356"
variation complement(2499)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:368637046"
variation complement(2519)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:374450104"
variation complement(2575)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:188248522"
variation complement(2577)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:145119798"
exon 2598..3248
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(2607)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:370688983"
variation complement(2611)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:200392000"
STS 2656..3162
/gene="CTNNA3"
/gene_synonym="VR22"
/standard_name="CTNNA3_4652"
/db_xref="UniSTS:462847"
variation complement(2691)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:376310020"
variation complement(2697)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:202196166"
variation complement(2698)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:373081692"
variation complement(2721)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:199852825"
variation complement(2747)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:138237676"
variation complement(2750)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:115814032"
variation complement(2770)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:41313840"
variation complement(2825)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:377740786"
variation complement(2826)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:374368635"
variation complement(2853)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:376134614"
variation complement(2893)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:190581449"
variation complement(2900)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:369681914"
variation complement(2984)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:371283856"
variation complement(3128)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:77424782"
variation complement(3140)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:185258162"
variation complement(3147)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:74442277"
variation complement(3193)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:192926725"
ORIGIN
tttctttcttatcctgggtgaacaacgctcagcgaaattgactgccccactgtcatctgcctctcaatttggtactctgtaactctgtgaccaccaagaagcctttttccgtcccccacaaagctctttttggaaaattccctacgggagctgaattttaagcccatttactttataggaagaaacagaaaggcagcatgtcagctgaaacaccaatcacattgaatatcgatcctcaggatctgcaggtccaaacattcaccgtggagaagctactggagcctctcataatccaggttaccacacttgtaaactgtccccagaacccttccagcaggaaaaaaggacgttcgaaaagagccagtgtccttctagcttctgtggaggaagcaacttggaatttattagacaagggagagaagattgcccaggaagctacagttttaaaggatgagcttacggcttcacttgaggaagttcgcaaagaaagtgaagctctgaaagtatcagctgagagatttacagatgacccctgttttctcccaaaaagggaggctgtggttcaagctgcccgtgccttgctggctgcggtgacgagactccttatccttgcggacatgattgatgtcatgtgcctcttgcaacatgtgtcagcttttcaaaggacatttgagtctctcaaaaatgttgccaacaaatctgacctccagaaaacctaccagaagcttgggaaggagctggaaaatttggattatttagccttcaaacgtcagcaggacttaaaatctccaaatcagagagatgaaattgcaggagcccgagcttcactgaaggagaactctcccctcttgcattcaatttgttcagcttgtttggagcattctgatgttgcttccctcaaagcaagcaaggacacagtttgtgaagaaattcagaatgctctcaatgtaatttcaaatgcttcacaagggatccagaatatgacaaccccaccagaacctcaggcagcaaccctgggaagtgcccttgatgagctggagaatttaattgtcctgaatccactcacagtaactgaggaggaaatacgaccatcactagagaaacgccttgaagccattatcagtggggctgctctgctggcggattcttcatgtacgagggacttacaccgagagcggattatcgcagaatgcaacgccattcgccaggctcttcaggatctgctttcagagtacatgaacaacgctggaaaaaaagaaaggagtaataccctgaatattgctttagacaacatgtgtaagaagacaagagaccttcgcagacagctccgcaaggctattatagatcatgtgtcagactctttcctggatacgacagtccctcttttggttctcattgaagctgctaagaatggccgggaaaaggaaataaaagaatatgctgcgatatttcatgaacacaccagcaggcttgtagaggtggcaaatcttgcttgttccatgtcaacaaatgaagatggaattaaaattgtcaaaattgcagccaatcatttggaaaccttgtgtccacagattattaatgctgcacttgctttggctgcaagacccaaaagtcaagcggtcaaaaacaccatggaaatgtacaagcgtacatgggagaatcatatacatgtcctcactgaagccgtagatgacattacaagcattgatgacttccttgctgtatctgaaagccatatcttggaagatgtcaacaagtgtatcatagccttaagagaccaggatgctgataatttagaccgtgctgcgggtgctatcagaggccgggcagcaagagttgctcacatcgtcacgggtgaaatggacagttacgagccaggggcttacacggaaggtgtaatgagaaatgttaacttccttacaagtactgtaattcctgaatttgtaacacaagtgaatgttgccttggaagccttaagcaaaagctcattgaatgtgttggatgataatcaatttgtggacatctcaaagaagatctatgatacaattcatgatatcagatgttcagtcatgatgattcggaccccagaggaactggaggatgtttctgaccttgaagaggaacacgaggtccgcagtcacaccagcattcagaccgaagggaaaactgatagggctaagatgactcaactgcctgaggcagaaaaagaaaagattgctgagcaagttgctgatttcaagaaagtaaagagtaagctggatgctgagattgagatatgggatgatacaagcaacgacatcattgttctggccaagaacatgtgtatgatcatgatggagatgacagacttcactaggggcaaaggaccactaaagcatacaactgatgtgatctatgcagcgaaaatgatatcagaatcaggatcaaggatggatgtccttgctcggcagattgctaatcagtgcccagatccatcttgtaaacaggacttgttggcctacctggaacagattaagttctactcccaccaactgaaaatctgcagtcaagttaaagctgagatccagaacctgggaggagagctcatcatgtcagctttggacagtgtcacatccctgatccaagcagccaaaaatttaatgaatgctgtagtgcaaacagtgaaaatgtcttacattgcctcaaccaagatcatccgaatccagagtcctgctgggccccggcacccagttgtgatgtggagaatgaaggctcctgcaaaaaaacccttgattaaaagagagaagccagaggaaacgtgtgcagctgtcagacgaggctcagcaaagaaaaaaatccatccattgcaagtcatgagtgaatttagaggaagacaaatctactgaaaccactattctacatatagtgcctatatgacaaaatcctgcctaaccacactgctttattttacacttaagaagttctgtaatttcactaagttttggtgtttaactcacaaataacataaaatattgggcgctaaatcaacaaaagcaatatatatttgggatcatatcactgtcatttctgtatggtcagcacctaatagttaaggaatatttgcttgttgaatgaatgaaattatcacgtgtcattcagcgtttcccatcatagagattatctactattcgttaccaaataaacacaggagaggccagagagtcctgtttatctgtaatacttcatgtacacttatcatccttatcttg
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:29119 -> Molecular function: GO:0005198 [structural molecule activity] evidence: IEA
GeneID:29119 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:29119 -> Molecular function: GO:0045296 [cadherin binding] evidence: TAS
GeneID:29119 -> Biological process: GO:0016337 [cell-cell adhesion] evidence: IPI
GeneID:29119 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
GeneID:29119 -> Cellular component: GO:0005916 [fascia adherens] evidence: IDA
GeneID:29119 -> Cellular component: GO:0015629 [actin cytoskeleton] evidence: IEA
GeneID:29119 -> Cellular component: GO:0030027 [lamellipodium] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.