Home |
Help |
Advanced search
2025-05-09 16:54:43, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_007113 6995 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens trichohyalin (TCHH), mRNA.
ACCESSION NM_007113
VERSION NM_007113.3 GI:444909136
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 6995)
AUTHORS Leung,M.C., Sutton,C.W., Fenton,D.A. and Tobin,D.J.
TITLE Trichohyalin is a potential major autoantigen in human alopecia
areata
JOURNAL J. Proteome Res. 9 (10), 5153-5163 (2010)
PUBMED 20722389
REMARK GeneRIF: Data suggest that an immune response to trichohyalin and
K16 may have a role in the pathogenesis of the enigmatic disorder.
REFERENCE 2 (bases 1 to 6995)
AUTHORS Eriksson,N., Macpherson,J.M., Tung,J.Y., Hon,L.S., Naughton,B.,
Saxonov,S., Avey,L., Wojcicki,A., Pe'er,I. and Mountain,J.
TITLE Web-based, participant-driven studies yield novel genetic
associations for common traits
JOURNAL PLoS Genet. 6 (6), E1000993 (2010)
PUBMED 20585627
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 6995)
AUTHORS Medland,S.E., Nyholt,D.R., Painter,J.N., McEvoy,B.P., McRae,A.F.,
Zhu,G., Gordon,S.D., Ferreira,M.A., Wright,M.J., Henders,A.K.,
Campbell,M.J., Duffy,D.L., Hansell,N.K., Macgregor,S.,
Slutske,W.S., Heath,A.C., Montgomery,G.W. and Martin,N.G.
TITLE Common variants in the trichohyalin gene are associated with
straight hair in Europeans
JOURNAL Am. J. Hum. Genet. 85 (5), 750-755 (2009)
PUBMED 19896111
REMARK GeneRIF: Common variants in the TCHH gene are associated with
straight hair in Europeans.
GeneRIF: Observational study and genome-wide association study of
gene-disease association. (HuGE Navigator)
REFERENCE 4 (bases 1 to 6995)
AUTHORS Yamamoto,S., Hirai,K., Hasegawa-Oka,Y. and Hirai,Y.
TITLE Molecular elements of the regulatory control of keratin filament
modulator AHF/trichohyalin in the hair follicle
JOURNAL Exp. Dermatol. 18 (2), 152-159 (2009)
PUBMED 18643848
REMARK GeneRIF: In human keratinocytes, we found BMP-4 facilitates
trichohyalin (THH) transcription, and lamin C plays a key role in
the posttranslational stabilization of THH.
GeneRIF: BMP-4 signalling activates AHF transcription in hair
follicles.
REFERENCE 5 (bases 1 to 6995)
AUTHORS Steinert,P.M., Parry,D.A. and Marekov,L.N.
TITLE Trichohyalin mechanically strengthens the hair follicle: multiple
cross-bridging roles in the inner root shealth
JOURNAL J. Biol. Chem. 278 (42), 41409-41419 (2003)
PUBMED 12853460
REFERENCE 6 (bases 1 to 6995)
AUTHORS O'Keefe,E.J., Hamilton,E.H., Lee,S.C. and Steinert,P.
TITLE Trichohyalin: a structural protein of hair, tongue, nail, and
epidermis
JOURNAL J. Invest. Dermatol. 101 (1 SUPPL), 65S-71S (1993)
PUBMED 7686953
REFERENCE 7 (bases 1 to 6995)
AUTHORS Lee,S.C., Kim,I.G., Marekov,L.N., O'Keefe,E.J., Parry,D.A. and
Steinert,P.M.
TITLE The structure of human trichohyalin. Potential multiple roles as a
functional EF-hand-like calcium-binding protein, a cornified cell
envelope precursor, and an intermediate filament-associated
(cross-linking) protein
JOURNAL J. Biol. Chem. 268 (16), 12164-12176 (1993)
PUBMED 7685034
REFERENCE 8 (bases 1 to 6995)
AUTHORS Lee,S.C., Wang,M., McBride,O.W., O'Keefe,E.J., Kim,I.G. and
Steinert,P.M.
TITLE Human trichohyalin gene is clustered with the genes for other
epidermal structural proteins and calcium-binding proteins at
chromosomal locus 1q21
JOURNAL J. Invest. Dermatol. 100 (1), 65-68 (1993)
PUBMED 8423399
REFERENCE 9 (bases 1 to 6995)
AUTHORS Fietz,M.J., Rogers,G.E., Eyre,H.J., Baker,E., Callen,D.F. and
Sutherland,G.R.
TITLE Mapping of the trichohyalin gene: co-localization with the
profilaggrin, involucrin, and loricrin genes
JOURNAL J. Invest. Dermatol. 99 (5), 542-544 (1992)
PUBMED 1431214
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AL589986.15.
On Feb 2, 2013 this sequence version replaced gi:148746194.
Summary: Trichohyalin confers mechanical strength to the hair
follicle inner root sheath and to other toughened epithelial
tissues, such as the hard palate and filiform ridges of the tongue,
by forming multiple complex crosslinks with itself and with other
structural proteins (Steinert et al., 2003 [PubMed
12853460]).[supplied by OMIM, Dec 2009].
Sequence Note: The RefSeq transcript and protein were derived from
genomic sequence to make the sequence consistent with the reference
genome assembly. The genomic coordinates used for the transcript
record were based on alignments.
##Evidence-Data-START##
RNAseq introns :: mixed/partial sample support ERS025088, ERS025098
[ECO:0000350]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-64 AL589986.15 19649-19712 c
65-233 AL589986.15 18201-18369 c
234-6995 AL589986.15 10575-17336 c
FEATURES Location/Qualifiers
source 1..6995
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1q21.3"
gene 1..6995
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/note="trichohyalin"
/db_xref="GeneID:7062"
/db_xref="HGNC:11791"
/db_xref="MIM:190370"
exon 1..64
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/inference="alignment:Splign:1.39.8"
exon 65..233
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/inference="alignment:Splign:1.39.8"
misc_feature 78..80
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/note="upstream in-frame stop codon"
CDS 96..5927
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/codon_start=1
/product="trichohyalin"
/protein_id="NP_009044.2"
/db_xref="GI:148746195"
/db_xref="CCDS:CCDS41396.1"
/db_xref="GeneID:7062"
/db_xref="HGNC:11791"
/db_xref="MIM:190370"
/translation="
MSPLLRSICDITEIFNQYVSHDCDGAALTKKDLKNLLEREFGAVLRRPHDPKTVDLILELLDLDSNGRVDFNEFLLFIFKVAQACYYALGQATGLDEEKRARCDGKESLLQDRRQEEDQRRFEPRDRQLEEEPGQRRRQKRQEQERELAEGEEQSEKQERLEQRDRQRRDEELWRQRQEWQEREERRAEEEQLQSCKGHETEEFPDEEQLRRRELLELRRKGREEKQQQRRERQDRVFQEEEEKEWRKRETVLRKEEEKLQEEEPQRQRELQEEEEQLRKLERQELRRERQEEEQQQQRLRREQQLRRKQEEERREQQEERREQQERREQQEERREQQLRREQEERREQQLRREQEEERREQQLRREQEEERREQQLRREQQLRREQQLRREQQLRREQQLRREQQLRREQQLRREQQLRREQQLRREQEEERHEQKHEQERREQRLKREQEERRDWLKREEETERHEQERRKQQLKRDQEEERRERWLKLEEEERREQQERREQQLRREQEERREQRLKRQEEEERLQQRLRSEQQLRREQEERREQLLKREEEKRLEQERREQRLKREQEERRDQLLKREEERRQQRLKREQEERLEQRLKREEVERLEQEERREQRLKREEPEEERRQQLLKSEEQEERRQQQLRREQQERREQRLKREEEEERLEQRLKREHEEERREQELAEEEQEQARERIKSRIPKWQWQLESEADARQSKVYSRPRKQEGQRRRQEQEEKRRRRESELQWQEEERAHRQQQEEEQRRDFTWQWQAEEKSERGRQRLSARPPLREQRERQLRAEERQQREQRFLPEEEEKEQRRRQRREREKELQFLEEEEQLQRRERAQQLQEEEDGLQEDQERRRSQEQRRDQKWRWQLEEERKRRRHTLYAKPALQEQLRKEQQLLQEEEEELQREEREKRRRQEQERQYREEEQLQQEEEQLLREEREKRRRQERERQYRKDKKLQQKEEQLLGEEPEKRRRQEREKKYREEEELQQEEEQLLREEREKRRRQEWERQYRKKDELQQEEEQLLREEREKRRLQERERQYREEEELQQEEEQLLGEERETRRRQELERQYRKEEELQQEEEQLLREEPEKRRRQERERQCREEEELQQEEEQLLREEREKRRRQELERQYREEEEVQQEEEQLLREEPEKRRRQELERQYREEEELQQEEEQLLREEQEKRRQERERQYREEEELQRQKRKQRYRDEDQRSDLKWQWEPEKENAVRDNKVYCKGRENEQFRQLEDSQLRDRQSQQDLQHLLGEQQERDREQERRRWQQRDRHFPEEEQLEREEQKEAKRRDRKSQEEKQLLREEREEKRRRQETDRKFREEEQLLQEREEQPLRRQERDRKFREEELRHQEQGRKFLEEEQRLRRQERERKFLKEEQQLRCQEREQQLRQDRDRKFREEEQQLSRQERDRKFREEEQQVRRQERERKFLEEEQQLRQERHRKFREEEQLLQEREEQQLHRQERDRKFLEEEQQLRRQERDRKFREQELRSQEPERKFLEEEQQLHRQQRQRKFLQEEQQLRRQERGQQRRQDRDRKFREEEQLRQEREEQQLSRQERDRKFRLEEQKVRRQEQERKFMEDEQQLRRQEGQQQLRQERDRKFREDEQLLQEREEQQLHRQERDRKFLEEEPQLRRQEREQQLRHDRDRKFREEEQLLQEGEEQQLRRQERDRKFREEEQQLRRQERERKFLQEEQQLRRQELERKFREEEQLRQETEQEQLRRQERYRKILEEEQLRPEREEQQLRRQERDRKFREEEQLRQEREEQQLRSQESDRKFREEEQLRQEREEQQLRPQQRDGKYRWEEEQLQLEEQEQRLRQERDRQYRAEEQFATQEKSRREEQELWQEEEQKRRQERERKLREEHIRRQQKEEQRHRQVGEIKSQEGKGHGRLLEPGTHQFASVPVRSSPLYEYIQEQRSQYRP
"
misc_feature 96..368
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07283.2);
Region: S-100-like"
misc_feature 99..362
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/note="S-100: S-100 domain, which represents the largest
family within the superfamily of proteins carrying the
Ca-binding EF-hand motif. Note that this S-100 hierarchy
contains only S-100 EF-hand domains, other EF-hands have
been modeled separately. S100...; Region: S-100; cd00213"
/db_xref="CDD:88292"
misc_feature order(99..152,168..176,201..206,210..218,300..311,
315..320,324..335,339..362)
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/note="dimerization interface [polypeptide binding]; other
site"
/db_xref="CDD:88292"
misc_feature order(150..152,165..167,174..176,189..194,279..281,
285..287,291..293,297..299,303..305,312..314)
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:88292"
misc_feature 156..329
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/note="EF-hand domain pair; Region: EF_hand_5; pfam13499"
/db_xref="CDD:205677"
misc_feature 846..848
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1035..1226
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07283.2);
Region: 5 X 13 AA tandem repeats of
R-R-E-Q-E-E-E-R-R-E-Q-Q-L"
misc_feature 1227..1370
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07283.2);
Region: 8 X 6 AA tandem repeats of R-R-E-Q-Q-L"
misc_feature 1368..2144
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07283.2);
Region: 9 X 28 AA approximate tandem repeats"
misc_feature 2811..3707
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07283.2);
Region: 10 X 30 AA tandem repeats"
misc_feature 3969..5777
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q07283.2);
Region: 23 X 26 AA approximate tandem repeats"
exon 234..6995
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/inference="alignment:Splign:1.39.8"
variation 283
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/replace="g"
/replace="t"
/db_xref="dbSNP:2515663"
variation 804
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/replace="c"
/replace="g"
/db_xref="dbSNP:3134814"
variation 2027..2028
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/replace="c"
/replace="g"
/db_xref="dbSNP:3020643"
variation 2036
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/replace="a"
/replace="g"
/db_xref="dbSNP:2515664"
variation 2555..2556
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/replace="c"
/replace="g"
/db_xref="dbSNP:2515665"
variation 5440..5441
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/replace="a"
/replace="g"
/db_xref="dbSNP:2515667"
variation 5628
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/replace="g"
/replace="t"
/db_xref="dbSNP:201647177"
variation 5799
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/replace="a"
/replace="c"
/db_xref="dbSNP:1131471"
variation 5965
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/replace="c"
/replace="g"
/db_xref="dbSNP:1131473"
STS 6159..6496
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/standard_name="D1S2399"
/db_xref="UniSTS:19448"
variation 6474
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/replace="g"
/replace="t"
/db_xref="dbSNP:9050"
STS 6815..6897
/gene="TCHH"
/gene_synonym="THH; THL; TRHY"
/standard_name="RH69475"
/db_xref="UniSTS:6245"
ORIGIN
gttacccagtacacttgcctgtggtgtcagcaagcactgtcgacttcttcctctggtgaagtgggtttacttgaacttgaaggaaagaaaaaaaaatgtctccacttctgagaagcatctgtgacatcactgaaattttcaatcagtatgtctctcatgattgtgatggagcagcattaactaagaaagacctgaagaacctccttgaaagggaatttggagctgtgcttcggagaccacatgaccctaagacggtagatctgatcctggaacttctggatcttgacagtaatgggcgtgtcgatttcaacgaattcctcctatttattttcaaagtggctcaagcttgttactatgctctcggccaggccacgggactggatgaggagaagcgagcccggtgtgacggaaaggagagcctgttacaagatcgcaggcaagaagaagaccaaaggagattcgagccccgggacagacaactggaagaagaacctgggcaacgacgcaggcagaagaggcaggaacaggagagggagctagctgagggagaggagcaaagtgagaaacaagagcgacttgaacagcgcgacaggcagcgccgcgacgaggagctgtggcggcaaaggcaagaatggcaagaacgggaagagcgccgtgcagaggaagagcagctgcagagttgcaaaggtcacgaaactgaggagtttccagacgaagagcaactgcgaaggcgggagctgctggagctgaggaggaagggccgcgaggagaaacagcagcaaaggcgagagcggcaagacagagtgttccaggaggaagaagagaaagagtggaggaagcgcgagacagtgctccggaaggaagaagagaagttgcaggaagaggagccgcagcggcaaagagagctccaggaggaagaagagcagctacggaagctggagcggcaagagctgaggagggagcgccaggaggaagagcagcagcagcaaaggctgaggcgcgagcagcaactaaggcgcaagcaggaggaggagaggcgcgagcagcaggaggagaggcgcgagcagcaggagaggcgcgagcagcaggaggagaggcgcgagcagcagctgaggcgcgagcaggaggagaggcgcgagcagcagctgaggcgcgagcaggaggaggagaggcgcgagcagcagctgaggcgcgagcaggaggaggagaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcaggaggaggagaggcacgagcagaagcacgagcaggagaggcgcgagcagcggctgaagcgcgagcaggaggagaggcgcgattggctgaagcgcgaggaggagacggagaggcacgagcaggagaggcgcaagcagcagctgaagcgcgaccaggaggaggagaggcgcgaacgttggctgaagctcgaggaggaggagaggcgcgagcagcaggagaggcgcgagcagcaactaaggcgggagcaagaggagaggcgcgagcagcggctgaagcgccaggaggaggaagagaggctccagcagcggttgaggagcgagcaacaactaagacgcgagcaggaggagaggcgcgagcagctgctgaagcgcgaggaggagaagaggctcgagcaggagaggcgagagcagcggctgaagcgcgagcaggaggagaggcgcgatcagctgctgaagcgcgaggaggagaggcgccagcagcggctgaagcgcgagcaggaagagaggctcgagcagcgactgaagcgcgaggaggtggagagactcgagcaggaggagaggcgcgagcagcggctgaagcgcgaggagccggaggaagagaggcgccagcagctgctgaagagcgaggagcaggaggagaggcgccagcagcaactaaggcgcgagcagcaggaaaggcgcgagcagcggctgaagcgcgaggaggaggaagagaggctcgagcagcggctgaagcgcgagcatgaggaagagaggcgcgagcaggagctagctgaggaggagcaggaacaggcccgggagcggattaagagccgcatcccgaagtggcagtggcagctagaaagcgaggccgacgcacggcaaagcaaagtctactcgaggccccgcaagcaggaagggcagaggcgccgccaagagcaggaggaaaagaggcggcgccgggagagtgagctgcaatggcaggaggaggaacgggctcaccggcagcagcaggaagaggagcagcgccgggacttcacatggcagtggcaggcggaggaaaagagcgagaggggccgtcagaggctgtcggccaggcccccattgcgggagcagcgggagaggcagctgagggccgaggagcgccagcagcgggaacaacggtttctcccggaggaggaggagaaggagcagcggcgccgccagcgacgcgagagggagaaagagctgcagttcctggaggaagaggagcagctccagcggcgggagcgtgcccaacagctccaggaggaggaggacggcctccaggaggatcaggagaggaggcgaagccaggagcagcgccgcgaccaaaaatggaggtggcaactagaagaagaaaggaagagacgccgccacacgctgtacgccaagccagccctacaagagcagctgaggaaggaacagcagctgctgcaggaggaggaggaggagctacagagagaggagcgcgagaagagaaggcgccaagaacaggagagacaataccgcgaggaagagcagctgcagcaggaggaagagcagctgctgagagaggaacgggagaaaagaagacgccaggagcgggaaaggcaatatcggaaggataagaagctgcagcagaaggaagagcagctgctgggagaggaaccggagaagagaaggcgccaggagcgggagaaaaaataccgcgaggaagaggagttgcagcaggaggaagagcagctgctgagagaggaacgggagaagagaaggcgccaggagtgggagaggcagtaccgcaaaaaagacgagctgcagcaggaagaagagcagctgctgagagaggaacgggagaaaagaagactccaggagcgggagaggcaatatcgggaggaagaggagctgcagcaggaggaagagcagctgctgggagaggaacgggagacgagaaggcgccaggagctggagaggcaatatcggaaggaagaggagctgcagcaggaggaagagcagctgctgagagaggaaccggagaagagaaggcgccaggagcgggagaggcaatgtcgggaggaagaggagctgcagcaggaggaagagcagctgctgagagaggaacgggagaagagaaggcgccaggagctggagaggcaatatcgggaggaagaggaggtgcagcaggaggaagagcagctgctgagagaggaaccggagaagagaaggcgccaggagctggagaggcaataccgcgaggaagaggagctgcagcaggaggaagagcagctgctgagagaggaacaggagaaaaggcgccaggagcgggagaggcagtatcgggaggaggaagagcttcagcgccagaaaaggaagcagcgataccgggatgaggatcagcgcagtgatctgaaatggcagtgggaaccagaaaaagaaaatgcagttcgtgataacaaggtttactgcaaaggcagagagaatgaacagttccggcagttggaagattcccagctgcgcgacagacaatcccagcaagatctgcagcacctgctgggtgaacagcaagagcgagatcgtgagcaagagaggaggcgctggcagcagcgcgacaggcatttcccagaggaagaacagctggagcgagaagagcaaaaggaagccaaaaggcgcgacaggaagtcccaagaggaaaagcagttgctgagagaggaaagagaagagaagagacgccgtcaagagacagacagaaaattccgcgaggaggaacagctgctccaggaaagggaggaacagccgctgcgccgccaagagcgtgacagaaaattccgcgaagaggaactgcgccatcaggaacaagggagaaaattcctcgaggaggaacagcggctgcgccgccaggaacgggagagaaaattccttaaggaggaacagcagctgcgctgccaggagcgcgagcaacagctgcgtcaggaccgcgacagaaaattccgcgaggaggaacagcagctgagccgccaagagcgtgacagaaaattccgtgaagaggaacagcaggtgcgccgccaggaacgagagagaaaattcctggaggaggaacagcagctgcgccaggagcgtcacagaaaattccgcgaagaggaacagctgctccaggaaagggaagaacagcagctgcaccgccaagagcgtgacagaaaattcctggaggaggaacaacagctgcgccgccaagagcgtgacagaaaattccgcgaacaggaactgcgcagtcaggaaccagagagaaaattcctcgaggaggaacagcagctgcaccgccagcaacggcagagaaaattcctccaggaggaacagcagctgcgccgccaggagcgcgggcaacagcggcgtcaggaccgtgacagaaaattccgcgaggaggaacagctgcgccaggagagggaggaacagcagctgagccgccaagagcgtgacagaaaattccgtttagaggaacagaaagtgcgccgccaggaacaagagagaaaattcatggaggacgaacagcagctgcgccgccaggagggccaacaacagctgcgccaggagcgcgacagaaaattccgcgaagacgaacagctgctccaggaaagggaagaacagcagctgcaccgccaagagcgtgacagaaaattcctcgaggaggaaccgcagctgcgccgccaggagcgcgaacaacagctgcgtcacgaccgcgacagaaaattccgtgaagaggaacagctgctccaggaaggggaggaacagcagctgcgccgccaagagcgtgacagaaaattccgcgaagaggaacagcagctccgccgtcaggaacgagagagaaaattcctccaggaggaacagcagctgcgccgccaggaactggagagaaaattccgtgaggaggaacagctgcgccaagaaacggagcaagagcagctgcgccgccaagaacgctacagaaaaatcctagaggaagagcagctccgtccggaaagggaagaacagcagctgcgccgccaggagcgcgacagaaaattccgcgaggaggaacagctccgccaggagagggaggaacagcagctgcgcagccaagagtctgacagaaaattccgcgaggaggaacagctacgccaggagagggaagaacagcagctgcgcccccaacagcgtgacggaaagtatcgctgggaagaagagcagctccaacttgaggaacaagagcagaggctgcggcaggagcgagaccggcagtaccgggcggaggagcagtttgccacgcaggagaagagtcgtcgtgaggaacaagaactatggcaagaagaggagcagaaacgtcgccaggaacgggaaaggaaattacgggaagaacacatccgccgccagcagaaggaggaacagaggcaccgccaagtcggggagataaaatcccaagaagggaagggccatgggcggcttctggagcccggcactcatcagtttgccagtgtcccagtgcgctccagccctctctatgagtacatccaagagcagagatctcaataccgcccttaagtgatgttgccaatatcttgacacctgccaaagcttcgagcacgggaaaatgagaaacactgggtaccaagtgataactcagatgtttctggttgtgggaaaactctctgatattagaatgtcttttcttccaaaatcttaaactacgctcattttacgcactttgtacttctgctttttattcttcctcaagtagttctttactgcaagatgtctttcttttgctctttgatgcagatgtggtgtgcatttaaaaaaaatataaatcatttaatttgtttaagaaattttgtttgaggaacatgttcatttattgctttcagaagtaacaagagtaataggatgatttgagattctaaacaatgggtcggtttgtttaatgactgacccatcttgtggaaagtgcagatacttttaatgttcaagttgctatttcttcttgaacctaaattgatcattgcctccaaacagcatttcatcttttgtggcatagttagcacaaattccaggtaactaaatttttataacccttgaatagtgcagggggagtgacctctgcataaaaacttcctgtaaaatcagcccattactggaagaaatatctgttaagaataggtttagctttgaagatttagaatttaaattagattttttttaaactcaactccacttaaacacataatctcatgaagaaataatgaggtgtttctcaacttcagagttcaaattttaaaactgtgtctgttgtagtctatagtgttcattctacttccccaagttttgatgagtttcagaatattatgaacctttgttaattttagcttgttagaaggaagctgctcagaatcccataaacatctgtcttactctagggccaataagagatcacatagagcatgttgggggtgtaaaagggaaaaatgtgtgaacataggggcaaatttctagaggccctttgacaagacccatttgcccacaatcatttgaggcctattgataataccttagatatattcttgttgaaataattggactgtgaaaaattaataataaatgtttggcaagtaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:7062 -> Molecular function: GO:0005509 [calcium ion binding] evidence: TAS
GeneID:7062 -> Biological process: GO:0008150 [biological_process] evidence: ND
GeneID:7062 -> Biological process: GO:0031424 [keratinization] evidence: IEA
GeneID:7062 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:7062 -> Cellular component: GO:0005813 [centrosome] evidence: IDA
GeneID:7062 -> Cellular component: GO:0005856 [cytoskeleton] evidence: NAS
GeneID:7062 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:7062 -> Cellular component: GO:0045111 [intermediate filament cytoskeleton] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.