Home |
Help |
Advanced search
2025-05-09 17:03:25, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_005032 3612 bp mRNA linear PRI 01-JUL-2013
DEFINITION Homo sapiens plastin 3 (PLS3), transcript variant 1, mRNA.
ACCESSION NM_005032
VERSION NM_005032.5 GI:288915537
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3612)
AUTHORS Yokobori,T., Iinuma,H., Shimamura,T., Imoto,S., Sugimachi,K.,
Ishii,H., Iwatsuki,M., Ota,D., Ohkuma,M., Iwaya,T., Nishida,N.,
Kogo,R., Sudo,T., Tanaka,F., Shibata,K., Toh,H., Sato,T.,
Barnard,G.F., Fukagawa,T., Yamamoto,S., Nakanishi,H., Sasaki,S.,
Miyano,S., Watanabe,T., Kuwano,H., Mimori,K., Pantel,K. and Mori,M.
TITLE Plastin3 is a novel marker for circulating tumor cells undergoing
the epithelial-mesenchymal transition and is associated with
colorectal cancer prognosis
JOURNAL Cancer Res. 73 (7), 2059-2069 (2013)
PUBMED 23378342
REMARK GeneRIF: Overexpression of PLS3 is associated with
epithelial-mesenchymal transition and is associated with metastasis
in colorectal cancer
REFERENCE 2 (bases 1 to 3612)
AUTHORS Michel,L., Jean-Louis,F., Begue,E., Bensussan,A. and Bagot,M.
TITLE Use of PLS3, Twist, CD158k/KIR3DL2, and NKp46 gene expression
combination for reliable Sezary syndrome diagnosis
JOURNAL Blood 121 (8), 1477-1478 (2013)
PUBMED 23429988
REMARK GeneRIF: PLS3, Twist, KIR3DL2 and NKp46 gene expression can model
efficient molecular Sezary syndrome diagnosis.
REFERENCE 3 (bases 1 to 3612)
AUTHORS Su,H., Zhu,J., Cai,C., Pei,W., Wang,J., Dong,H. and Ren,H.
TITLE FIMBRIN1 is involved in lily pollen tube growth by stabilizing the
actin fringe
JOURNAL Plant Cell 24 (11), 4539-4554 (2012)
PUBMED 23150633
REFERENCE 4 (bases 1 to 3612)
AUTHORS Jones,C.L., Ferreira,S., McKenzie,R.C., Tosi,I., Caesar,J.A.,
Bagot,M., Whittaker,S.J. and Mitchell,T.J.
TITLE Regulation of T-plastin expression by promoter hypomethylation in
primary cutaneous T-cell lymphoma
JOURNAL J. Invest. Dermatol. 132 (8), 2042-2049 (2012)
PUBMED 22495182
REMARK GeneRIF: PLS3 is expressed in the majority of SS patients and
provide insight into the molecular regulation of PLS3 expression in
CTCL
REFERENCE 5 (bases 1 to 3612)
AUTHORS Begue,E., Jean-Louis,F., Bagot,M., Jauliac,S., Cayuela,J.M.,
Laroche,L., Parquet,N., Bachelez,H., Bensussan,A., Courtois,G. and
Michel,L.
TITLE Inducible expression and pathophysiologic functions of T-plastin in
cutaneous T-cell lymphoma
JOURNAL Blood 120 (1), 143-154 (2012)
PUBMED 22627769
REMARK GeneRIF: T-plastin is a marker restricted to malignant lymphocytes
from Sezary syndrome patients and plays a role for cell survival
and migration.
REFERENCE 6 (bases 1 to 3612)
AUTHORS Arpin,M., Friederich,E., Algrain,M., Vernel,F. and Louvard,D.
TITLE Functional differences between L- and T-plastin isoforms
JOURNAL J. Cell Biol. 127 (6 PT 2), 1995-2008 (1994)
PUBMED 7806577
REFERENCE 7 (bases 1 to 3612)
AUTHORS Lin,C.S., Park,T., Chen,Z.P. and Leavitt,J.
TITLE Human plastin genes. Comparative gene structure, chromosome
location, and differential expression in normal and neoplastic
cells
JOURNAL J. Biol. Chem. 268 (4), 2781-2792 (1993)
PUBMED 8428952
REFERENCE 8 (bases 1 to 3612)
AUTHORS Lin,C.S., Aebersold,R.H. and Leavitt,J.
TITLE Correction of the N-terminal sequences of the human plastin
isoforms by using anchored polymerase chain reaction:
identification of a potential calcium-binding domain
JOURNAL Mol. Cell. Biol. 10 (4), 1818-1821 (1990)
PUBMED 2378651
REFERENCE 9 (bases 1 to 3612)
AUTHORS Lin,C.S., Aebersold,R.H., Kent,S.B., Varma,M. and Leavitt,J.
TITLE Molecular cloning and characterization of plastin, a human
leukocyte protein expressed in transformed human fibroblasts
JOURNAL Mol. Cell. Biol. 8 (11), 4659-4668 (1988)
PUBMED 3211125
REFERENCE 10 (bases 1 to 3612)
AUTHORS Goldstein,D., Djeu,J., Latter,G., Burbeck,S. and Leavitt,J.
TITLE Abundant synthesis of the transformation-induced protein of
neoplastic human fibroblasts, plastin, in normal lymphocytes
JOURNAL Cancer Res. 45 (11 PT 2), 5643-5647 (1985)
PUBMED 4053036
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DC320695.1, AK312391.1 and
AC005000.2.
This sequence is a reference standard in the RefSeqGene project.
On Feb 17, 2010 this sequence version replaced gi:226053440.
Summary: Plastins are a family of actin-binding proteins that are
conserved throughout eukaryote evolution and expressed in most
tissues of higher eukaryotes. In humans, two ubiquitous plastin
isoforms (L and T) have been identified. Plastin 1 (otherwise known
as Fimbrin) is a third distinct plastin isoform which is
specifically expressed at high levels in the small intestine. The L
isoform is expressed only in hemopoietic cell lineages, while the T
isoform has been found in all other normal cells of solid tissues
that have replicative potential (fibroblasts, endothelial cells,
epithelial cells, melanocytes, etc.). The C-terminal 570 amino
acids of the T-plastin and L-plastin proteins are 83% identical. It
contains a potential calcium-binding site near the N terminus.
Alternate splicing results in multiple transcript
variants.[provided by RefSeq, Feb 2010].
Transcript Variant: This variant (1) represents the longest
transcript and encodes the longer isoform (1). Variants 1 and 2
encode the same isoform (1).
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC056898.1, AK222801.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025081, ERS025082 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-326 DC320695.1 1-326
327-2002 AK312391.1 1-1676
2003-2003 AC005000.2 15987-15987
2004-2312 AK312391.1 1678-1986
2313-3612 AC005000.2 17927-19226
FEATURES Location/Qualifiers
source 1..3612
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="X"
/map="Xq23"
gene 1..3612
/gene="PLS3"
/gene_synonym="T-plastin"
/note="plastin 3"
/db_xref="GeneID:5358"
/db_xref="HGNC:9091"
/db_xref="HPRD:02133"
/db_xref="MIM:300131"
exon 1..411
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 69
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:140832180"
variation 306
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:373494371"
variation 365
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="g"
/db_xref="dbSNP:757124"
exon 412..492
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
misc_feature 417..419
/gene="PLS3"
/gene_synonym="T-plastin"
/note="upstream in-frame stop codon"
CDS 420..2312
/gene="PLS3"
/gene_synonym="T-plastin"
/note="isoform 1 is encoded by transcript variant 1; T
fimbrin; plastin-3; T plastin"
/codon_start=1
/product="plastin-3 isoform 1"
/protein_id="NP_005023.2"
/db_xref="GI:7549809"
/db_xref="CCDS:CCDS14568.1"
/db_xref="GeneID:5358"
/db_xref="HGNC:9091"
/db_xref="HPRD:02133"
/db_xref="MIM:300131"
/translation="
MDEMATTQISKDELDELKEAFAKVDLNSNGFICDYELHELFKEANMPLPGYKVREIIQKLMLDGDRNKDGKISFDEFVYIFQEVKSSDIAKTFRKAINRKEGICALGGTSELSSEGTQHSYSEEEKYAFVNWINKALENDPDCRHVIPMNPNTDDLFKAVGDGIVLCKMINLSVPDTIDERAINKKKLTPFIIQENLNLALNSASAIGCHVVNIGAEDLRAGKPHLVLGLLWQIIKIGLFADIELSRNEALAALLRDGETLEELMKLSPEELLLRWANFHLENSGWQKINNFSADIKDSKAYFHLLNQIAPKGQKEGEPRIDINMSGFNETDDLKRAESMLQQADKLGCRQFVTPADVVSGNPKLNLAFVANLFNKYPALTKPENQDIDWTLLEGETREERTFRNWMNSLGVNPHVNHLYADLQDALVILQLYERIKVPVDWSKVNKPPYPKLGANMKKLENCNYAVELGKHPAKFSLVGIGGQDLNDGNQTLTLALVWQLMRRYTLNVLEDLGDGQKANDDIIVNWVNRTLSEAGKSTSIQSFKDKTISSSLAVVDLIDAIQPGCINYDLVKSGNLTEDDKHNNAKYAVSMARRIGARVYALPEDLVEVKPKMVMTVFACLMGRGMKRV
"
misc_feature 465..665
/gene="PLS3"
/gene_synonym="T-plastin"
/note="EF-hand, calcium binding motif; A diverse
superfamily of calcium sensors and calcium signal
modulators; most examples in this alignment model have 2
active canonical EF hands. Ca2+ binding induces a
conformational change in the EF-hand motif, leading to...;
Region: EFh; cd00051"
/db_xref="CDD:28933"
misc_feature 474..2288
/gene="PLS3"
/gene_synonym="T-plastin"
/note="Ca2+-binding actin-bundling protein fimbrin/plastin
(EF-Hand superfamily) [Cytoskeleton]; Region: SAC6;
COG5069"
/db_xref="CDD:34673"
misc_feature order(492..494,498..500,504..506,525..527,612..614,
618..620,624..626,645..647)
/gene="PLS3"
/gene_synonym="T-plastin"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:28933"
misc_feature 768..770
/gene="PLS3"
/gene_synonym="T-plastin"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 789..1136
/gene="PLS3"
/gene_synonym="T-plastin"
/note="Calponin homology domain; actin-binding domain
which may be present as a single copy or in tandem repeats
(which increases binding affinity). The CH domain is found
in cytoskeletal and signal transduction proteins,
including actin-binding proteins like...; Region: CH;
cd00014"
/db_xref="CDD:28898"
misc_feature order(789..794,798..806,813..815,822..824,1020..1025,
1032..1034,1041..1043,1047..1049,1092..1097,1104..1109,
1113..1118,1125..1130)
/gene="PLS3"
/gene_synonym="T-plastin"
/note="putative actin binding surface [polypeptide
binding]; other site"
/db_xref="CDD:28898"
misc_feature 1221..1553
/gene="PLS3"
/gene_synonym="T-plastin"
/note="Calponin homology domain; actin-binding domain
which may be present as a single copy or in tandem repeats
(which increases binding affinity). The CH domain is found
in cytoskeletal and signal transduction proteins,
including actin-binding proteins like...; Region: CH;
cd00014"
/db_xref="CDD:28898"
misc_feature order(1221..1226,1230..1238,1245..1247,1254..1256,
1440..1445,1452..1454,1461..1463,1467..1469,1509..1514,
1521..1526,1530..1535,1542..1547)
/gene="PLS3"
/gene_synonym="T-plastin"
/note="putative actin binding surface [polypeptide
binding]; other site"
/db_xref="CDD:28898"
misc_feature 1296..1298
/gene="PLS3"
/gene_synonym="T-plastin"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P13797.4); phosphorylation site"
misc_feature 1395..1397
/gene="PLS3"
/gene_synonym="T-plastin"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P13797.4); phosphorylation site"
misc_feature 1590..1592
/gene="PLS3"
/gene_synonym="T-plastin"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (P13797.4); phosphorylation site"
misc_feature 1626..1934
/gene="PLS3"
/gene_synonym="T-plastin"
/note="Calponin homology domain; actin-binding domain
which may be present as a single copy or in tandem repeats
(which increases binding affinity). The CH domain is found
in cytoskeletal and signal transduction proteins,
including actin-binding proteins like...; Region: CH;
cd00014"
/db_xref="CDD:28898"
misc_feature order(1626..1628,1635..1637,1644..1646,1818..1823,
1830..1832,1842..1844,1848..1850,1893..1898,1905..1910,
1914..1919,1926..1931)
/gene="PLS3"
/gene_synonym="T-plastin"
/note="putative actin binding surface [polypeptide
binding]; other site"
/db_xref="CDD:28898"
misc_feature 1980..2297
/gene="PLS3"
/gene_synonym="T-plastin"
/note="Calponin homology domain; actin-binding domain
which may be present as a single copy or in tandem repeats
(which increases binding affinity). The CH domain is found
in cytoskeletal and signal transduction proteins,
including actin-binding proteins like...; Region: CH;
cd00014"
/db_xref="CDD:28898"
misc_feature order(1983..1991,1998..2000,2007..2009,2187..2192,
2199..2201,2208..2210,2214..2216,2256..2261,2268..2273,
2277..2282,2289..2294)
/gene="PLS3"
/gene_synonym="T-plastin"
/note="putative actin binding surface [polypeptide
binding]; other site"
/db_xref="CDD:28898"
exon 493..656
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 494
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:150018375"
variation 505
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:145235506"
variation 613
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="c"
/db_xref="dbSNP:373153000"
variation 628
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:377475836"
variation 644
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:113492800"
variation 645
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:186923237"
exon 657..786
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 740
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="t"
/db_xref="dbSNP:140121121"
variation 743
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:144784703"
variation 782
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:147957783"
exon 787..919
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 855
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:141907957"
variation 887
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="g"
/db_xref="dbSNP:143815252"
variation 890
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:151153004"
exon 920..1001
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
exon 1002..1167
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1059
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:367830488"
variation 1070
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:112589137"
variation 1107
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:371332791"
variation 1141
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:375187925"
exon 1168..1310
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1169
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="g"
/db_xref="dbSNP:376568367"
variation 1295
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:373249162"
variation 1296
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:369914417"
exon 1311..1406
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1311
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:202076515"
variation 1344
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:140968059"
variation 1377
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:137917062"
variation 1393
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:142569974"
exon 1407..1602
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1469
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:113204501"
variation 1520
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:1859671"
exon 1603..1681
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1611
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:377411857"
variation 1613
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:138662773"
variation 1629
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:201842598"
variation 1661
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:2108099"
variation 1664
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:144592792"
variation 1681
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:370999829"
exon 1682..1796
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1694
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:148514983"
variation 1713
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:871774"
exon 1797..1930
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1799
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:75219193"
variation 1838
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:140768895"
variation 1895
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="g"
/db_xref="dbSNP:35211005"
exon 1931..2054
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1937
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="g"
/replace="t"
/db_xref="dbSNP:35525703"
variation 1964
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:140069545"
variation 1965
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:199893556"
variation 2015
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:372389185"
variation 2017
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:377191528"
variation 2034
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:150069454"
variation 2047
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:191246889"
exon 2055..2179
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 2080
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="c"
/db_xref="dbSNP:181782110"
variation 2151
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:149142111"
variation 2159
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:145393426"
exon 2180..3612
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 2311
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:369448909"
variation 2352
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:373177061"
variation 2363
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:376407795"
variation 2528
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="g"
/db_xref="dbSNP:184318952"
variation 2696
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:144589761"
variation 2956
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:11551495"
variation 3028
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:370865892"
variation 3204
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:373978498"
polyA_signal 3402..3407
/gene="PLS3"
/gene_synonym="T-plastin"
polyA_site 3423
/gene="PLS3"
/gene_synonym="T-plastin"
variation 3454
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:376902216"
variation 3534
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:148073444"
ORIGIN
ttattaatcccacaagattgtgtgaatgtgtactccgagccaggcacgttggacttctaacttcctcttagcccaagtaggaaggggagactcaggcgctggggaccattctcctctccctgcagcagagttgcagtccctatccctcctgggtgcccatccccgtgcctattttcctggatccccacccagttgatgtgacaggctcgtggcccaatccccttcctggttcccaggccgactgctagcaccacccgagccaatggcggcggccgaggggcggagggggctggcaggaggggagggagcgctggctttagagccacagctgcaaagattccgaggtgcagaagttgtctgagtgcgttggtcggcggcagtcgggccagacccaggactctgcgactttacatctttaaatggatgagatggctaccactcagatttccaaagatgagcttgatgaactcaaagaggcctttgcaaaagttgatctcaacagcaacggattcatttgtgactatgaacttcatgagctcttcaaggaagctaatatgccattaccaggatataaagtgagagaaattattcagaaactcatgctggatggtgacaggaataaagatgggaaaataagttttgacgaatttgtttatatttttcaagaggtaaaaagtagtgatattgccaagaccttccgcaaagcaatcaacaggaaagaaggtatttgtgctctgggtggaacttcagagttgtccagcgaaggaacacagcattcttactcagaggaagaaaaatatgcttttgttaactggataaacaaagctttggaaaatgatcctgattgtagacatgttataccaatgaaccctaacaccgatgacctgttcaaagctgttggtgatggaattgtgctttgtaaaatgattaacctttcagttcctgataccattgatgaaagagcaatcaacaagaagaaacttacacccttcatcattcaggaaaacttgaacttggcactgaactctgcttctgccattgggtgtcatgttgtgaacattggtgcagaagatttgagggctgggaaacctcatctggttttgggactgctttggcagatcattaagatcggtttgttcgctgacattgaattaagcaggaatgaagccttggctgctttactccgagatggtgagactttggaggaacttatgaaattgtctccagaagagcttctgcttagatgggcaaactttcatttggaaaactcgggctggcaaaaaattaacaactttagtgctgacatcaaggattccaaagcctatttccatcttctcaatcaaatcgcaccaaaaggacaaaaggaaggtgaaccacggatagatattaacatgtcaggtttcaatgaaacagatgatttgaagagagctgagagtatgcttcaacaagcagataaattaggttgcagacagtttgttacccctgctgatgttgtcagtggaaaccccaaactcaacttagctttcgtggctaacctgtttaataaatacccagcactaactaagccagagaaccaggatattgactggactctattagaaggagaaactcgtgaagaaagaaccttccgtaactggatgaactctcttggtgtcaatcctcacgtaaaccatctctatgctgacctgcaagatgccctggtaatcttacagttatatgaacgaattaaagttcctgttgactggagtaaggttaataaacctccatacccgaaactgggagccaacatgaaaaagctagaaaactgcaactatgctgttgaattagggaagcatcctgctaaattctccctggttggcattggagggcaagacctgaatgatgggaaccaaaccctgactttagctttagtctggcagctgatgagaagatataccctcaatgtcctggaagatcttggagatggtcagaaagccaatgacgacatcattgtgaactgggtgaacagaacgttgagtgaagctggaaaatcaacttccattcagagttttaaggacaagacgatcagctccagtttggcagttgtggatttaattgatgccatccagccaggctgtataaactatgaccttgtgaagagtggcaatctaacagaagatgacaagcacaataatgccaagtatgcagtgtcaatggctagaagaatcggagccagagtgtatgctctccctgaagaccttgtggaagtaaagcccaagatggtcatgactgtgtttgcatgtttgatgggcaggggaatgaagagagtgtaaaataaccaatctgaataaaacagccatgctcccaggtgcatgattcgcaggtcagctatttccaggtgaagtgcttatggcttaaggaactcttggccattcaaaggacttttcattttgattaacaggactagcttatcatgagagccctcaggggaaagggtttaagaaaaacaactcctctttcccatagtcagagttgaatttgtcaggcacgcctgaaatgtgctcatagccaaaacattttactctctcctcctagaatgctgcccttgacatttcccattgctgtatgttatttcttgctctgttatcttttgccctcttagaatgtccctctcttgggacttgcttagatgatgggatatgaatattattagacagtaattttgctttccatccagtatgctagttcttattcgagaactatggtcagagcgtatttggatatgagtatcctttgcttatctttgtagtactgaaaatttgccgaagtaactggctgtgcagaatgtaatagaagcttttcttattcttttattcttaagatcagtatctttttacagtattctttctacatgatccttttttgtacatttaagaatattttgattatattaaacaagactgctgattttgctactttttttaaggggtcttcaagtaagtaaaacatacatcgtagctagaagaaaaatgtaccttaaatttgcatcttccctctcatacccaagctgtaaacaattgaaatattttgtcttaaatcacttggttcaatacatgcttatttgttttaaaacctgtatcatcaaactctctctctaaatttaaaatgctgttgaatatgatacttttgaggagagagtgtgctcagaacttagacgggatttggtaggccaagtatgctaagtgtacaatatattttttaattttacacctgaaacaaagaaatgtggtcactaaaaataaaagtatatatgtaggaattaatgtactcttgctttgtcaagctgtttgctatagtttccaaggtattatgttactctaactctgaaaagtgatgtaatctggtagcaatgtagtagttcaaataaaggcatttacataataattagtctgttcttcatgcttttgtctcttaggaagtatgccaatgtttgtcaggatttttttctttttgtttttctgatgtattctgtaaaatggtgtttgttaaatttgagttttgggagctgaattagaggtactgaattaaggacagtacaaatgaagtaaaaaggttttctccaatttaccaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:5358 -> Molecular function: GO:0003779 [actin binding] evidence: IEA
GeneID:5358 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
GeneID:5358 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.