Home |
Help |
Advanced search
2025-05-09 16:14:52, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_005246 2950 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens fer (fps/fes related) tyrosine kinase (FER), mRNA.
ACCESSION NM_005246
VERSION NM_005246.2 GI:119964720
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2950)
AUTHORS Yoneyama,T., Angata,K., Bao,X., Courtneidge,S., Chanda,S.K. and
Fukuda,M.
TITLE Fer kinase regulates cell migration through alpha-dystroglycan
glycosylation
JOURNAL Mol. Biol. Cell 23 (5), 771-780 (2012)
PUBMED 22238358
REMARK GeneRIF: Fer, a non-receptor-type tyrosine kinase, plays a critical
role in synthesis of the laminin-binding glycans on alpha-DG.
REFERENCE 2 (bases 1 to 2950)
AUTHORS Makovski,A., Yaffe,E., Shpungin,S. and Nir,U.
TITLE Intronic promoter drives the BORIS-regulated expression of FerT in
colon carcinoma cells
JOURNAL J. Biol. Chem. 287 (9), 6100-6112 (2012)
PUBMED 22223638
REMARK GeneRIF: Transcription of the ferT gene in CC cells was found to be
driven by an intronic promoter residing in intron 10 of the fer
gene and to be regulated by the Brother of the Regulator of
Imprinted Sites (BORIS) transcription factor.
REFERENCE 3 (bases 1 to 2950)
AUTHORS Qi,L., Menzaghi,C., Salvemini,L., De Bonis,C., Trischitta,V. and
Hu,F.B.
TITLE Novel locus FER is associated with serum HMW adiponectin levels
JOURNAL Diabetes 60 (8), 2197-2201 (2011)
PUBMED 21700879
REMARK GeneRIF: The A allele of SNP rs10447248 in the FER locus was
nominally associated with lower MMW (P = 0.016) but was not
associated with LMW (P > 0.05) adiponectin levels
REFERENCE 4 (bases 1 to 2950)
AUTHORS Guo,C. and Stark,G.R.
TITLE FER tyrosine kinase (FER) overexpression mediates resistance to
quinacrine through EGF-dependent activation of NF-kappaB
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 108 (19), 7968-7973 (2011)
PUBMED 21518868
REMARK GeneRIF: Overexpression of FER from a cDNA confers quinacrine
resistance to several different types of cancer cell lines.
REFERENCE 5 (bases 1 to 2950)
AUTHORS Fei,F., Kweon,S.M., Haataja,L., De Sepulveda,P., Groffen,J. and
Heisterkamp,N.
TITLE The Fer tyrosine kinase regulates interactions of Rho
GDP-Dissociation Inhibitor alpha with the small GTPase Rac
JOURNAL BMC Biochem. 11, 48 (2010)
PUBMED 21122136
REMARK GeneRIF: tyrosine phosphorylation of RhoGDIalpha by Fer as a
mechanism to regulate binding of RhoGDIalpha to Rac
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 2950)
AUTHORS Warrington,J.A., Hall,L.V., Hinton,L.M., Miller,J.N., Wasmuth,J.J.
and Lovett,M.
TITLE Radiation hybrid map of 13 loci on the long arm of chromosome 5
JOURNAL Genomics 11 (3), 701-708 (1991)
PUBMED 1663488
REMARK Erratum:[Genomics 1992 Nov;14(3):832]
REFERENCE 7 (bases 1 to 2950)
AUTHORS Nishisho,I., Nakamura,Y., Miyoshi,Y., Miki,Y., Ando,H., Horii,A.,
Koyama,K., Utsunomiya,J., Baba,S. and Hedge,P.
TITLE Mutations of chromosome 5q21 genes in FAP and colorectal cancer
patients
JOURNAL Science 253 (5020), 665-669 (1991)
PUBMED 1651563
REFERENCE 8 (bases 1 to 2950)
AUTHORS Hao,Q.L., Ferris,D.K., White,G., Heisterkamp,N. and Groffen,J.
TITLE Nuclear and cytoplasmic location of the FER tyrosine kinase
JOURNAL Mol. Cell. Biol. 11 (2), 1180-1183 (1991)
PUBMED 1990274
REFERENCE 9 (bases 1 to 2950)
AUTHORS Krolewski,J.J., Lee,R., Eddy,R., Shows,T.B. and Dalla-Favera,R.
TITLE Identification and chromosomal mapping of new human tyrosine kinase
genes
JOURNAL Oncogene 5 (3), 277-282 (1990)
PUBMED 2156206
REFERENCE 10 (bases 1 to 2950)
AUTHORS Morris,C., Heisterkamp,N., Hao,Q.L., Testa,J.R. and Groffen,J.
TITLE The human tyrosine kinase gene (FER) maps to chromosome 5 and is
deleted in myeloid leukemias with a del(5q)
JOURNAL Cytogenet. Cell Genet. 53 (4), 196-200 (1990)
PUBMED 2209086
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from J03358.1 and BC017060.1.
This sequence is a reference standard in the RefSeqGene project.
On Dec 27, 2006 this sequence version replaced gi:4885230.
Summary: Fer protein is a member of the FPS/FES family of
nontransmembrane receptor tyrosine kinases. It regulates cell-cell
adhesion and mediates signaling from the cell surface to the
cytoskeleton via growth factor receptors. [provided by RefSeq, Jul
2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: J03358.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025098 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-1698 J03358.1 1-1698
1699-1713 BC017060.1 1381-1395
1714-2950 J03358.1 1714-2950
FEATURES Location/Qualifiers
source 1..2950
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="5"
/map="5q21"
gene 1..2950
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/note="fer (fps/fes related) tyrosine kinase"
/db_xref="GeneID:2241"
/db_xref="HGNC:3655"
/db_xref="MIM:176942"
exon 1..179
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 102
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:192003318"
exon 180..325
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 197
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:369010776"
variation 198
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="c"
/db_xref="dbSNP:182439411"
variation 199
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="c"
/db_xref="dbSNP:187440009"
variation 283
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:191529165"
variation 296
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:184164646"
variation 311
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:188764630"
exon 326..591
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 366
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="t"
/db_xref="dbSNP:141543178"
misc_feature 367..369
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/note="upstream in-frame stop codon"
CDS 385..2853
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/EC_number="2.7.10.2"
/note="phosphoprotein NCP94; p94-Fer; tyrosine kinase 3;
proto-oncogene c-Fer; feline encephalitis virus-related
kinase FER; fujinami poultry sarcoma/Feline
sarcoma-related protein Fer; protein phosphatase 1,
regulatory subunit 74"
/codon_start=1
/product="tyrosine-protein kinase Fer"
/protein_id="NP_005237.2"
/db_xref="GI:119964721"
/db_xref="CCDS:CCDS4098.1"
/db_xref="GeneID:2241"
/db_xref="HGNC:3655"
/db_xref="MIM:176942"
/translation="
MGFGSDLKNSHEAVLKLQDWELRLLETVKKFMALRIKSDKEYASTLQNLCNQVDKESTVQMNYVSNVSKSWLLMIQQTEQLSRIMKTHAEDLNSGPLHRLTMMIKDKQQVKKSYIGVHQQIEAEMIKVTKTELEKLKCSYRQLIKEMNSAKEKYKEALAKGKETEKAKERYDKATMKLHMLHNQYVLALKGAQLHQNQYYDITLPLLLDSLQKMQEEMIKALKGIFDEYSQITSLVTEEIVNVHKEIQMSVEQIDPSTEYNNFIDVHRTTAAKEQEIEFDTSLLEENENLQANEIMWNNLTAESLQVMLKTLAEELMQTQQMLLNKEEAVLELEKRIEESSETCEKKSDIVLLLSQKQALEELKQSVQQLRCTEAKFSAQKELLEQKVQENDGKEPPPVVNYEEDARSVTSMERKERLSKFESIRHSIAGIIRSPKSALGSSALSDMISISEKPLAEQDWYHGAIPRIEAQELLKKQGDFLVRESHGKPGEYVLSVYSDGQRRHFIIQYVDNMYRFEGTGFSNIPQLIDHHYTTKQVITKKSGVVLLNPIPKDKKWILSHEDVILGELLGKGNFGEVYKGTLKDKTSVAVKTCKEDLPQELKIKFLQEAKILKQYDHPNIVKLIGVCTQRQPVYIIMELVSGGDFLTFLRRKKDELKLKQLVKFSLDAAAGMLYLESKNCIHRDLAARNCLVGENNVLKISDFGMSRQEDGGVYSSSGLKQIPIKWTAPEALNYGRYSSESDVWSFGILLWETFSLGVCPYPGMTNQQAREQVERGYRMSAPQHCPEDISKIMMKCWDYKPENRPKFSELQKELTIIKRKLT
"
misc_feature 385..1284
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P16591.2);
Region: Important for interaction with membranes
containing phosphoinositides"
misc_feature 397..1098
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/note="The F-BAR (FES-CIP4 Homology and
Bin/Amphiphysin/Rvs) domain of Fer (Fes related) tyrosine
kinase; Region: F-BAR_Fer; cd07686"
/db_xref="CDD:153370"
misc_feature order(412..414,421..423,442..444,451..456,463..465,
472..477,484..489,496..498,508..510,517..519,529..531,
613..615,622..624,886..888,898..900,973..975,997..999,
1006..1008,1015..1020,1027..1029,1039..1041,1048..1050,
1060..1062,1072..1074,1081..1086,1093..1095)
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/note="dimer interface [polypeptide binding]; other site"
/db_xref="CDD:153370"
misc_feature 1588..1590
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine; propagated from
UniProtKB/Swiss-Prot (P16591.2); phosphorylation site"
misc_feature 1588..1590
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01491"
misc_feature 1588..1590
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1684..1686
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P16591.2); phosphorylation site"
misc_feature 1684..1686
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01491"
misc_feature 1741..1998
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/note="Src homology 2 (SH2) domain found in feline
sarcoma, Fujinami poultry sarcoma, and fes-related
(Fes/Fps/Fer) proteins; Region: SH2_Fps_family; cd10361"
/db_xref="CDD:198224"
misc_feature order(1783..1785,1831..1833,1894..1896,1900..1902)
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/note="phosphotyrosine binding pocket [polypeptide
binding]; other site"
/db_xref="CDD:198224"
misc_feature order(1897..1899,1975..1977)
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/note="hydrophobic binding pocket [polypeptide binding];
other site"
/db_xref="CDD:198224"
misc_feature 2071..2826
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/note="Protein tyrosine kinase; Region: Pkinase_Tyr;
pfam07714"
/db_xref="CDD:203736"
misc_feature 2083..2832
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/note="Catalytic domain of the Protein Tyrosine Kinase,
Fer; Region: PTKc_Fer; cd05085"
/db_xref="CDD:133216"
misc_feature order(2089..2097,2113..2115,2149..2151,2155..2157,
2206..2208,2293..2304,2311..2316,2434..2436,2446..2451,
2455..2457,2485..2490,2539..2556,2560..2562,2680..2682,
2692..2694)
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/note="active site"
/db_xref="CDD:133216"
misc_feature order(2089..2097,2113..2115,2149..2151,2155..2157,
2206..2208,2293..2304,2311..2316,2446..2451,2455..2457,
2485..2490)
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:133216"
misc_feature order(2434..2436,2446..2451,2539..2556,2560..2562,
2680..2682,2692..2694)
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/note="substrate binding site [chemical binding]; other
site"
/db_xref="CDD:133216"
misc_feature 2485..2559
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/note="activation loop (A-loop); other site"
/db_xref="CDD:133216"
misc_feature 2524..2526
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine, by autocatalysis; propagated from
UniProtKB/Swiss-Prot (P16591.2); phosphorylation site"
misc_feature 2524..2526
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01491"
variation 441
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:144530313"
variation 445..446
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace=""
/replace="ga"
/db_xref="dbSNP:35665762"
variation 451
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:147858956"
variation 452
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:199698325"
variation 468
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:2229085"
variation 478
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:142838306"
variation 564
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:146363767"
variation 573
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:56199104"
variation 579
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:374282780"
variation 581
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:371972203"
variation 582
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:190188307"
variation 583
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:376919194"
exon 592..765
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 618
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:150212580"
variation 676
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="c"
/db_xref="dbSNP:377413281"
variation 700
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="g"
/replace="t"
/db_xref="dbSNP:200116493"
variation 713
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:113090262"
variation 750
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:376506569"
exon 766..865
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 766
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="g"
/replace="t"
/db_xref="dbSNP:35150210"
variation 801
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:56244110"
variation 828
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:375647419"
variation 840
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:55954478"
exon 866..1049
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 910
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:138502993"
variation 935
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:376155654"
variation 949
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:149637747"
variation 986
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:369584454"
variation 1005
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:372794297"
variation 1032
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:370663101"
exon 1050..1187
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 1059
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:143449963"
variation 1108
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="t"
/db_xref="dbSNP:147265497"
variation 1117
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:141693705"
variation 1123
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="t"
/db_xref="dbSNP:370199096"
variation 1133
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:147156724"
variation 1156
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:140381149"
variation 1166
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:182613310"
variation 1180
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:201582060"
exon 1188..1307
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 1218
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:371373758"
variation 1233
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:142818071"
variation 1234
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="g"
/db_xref="dbSNP:199857892"
variation 1271
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="g"
/replace="t"
/db_xref="dbSNP:78300586"
variation 1280
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:147403485"
variation 1282
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="g"
/replace="t"
/db_xref="dbSNP:139205864"
variation 1306
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:149945605"
exon 1308..1430
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 1312
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:371991026"
variation 1317
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:374674458"
variation 1323
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:368242135"
variation 1324
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="g"
/db_xref="dbSNP:372482792"
variation 1350
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="g"
/replace="t"
/db_xref="dbSNP:145208291"
variation 1351
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="g"
/db_xref="dbSNP:200461855"
variation 1424
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:148708882"
exon 1431..1620
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 1433
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:115520719"
variation 1434
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:202195528"
variation 1460
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:376917767"
variation 1463
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:75191436"
variation 1467
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:146825031"
variation 1488
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:370261354"
variation 1506
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:140609551"
variation 1533
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:35990968"
variation 1558
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="g"
/replace="t"
/db_xref="dbSNP:146594490"
variation 1618
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:33940843"
exon 1621..1713
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 1627
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="c"
/db_xref="dbSNP:150263624"
variation 1641
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="g"
/db_xref="dbSNP:56341714"
variation 1653
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="g"
/replace="t"
/db_xref="dbSNP:137918625"
variation 1657
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:149466013"
variation 1680
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:145742969"
variation 1699
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="g"
/db_xref="dbSNP:2229086"
variation 1701
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:375067286"
variation 1711
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="g"
/db_xref="dbSNP:34259824"
exon 1714..1917
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 1743
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:34940896"
variation 1830
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:142731169"
variation 1853
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:375338865"
variation 1904
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:34204308"
variation 1913
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="t"
/db_xref="dbSNP:147406165"
exon 1918..2040
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 1924
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:200996798"
variation 1928
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:373617030"
variation 1941
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:34320303"
variation 1951
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:200527034"
variation 1956
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="t"
/db_xref="dbSNP:372148186"
variation 1961
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="t"
/db_xref="dbSNP:34269985"
variation 1971
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:34869483"
variation 2036
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="c"
/db_xref="dbSNP:191621957"
exon 2041..2097
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 2076
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="t"
/db_xref="dbSNP:150352843"
variation 2093
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="g"
/replace="t"
/db_xref="dbSNP:373771239"
exon 2098..2213
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 2124
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:150935294"
variation 2136
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:919771"
variation 2138
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:139628994"
variation 2185
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:183440274"
exon 2214..2308
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 2217
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:144241765"
variation 2223
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="g"
/replace="t"
/db_xref="dbSNP:145364639"
variation 2235
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:149182269"
variation 2251
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:377353306"
variation 2269
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="c"
/db_xref="dbSNP:74618133"
exon 2309..2432
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 2360
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:142394379"
variation 2408
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:112575947"
exon 2433..2587
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 2461
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:375506762"
variation 2472
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:368804605"
variation 2504
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="g"
/db_xref="dbSNP:151332661"
exon 2588..2710
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 2595
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:141853188"
variation 2597
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="g"
/db_xref="dbSNP:145807358"
variation 2611
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:202063368"
variation 2619
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:55876507"
variation 2626
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:201346702"
variation 2658
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="g"
/replace="t"
/db_xref="dbSNP:200387943"
variation 2664
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:141252882"
variation 2708
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:146949083"
exon 2711..2950
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/inference="alignment:Splign:1.39.8"
variation 2713
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:137975508"
STS 2733..2893
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/standard_name="RH71338"
/db_xref="UniSTS:47265"
variation 2739..2740
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace=""
/replace="g"
/db_xref="dbSNP:36084170"
variation 2739
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:190232603"
variation 2767
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="c"
/db_xref="dbSNP:149517787"
STS 2788..2912
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/standard_name="RH68965"
/db_xref="UniSTS:41338"
variation 2800
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:144036103"
variation 2820
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:148283941"
variation 2821
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="g"
/db_xref="dbSNP:56097357"
variation 2824
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:201713568"
variation 2827
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:141808872"
variation 2828
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:200830629"
variation 2836
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="c"
/db_xref="dbSNP:201191333"
variation 2853
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="g"
/db_xref="dbSNP:201854726"
variation 2865
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="c"
/replace="t"
/db_xref="dbSNP:369778570"
variation 2870
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
/replace="a"
/replace="t"
/db_xref="dbSNP:1133392"
polyA_site 2945
/gene="FER"
/gene_synonym="FerT; PPP1R74; TYK3"
ORIGIN
gtcacaccctcgaataatgacgcatacctatcctactgttactgatcacctagtaataatcttgtagttcacattactcatttttcaccaaattcttttggtgaaggacgcttcagaaacggccatcactgaagagcagacccgtttgggttctccacgcattctagactcccgaagagctcatgttttttggctagacctatgaccattttcgctagacttcactgcacgttttctcaagtatcttctttgtccctaatgtgtgacacctcatcatggacacgctactttagctaaggcatgaccagcaatgaacagtagtaagatatgtgctgattagaaggctcacttgtgcagtgtggaggataaccagtgccttacaaaatggggtttgggagtgacctgaagaattcacatgaagcagtgttaaaattgcaagactgggaattacggttactggaaacagtaaagaaatttatggccctgagaataaaaagtgataaagaatatgcatctactttacagaacctttgtaatcaagttgataaggaaagtactgtccaaatgaattatgtcagcaacgtatccaagtcttggctacttatgattcagcagacagaacaacttagtaggataatgaagacacatgcagaggacttgaactctggacctttacacaggctcaccatgatgattaaggacaagcagcaggtgaagaaaagttacataggtgttcatcagcagatagaggcagagatgatcaaggttaccaaaacagaattggagaagttaaaatgcagctatagacaattaataaaagaaatgaattctgccaaagagaaatataaagaagctttagctaaagggaaggaaactgaaaaggccaaggaacgatacgacaaagccacaatgaaacttcatatgttgcacaatcagtatgtattggcgttgaaaggggcacagctccatcagaatcagtattatgatatcacacttcccctgcttctggactccttacaaaagatgcaagaagaaatgataaaagcactcaaaggtatatttgatgaatacagccagataaccagtcttgtcacagaggaaatagtgaatgtccataaagagattcaaatgtcggttgaacagatagatcctagtacagaatacaataatttcatagatgttcacagaacaacggctgctaaagaacaagaaatagagtttgatacttccttactggaagaaaatgaaaatcttcaggcaaatgagatcatgtggaataacttaacagcagaaagtttgcaagtaatgttgaaaacgttagcggaagaacttatgcaaacacagcagatgcttttaaacaaggaggaggctgttttggagttagagaagagaattgaagaatcttctgaaacttgtgagaagaagtctgatattgtgcttctgctaagccaaaaacaggcacttgaagaactgaaacagtcagtccagcagctgagatgcactgaagcaaagttttcagcacagaaggaattactagagcaaaaagtgcaagaaaatgatgggaaagagccacctccagtagtaaattatgaagaagatgcacgatcagttacatctatggaaagaaaggagaggctatccaaatttgaatctattcgtcattcaattgctggaataattaggtctccaaaatctgcactgggctcttcagcactttctgatatgatctccatcagtgagaagcctttggcagaacaggactggtaccatggtgcaattcccagaatagaagctcaagaactgttaaaaaaacaaggagactttttggtgcgagagagtcatgggaaacctggtgaatatgtcctttctgtatattctgatggacagaggagacattttatcatacaatatgttgataacatgtatcgattcgagggcactgggttttcaaacattcctcaacttatagatcatcactatacaacaaaacaggtcatcactaagaaatcaggtgtagttctgctgaatcctattcctaaggacaagaaatggattctcagtcatgaagatgtcatattgggagaattactgggcaagggaaattttggtgaagtatataagggcacattaaaggataaaacttctgttgctgttaaaacatgtaaagaagatcttcctcaggaattgaaaataaaatttttacaagaagccaaaattctcaagcaatatgatcatcccaatattgtcaaacttataggagtttgcacacaaagacagcctgtctacatcattatggaactggtttcaggaggtgatttcctcacctttctgagaaggaagaaggatgaactaaaactcaaacagttagtgaaattttcattagacgctgctgctggtatgttgtatctcgagagtaaaaactgtatacacagggaccttgctgcaagaaactgcctggtaggtgaaaataatgttctgaaaatcagtgactttggaatgtctcgtcaagaggatggtggagtgtattcatcttctggcttaaagcagattcccattaaatggacagcaccggaagctcttaattatgggagatacagttcagagagtgacgtgtggagctttggcatccttctctgggagaccttcagcttaggggtttgtccgtaccctggaatgacaaatcagcaagcaagagagcaagtagaaagaggataccggatgtcagctccccagcactgtccagaggatatttccaaaatcatgatgaagtgttgggattataaacctgaaaatcgccctaagttcagtgaacttcagaaagagctcactatcatcaagagaaaactcacatagtgacaggatggcgccaaactcagccttcaggactctgtcctccagcagagtaacattattgttctcattaacaatgaatttataccacattaccttc
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:2241 -> Molecular function: GO:0003779 [actin binding] evidence: IEA
GeneID:2241 -> Molecular function: GO:0004713 [protein tyrosine kinase activity] evidence: TAS
GeneID:2241 -> Molecular function: GO:0004715 [non-membrane spanning protein tyrosine kinase activity] evidence: IDA
GeneID:2241 -> Molecular function: GO:0005154 [epidermal growth factor receptor binding] evidence: IDA
GeneID:2241 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:2241 -> Molecular function: GO:0008157 [protein phosphatase 1 binding] evidence: IEA
GeneID:2241 -> Molecular function: GO:0008289 [lipid binding] evidence: IDA
GeneID:2241 -> Molecular function: GO:0017137 [Rab GTPase binding] evidence: IEA
GeneID:2241 -> Molecular function: GO:0019901 [protein kinase binding] evidence: IEA
GeneID:2241 -> Molecular function: GO:0045295 [gamma-catenin binding] evidence: IEA
GeneID:2241 -> Molecular function: GO:0045296 [cadherin binding] evidence: IEA
GeneID:2241 -> Biological process: GO:0000226 [microtubule cytoskeleton organization] evidence: IMP
GeneID:2241 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: IMP
GeneID:2241 -> Biological process: GO:0001932 [regulation of protein phosphorylation] evidence: ISS
GeneID:2241 -> Biological process: GO:0006468 [protein phosphorylation] evidence: TAS
GeneID:2241 -> Biological process: GO:0006935 [chemotaxis] evidence: IEA
GeneID:2241 -> Biological process: GO:0008283 [cell proliferation] evidence: IMP
GeneID:2241 -> Biological process: GO:0008284 [positive regulation of cell proliferation] evidence: TAS
GeneID:2241 -> Biological process: GO:0010591 [regulation of lamellipodium assembly] evidence: IDA
GeneID:2241 -> Biological process: GO:0010762 [regulation of fibroblast migration] evidence: IEA
GeneID:2241 -> Biological process: GO:0018108 [peptidyl-tyrosine phosphorylation] evidence: IDA
GeneID:2241 -> Biological process: GO:0019221 [cytokine-mediated signaling pathway] evidence: IMP
GeneID:2241 -> Biological process: GO:0030335 [positive regulation of cell migration] evidence: IMP
GeneID:2241 -> Biological process: GO:0030838 [positive regulation of actin filament polymerization] evidence: IMP
GeneID:2241 -> Biological process: GO:0031532 [actin cytoskeleton reorganization] evidence: ISS
GeneID:2241 -> Biological process: GO:0032496 [response to lipopolysaccharide] evidence: ISS
GeneID:2241 -> Biological process: GO:0032869 [cellular response to insulin stimulus] evidence: ISS
GeneID:2241 -> Biological process: GO:0033007 [negative regulation of mast cell activation involved in immune response] evidence: ISS
GeneID:2241 -> Biological process: GO:0034446 [substrate adhesion-dependent cell spreading] evidence: ISS
GeneID:2241 -> Biological process: GO:0034614 [cellular response to reactive oxygen species] evidence: ISS
GeneID:2241 -> Biological process: GO:0035426 [extracellular matrix-cell signaling] evidence: ISS
GeneID:2241 -> Biological process: GO:0035556 [intracellular signal transduction] evidence: TAS
GeneID:2241 -> Biological process: GO:0036006 [cellular response to macrophage colony-stimulating factor stimulus] evidence: IMP
GeneID:2241 -> Biological process: GO:0036119 [response to platelet-derived growth factor stimulus] evidence: ISS
GeneID:2241 -> Biological process: GO:0038028 [insulin receptor signaling pathway via phosphatidylinositol 3-kinase cascade] evidence: ISS
GeneID:2241 -> Biological process: GO:0038095 [Fc-epsilon receptor signaling pathway] evidence: ISS
GeneID:2241 -> Biological process: GO:0038109 [Kit signaling pathway] evidence: ISS
GeneID:2241 -> Biological process: GO:0042058 [regulation of epidermal growth factor receptor signaling pathway] evidence: IMP
GeneID:2241 -> Biological process: GO:0042503 [tyrosine phosphorylation of Stat3 protein] evidence: IDA
GeneID:2241 -> Biological process: GO:0044331 [cell-cell adhesion mediated by cadherin] evidence: ISS
GeneID:2241 -> Biological process: GO:0046777 [protein autophosphorylation] evidence: IDA
GeneID:2241 -> Biological process: GO:0048008 [platelet-derived growth factor receptor signaling pathway] evidence: ISS
GeneID:2241 -> Biological process: GO:0048008 [platelet-derived growth factor receptor signaling pathway] evidence: TAS
GeneID:2241 -> Biological process: GO:0050904 [diapedesis] evidence: ISS
GeneID:2241 -> Biological process: GO:0051092 [positive regulation of NF-kappaB transcription factor activity] evidence: IMP
GeneID:2241 -> Biological process: GO:0070102 [interleukin-6-mediated signaling pathway] evidence: IMP
GeneID:2241 -> Cellular component: GO:0000790 [nuclear chromatin] evidence: IDA
GeneID:2241 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:2241 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:2241 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:2241 -> Cellular component: GO:0005938 [cell cortex] evidence: IEA
GeneID:2241 -> Cellular component: GO:0015629 [actin cytoskeleton] evidence: IDA
GeneID:2241 -> Cellular component: GO:0015630 [microtubule cytoskeleton] evidence: IDA
GeneID:2241 -> Cellular component: GO:0030027 [lamellipodium] evidence: IDA
GeneID:2241 -> Cellular component: GO:0030054 [cell junction] evidence: IDA
GeneID:2241 -> Cellular component: GO:0031234 [extrinsic to internal side of plasma membrane] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_005237 -> EC 2.7.10.2
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.