Home |
Help |
Advanced search
2025-05-09 16:47:07, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004358 3659 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens cell division cycle 25B (CDC25B), transcript variant
2, mRNA.
ACCESSION NM_004358
VERSION NM_004358.3 GI:47078250
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3659)
AUTHORS Hsieh,W.L., Lin,Y.K., Tsai,C.N., Wang,T.M., Chen,T.Y. and Pang,J.H.
TITLE Indirubin, an acting component of indigo naturalis, inhibits EGFR
activation and EGF-induced CDC25B gene expression in epidermal
keratinocytes
JOURNAL J. Dermatol. Sci. 67 (2), 140-146 (2012)
PUBMED 22721997
REMARK GeneRIF: Indirubin, an acting component of indigo naturalis,
inhibits EGFR activation and EGF-induced CDC25B gene expression in
epidermal ke
REFERENCE 2 (bases 1 to 3659)
AUTHORS Yu,X.Y., Zhang,Z., Zhang,G.J., Guo,K.F. and Kong,C.Z.
TITLE Knockdown of Cdc25B in renal cell carcinoma is associated with
decreased malignant features
JOURNAL Asian Pac. J. Cancer Prev. 13 (3), 931-935 (2012)
PUBMED 22631674
REMARK GeneRIF: downregulation of Cdc25B resulted in slower growth, more
G2/M cells, weaker capacity for migration and invasion and
induction of apoptosis in renal carcinoma cell line 769-P
transfectants; findings suggest an important role of Cdc25B in
renal cell carcinoma development
REFERENCE 3 (bases 1 to 3659)
AUTHORS Liffers,S.T., Munding,J.B., Vogt,M., Kuhlmann,J.D., Verdoodt,B.,
Nambiar,S., Maghnouj,A., Mirmohammadsadegh,A., Hahn,S.A. and
Tannapfel,A.
TITLE MicroRNA-148a is down-regulated in human pancreatic ductal
adenocarcinomas and regulates cell survival by targeting CDC25B
JOURNAL Lab. Invest. 91 (10), 1472-1479 (2011)
PUBMED 21709669
REMARK GeneRIF: We identified CDC25B as novel miR-148a target which may
confer a proliferative advantage in pancreatic ductal
adenocarcinomas.
REFERENCE 4 (bases 1 to 3659)
AUTHORS Lobjois,V., Froment,C., Braud,E., Grimal,F., Burlet-Schiltz,O.,
Ducommun,B. and Bouche,J.P.
TITLE Study of the docking-dependent PLK1 phosphorylation of the CDC25B
phosphatase
JOURNAL Biochem. Biophys. Res. Commun. 410 (1), 87-90 (2011)
PUBMED 21640712
REMARK GeneRIF: there are 13 sites phosphorylated by PLK1 in CDC25B.This
study illustrates the complexity of the phosphorylation pattern and
of the subsequent regulation of CDC25B activity.
REFERENCE 5 (bases 1 to 3659)
AUTHORS Nakamura,S., Nagata,Y., Tan,L., Takemura,T., Shibata,K., Fujie,M.,
Fujisawa,S., Tanaka,Y., Toda,M., Makita,R., Tsunekawa,K.,
Yamada,M., Yamaoka,M., Yamashita,J., Ohnishi,K. and Yamashita,M.
TITLE Transcriptional repression of Cdc25B by IER5 inhibits the
proliferation of leukemic progenitor cells through NF-YB and p300
in acute myeloid leukemia
JOURNAL PLoS ONE 6 (11), E28011 (2011)
PUBMED 22132193
REMARK GeneRIF: Transcriptional repression mediated by IER5 regulates
Cdc25B expression levels via the release of NF-YB and p300 in acute
myeloid leukemia.
REFERENCE 6 (bases 1 to 3659)
AUTHORS Baldin,V., Cans,C., Superti-Furga,G. and Ducommun,B.
TITLE Alternative splicing of the human CDC25B tyrosine phosphatase.
Possible implications for growth control?
JOURNAL Oncogene 14 (20), 2485-2495 (1997)
PUBMED 9188863
REFERENCE 7 (bases 1 to 3659)
AUTHORS Conklin,D.S., Galaktionov,K. and Beach,D.
TITLE 14-3-3 proteins associate with cdc25 phosphatases
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (17), 7892-7896 (1995)
PUBMED 7644510
REFERENCE 8 (bases 1 to 3659)
AUTHORS Galaktionov,K. and Beach,D.
TITLE Specific activation of cdc25 tyrosine phosphatases by B-type
cyclins: evidence for multiple roles of mitotic cyclins
JOURNAL Cell 67 (6), 1181-1194 (1991)
PUBMED 1836978
REFERENCE 9 (bases 1 to 3659)
AUTHORS Nagata,A., Igarashi,M., Jinno,S., Suto,K. and Okayama,H.
TITLE An additional homolog of the fission yeast cdc25+ gene occurs in
humans and is highly expressed in some cancer cells
JOURNAL New Biol. 3 (10), 959-968 (1991)
PUBMED 1662986
REFERENCE 10 (bases 1 to 3659)
AUTHORS Strausfeld,U., Labbe,J.C., Fesquet,D., Cavadore,J.C., Picard,A.,
Sadhu,K., Russell,P. and Doree,M.
TITLE Dephosphorylation and activation of a p34cdc2/cyclin B complex in
vitro by human CDC25 protein
JOURNAL Nature 351 (6323), 242-245 (1991)
PUBMED 1828290
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AK092713.1, BC051711.1,
S78187.1 and BX640836.1.
On May 7, 2004 this sequence version replaced gi:11641416.
Summary: CDC25B is a member of the CDC25 family of phosphatases.
CDC25B activates the cyclin dependent kinase CDC2 by removing two
phosphate groups and it is required for entry into mitosis. CDC25B
shuttles between the nucleus and the cytoplasm due to nuclear
localization and nuclear export signals. The protein is nuclear in
the M and G1 phases of the cell cycle and moves to the cytoplasm
during S and G2. CDC25B has oncogenic properties, although its role
in tumor formation has not been determined. Multiple transcript
variants for this gene exist. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (2), also known as CDC25B1, uses
an alternate splice site in the 5' coding region, compared to
variant 1, resulting in a shorter protein (isoform 2) compared to
isoform 1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: S78187.1, M81934.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025089, ERS025093 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-86 AK092713.1 16-101
87-556 BC051711.1 6-475
557-2458 S78187.1 19-1920
2459-3003 BC051711.1 2421-2965
3004-3624 BX640836.1 1984-2604
3625-3659 S78187.1 3084-3118
FEATURES Location/Qualifiers
source 1..3659
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="20"
/map="20p13"
gene 1..3659
/gene="CDC25B"
/note="cell division cycle 25B"
/db_xref="GeneID:994"
/db_xref="HGNC:1726"
/db_xref="HPRD:00307"
/db_xref="MIM:116949"
exon 1..978
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 69
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:183999341"
variation 158
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11569978"
variation 251
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:374054731"
misc_feature 470..472
/gene="CDC25B"
/note="upstream in-frame stop codon"
variation 568
/gene="CDC25B"
/replace="a"
/replace="t"
/db_xref="dbSNP:6116042"
variation 662
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:13038734"
variation 665..666
/gene="CDC25B"
/replace=""
/replace="c"
/db_xref="dbSNP:11462398"
variation 666..667
/gene="CDC25B"
/replace=""
/replace="c"
/db_xref="dbSNP:71678223"
variation 772
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11087603"
variation 775
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:372029025"
CDS 779..2479
/gene="CDC25B"
/EC_number="3.1.3.48"
/note="isoform 2 is encoded by transcript variant 2;
M-phase inducer phosphatase 2; dual specificity
phosphatase Cdc25B"
/codon_start=1
/product="M-phase inducer phosphatase 2 isoform 2"
/protein_id="NP_004349.1"
/db_xref="GI:4757950"
/db_xref="CCDS:CCDS13065.1"
/db_xref="GeneID:994"
/db_xref="HGNC:1726"
/db_xref="HPRD:00307"
/db_xref="MIM:116949"
/translation="
MEVPQPEPAPGSALSPAGVCGGAQRPGHLPGLLLGSHGLLGSPVRAAASSPVTTLTQTMHDLAGLGSRSRLTHLSLSRRASESSLSSESSESSDAGLCMDSPSPMDPHMAEQTFEQAIQAASRIIRNEQFAIRRFQSMPVRLLGHSPVLRNITNSQAPDGRRKSEAGSGAASSSGEDKENDGFVFKMPWKPTHPSSTHALAEWASRREAFAQRPSSAPDLMCLSPDRKMEVEELSPLALGRFSLTPAEGDTEEDDGFVDILESDLKDDDAVPPGMESLISAPLVKTLEKEEEKDLVMYSKCQRLFRSPSMPCSVIRPILKRLERPQDRDTPVQNKRRRSVTPPEEQQEAEEPKARVLRSKSLCHDEIENLLDSDHRELIGDYSKAFLLQTVDGKHQDLKYISPETMVALLTGKFSNIVDKFVIVDCRYPYEYEGGHIKTAVNLPLERDAESFLLKSPIAPCSLDKRVILIFHCEFSSERGPRMCRFIRERDRAVNDYPSLYYPEMYILKGGYKEFFPQHPNFCEPQDYRPMNHEAFKDELKTFRLKTRSWAGERSRRELCSRLQDQ
"
misc_feature 1073..1888
/gene="CDC25B"
/note="M-phase inducer phosphatase; Region:
M-inducer_phosp; pfam06617"
/db_xref="CDD:115287"
misc_feature 1214..1216
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00302"
misc_feature 1292..1294
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00277"
misc_feature 1295..1297
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00277"
misc_feature 1697..1699
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:06119"
misc_feature 1793..1795
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:04066"
misc_feature 1970..2329
/gene="CDC25B"
/note="Cdc25 phosphatases are members of the Rhodanese
Homology Domain superfamily. They activate the cell
division kinases throughout the cell cycle progression.
Cdc25 phosphatases dephosphorylate phosphotyrosine and
phosphothreonine residues, in order to...; Region: Cdc25;
cd01530"
/db_xref="CDD:29093"
misc_feature 2195..2215
/gene="CDC25B"
/note="oxyanion binding site; other site"
/db_xref="CDD:29093"
misc_feature 2195..2197
/gene="CDC25B"
/note="active site residue [active]"
/db_xref="CDD:29093"
variation 820
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11569979"
variation 838
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:375122468"
variation 889
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:368274446"
variation 953
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:372183442"
variation 965
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:145700972"
variation 973
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:373847564"
exon 979..1064
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 981
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:146567070"
variation 989
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:141031701"
variation 996
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:375803588"
variation 997
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:370072424"
variation 1021
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:201619391"
variation 1027
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:374599445"
variation 1036
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:147311787"
variation 1039
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:368877264"
variation 1049
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:199501910"
exon 1065..1116
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1084
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:371577332"
variation 1107
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:376436608"
variation 1108
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:148241851"
variation 1112
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:141382375"
variation 1114
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:139123058"
variation 1116
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:370155414"
exon 1117..1158
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1117
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:150375046"
variation 1145
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:137919521"
variation 1146
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:143386679"
variation 1155
/gene="CDC25B"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:143369164"
exon 1159..1195
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1170
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:111654983"
variation 1178
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:147172963"
variation 1179
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:371528141"
variation 1186
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:61755298"
variation 1189
/gene="CDC25B"
/replace="a"
/replace="t"
/db_xref="dbSNP:368675680"
variation 1190
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:140433155"
variation 1195
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:201436986"
exon 1196..1318
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1220
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:375465916"
variation 1223
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:201911534"
variation 1226
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:371350767"
variation 1248
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:373068861"
variation 1249
/gene="CDC25B"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:11552106"
variation 1256
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:367573455"
variation 1260
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:144359318"
variation 1265
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:199988612"
variation 1270
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:376072567"
exon 1319..1441
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1323
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:202155757"
variation 1367
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:368042199"
variation 1388
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:142459784"
variation 1406
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:200968688"
exon 1442..1576
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1444..1445
/gene="CDC25B"
/replace=""
/replace="a"
/db_xref="dbSNP:35741868"
variation 1448
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:111545759"
variation 1457
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:202222511"
variation 1458
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:201435494"
variation 1500
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:151315259"
variation 1512
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:372916640"
variation 1513
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:375854669"
variation 1514
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:202059655"
variation 1518
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:139531565"
variation 1571
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:373171092"
exon 1577..1657
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1592
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:144187197"
variation 1646
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:201902192"
variation 1656..1657
/gene="CDC25B"
/replace=""
/replace="a"
/db_xref="dbSNP:35824153"
exon 1658..1834
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1663
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:145108436"
variation 1681
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:200104998"
variation 1694
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:141314132"
variation 1701
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:375465349"
variation 1706
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:371407165"
variation 1718
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:149795416"
variation 1724
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:376224294"
variation 1767
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:369403610"
variation 1768
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:372954698"
variation 1771
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:61746575"
variation 1788
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:376488245"
variation 1789
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:2228465"
exon 1835..1930
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1843
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:143612466"
variation 1846
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11570010"
variation 1851
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:374005977"
variation 1886
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:376924240"
variation 1889
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:371158244"
variation 1904
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:138180783"
exon 1931..1993
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1954
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:371343744"
exon 1994..2092
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 2003
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:2228464"
variation 2010
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:376914644"
variation 2011
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:146556613"
variation 2030
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:199832947"
exon 2093..2226
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 2117
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:377681163"
variation 2118
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:138651339"
variation 2120
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:61742036"
variation 2122
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11570015"
variation 2125
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:141229949"
variation 2150
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:370128666"
variation 2152
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:1056720"
variation 2154
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:61755297"
variation 2194
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:374888909"
variation 2218
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:149394412"
variation 2222
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:199659921"
variation 2223
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:200957584"
exon 2227..2338
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 2308
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:146399677"
variation 2332
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:143897481"
exon 2339..3633
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 2353
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:374526361"
variation 2378
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:11570019"
variation 2422
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:368410035"
variation 2435
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:371947700"
variation 2442
/gene="CDC25B"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:514523"
variation 2443
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:514521"
variation 2462
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:369357260"
variation 2475
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:200551395"
variation 2488
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:371951429"
variation 2498
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:372117595"
variation 2517
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:375603041"
variation 2543
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:41279402"
variation 2544
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:2229592"
variation 2607
/gene="CDC25B"
/replace=""
/replace="t"
/db_xref="dbSNP:201707296"
variation 2690
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11570020"
variation 2701
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:368742502"
variation 2712
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:139271260"
variation 2720
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:55732615"
variation 2749
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:189019990"
variation 2829
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:6052085"
variation 2849
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:11087604"
variation 2855
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11087605"
variation 2923
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:142635163"
variation 2964..2965
/gene="CDC25B"
/replace=""
/replace="a"
/db_xref="dbSNP:35980638"
variation 2977
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11570021"
STS 3048..3384
/gene="CDC25B"
/standard_name="D20S1012"
/db_xref="UniSTS:32857"
variation 3118
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:181412320"
variation 3145..3166
/gene="CDC25B"
/replace=""
/replace="tacccactcggtcccagttttg"
/db_xref="dbSNP:71331068"
variation 3146..3167
/gene="CDC25B"
/replace=""
/replace="acccactcggtcccagttttgt"
/db_xref="dbSNP:11570022"
variation 3154
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:11570023"
variation 3216
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:367792437"
variation 3363
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:186687615"
variation 3438
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:1803263"
STS 3485..3609
/gene="CDC25B"
/standard_name="SHGC-30160"
/db_xref="UniSTS:79344"
variation 3508
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:8156"
variation 3552
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:3516"
polyA_signal 3608..3613
/gene="CDC25B"
polyA_site 3629
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
polyA_site 3633
/gene="CDC25B"
ORIGIN
gcagccagtcgcggaggcggggaggctgcgcggtcagaggcgcctggagcgagcgaatcctggcccaccgcctgcccaaccgcgtgaccttgattgagttaatgaacttcacgcctcagcgtccaggtctgtaaaatggggtgtctaacgcagaccgtacagcccagctgggtttagcaaacttccgggagccagttggagcctctccccatccctagcggtgatcccaggtgacgacatgccgcggggggtcctgcggaggccaccctagggcgttgctgctgcctttgggagtgtggagctccaaaccatgtcgcgagaggcggattttgggaggccgggatcctcgcgccagggggatgtgcgagggtgtgggataaatcttaattcctccggcccacccaaagcctggaaatccagcctccgcgcctcttgccctgcgggccccgccctcagtcccgccctcatctaacccgctaccccattggtggcgtccggcggcgcggctgctgttatttttcgaatatataaggaggtggaagtggcagctgcaactagaggcttccctggctggtgcctgagcccggcgtccctcgccccccgccctccccgcatccctctcctccctcgcgcctggccctgtggctcttcctccctccctccttccccccccccccacccctcgcccgctgcctccctcggcccagccagctgtgccggcgtttgttggctgccctgcgcccggccctccagccagccttctgccggccccgccgcgatggaggtgccccagccggagcccgcgccaggctcggctctcagtccagcaggcgtgtgcggtggcgcccagcgtccgggccacctcccgggcctcctgctgggatctcatggcctcctggggtccccggtgcgggcggccgcttcctcgccggtcaccaccctcacccagaccatgcacgacctcgccgggctcggcagccgcagccgcctgacgcacctatccctgtctcgacgggcatccgaatcctccctgtcgtctgaatcctccgaatcttctgatgcaggtctctgcatggattcccccagccctatggacccccacatggcggagcagacgtttgaacaggccatccaggcagccagccggatcattcgaaacgagcagtttgccatcagacgcttccagtctatgccggtgaggctgctgggccacagccccgtgcttcggaacatcaccaactcccaggcgcccgacggccggaggaagagcgaggcgggcagtggagctgccagcagctctggggaagacaaggagaatgatggatttgtcttcaagatgccatggaagcccacacatcccagctccacccatgctctggcagagtgggccagccgcagggaagcctttgcccagagacccagctcggcccccgacctgatgtgtctcagtcctgaccggaagatggaagtggaggagctcagccccctggccctaggtcgcttctctctgacccctgcagagggggatactgaggaagatgatggatttgtggacatcctagagagtgacttaaaggatgatgatgcagttcccccaggcatggagagtctcattagtgccccactggtcaagaccttggaaaaggaagaggaaaaggacctcgtcatgtacagcaagtgccagcggctcttccgctctccgtccatgccctgcagcgtgatccggcccatcctcaagaggctggagcggccccaggacagggacacgcccgtgcagaataagcggaggcggagcgtgacccctcctgaggagcagcaggaggctgaggaacctaaagcccgcgtcctccgctcaaaatcactgtgtcacgatgagatcgagaacctcctggacagtgaccaccgagagctgattggagattactctaaggccttcctcctacagacagtagacggaaagcaccaagacctcaagtacatctcaccagaaacgatggtggccctattgacgggcaagttcagcaacatcgtggataagtttgtgattgtagactgcagatacccctatgaatatgaaggcgggcacatcaagactgcggtgaacttgcccctggaacgcgacgccgagagcttcctactgaagagccccatcgcgccctgtagcctggacaagagagtcatcctcattttccactgtgaattctcatctgagcgtgggccccgcatgtgccgtttcatcagggaacgagaccgtgctgtcaacgactaccccagcctctactaccctgagatgtatatcctgaaaggcggctacaaggagttcttccctcagcacccgaacttctgtgaaccccaggactaccggcccatgaaccacgaggccttcaaggatgagctaaagaccttccgcctcaagactcgcagctgggctggggagcggagccggcgggagctctgtagccggctgcaggaccagtgaggggcctgcgccagtcctgctacctcccttgcctttcgaggcctgaagccagctgccctatgggcctgccgggctgagggcctgctggaggcctcaggtgctgtccatgggaaagatggtgtgggtgtcctgcctgtctgccccagcccagattcccctgtgtcatcccatcattttccatatcctggtgccccccacccctggaagagcccagtctgttgagttagttaagttgggttaataccagcttaaaggcagtattttgtgtcctccaggagcttcttgtttccttgttagggttaacccttcatcttcctgtgtcctgaaacgctcctttgtgtgtgtgtcagctgaggctgggggagagccgtggtccctgaggatgggtcagagctaaactccttcctggcctgagagtcagctctctgccctgtgtacttcccgggccagggctgcccctaatctctgtaggaaccgtggtatgtctgccatgttgcccctttctcttttcccctttcctgtcccaccatacgagcacctccagcctgaacagaagctcttactctttcctatttcagtgttacctgtgtgcttggtctgtttgactttacgcccatctcaggacacttccgtagactgtttaggttcccctgtcaaatatcagttacccactcggtcccagttttgttgccccagaaagggatgttattatccttgggggctcccagggcaagggttaaggcctgaatcatgagcctgctggaagcccagcccctactgctgtgaaccctggggcctgactgctcagaacttgctgctgtcttgttgcggatggatggaaggttggatggatgggtggatggccgtggatggccgtggatgcgcagtgccttgcatacccaaaccaggtgggagcgttttgttgagcatgacagcctgcagcaggaatatatgtgtgcctatttgtgtggacaaaaatatttacacttagggtttggagctattcaagaggaaatgtcacagaagcagctaaaccaaggactgagcaccctctggattctgaatctcaagatgggggcagggctgtgcttgaaggccctgctgagtcatctgttagggccttggttcaataaagcactgagcaagttgagaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:994 -> Molecular function: GO:0004725 [protein tyrosine phosphatase activity] evidence: TAS
GeneID:994 -> Molecular function: GO:0019901 [protein kinase binding] evidence: IPI
GeneID:994 -> Biological process: GO:0000086 [G2/M transition of mitotic cell cycle] evidence: TAS
GeneID:994 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
GeneID:994 -> Biological process: GO:0001556 [oocyte maturation] evidence: IEA
GeneID:994 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA
GeneID:994 -> Biological process: GO:0007067 [mitosis] evidence: IEA
GeneID:994 -> Biological process: GO:0007144 [female meiosis I] evidence: IEA
GeneID:994 -> Biological process: GO:0008284 [positive regulation of cell proliferation] evidence: TAS
GeneID:994 -> Biological process: GO:0032467 [positive regulation of cytokinesis] evidence: IMP
GeneID:994 -> Biological process: GO:0035335 [peptidyl-tyrosine dephosphorylation] evidence: TAS
GeneID:994 -> Biological process: GO:0045860 [positive regulation of protein kinase activity] evidence: IEA
GeneID:994 -> Biological process: GO:0045931 [positive regulation of mitotic cell cycle] evidence: IMP
GeneID:994 -> Biological process: GO:0051301 [cell division] evidence: IEA
GeneID:994 -> Cellular component: GO:0000922 [spindle pole] evidence: IDA
GeneID:994 -> Cellular component: GO:0005622 [intracellular] evidence: NAS
GeneID:994 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:994 -> Cellular component: GO:0005813 [centrosome] evidence: IDA
GeneID:994 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_004349 -> EC 3.1.3.48
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.