2025-09-18 11:57:20, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_003747 9599 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase (TNKS), mRNA. ACCESSION NM_003747 VERSION NM_003747.2 GI:87239980 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 9599) AUTHORS Ozaki,Y., Matsui,H., Asou,H., Nagamachi,A., Aki,D., Honda,H., Yasunaga,S., Takihara,Y., Yamamoto,T., Izumi,S., Ohsugi,M. and Inaba,T. TITLE Poly-ADP ribosylation of Miki by tankyrase-1 promotes centrosome maturation JOURNAL Mol. Cell 47 (5), 694-706 (2012) PUBMED 22864114 REMARK GeneRIF: The data suggest that PARsylation of Miki by tankyrase-1 is a key initial event promoting prometaphase. REFERENCE 2 (bases 1 to 9599) AUTHORS Kim,M.K., Dudognon,C. and Smith,S. TITLE Tankyrase 1 regulates centrosome function by controlling CPAP stability JOURNAL EMBO Rep. 13 (8), 724-732 (2012) PUBMED 22699936 REMARK GeneRIF: CPAP degradation and function is controlled by the poly(ADP-ribose) polymerase tankyrase 1. REFERENCE 3 (bases 1 to 9599) AUTHORS Bisht,K.K., Dudognon,C., Chang,W.G., Sokol,E.S., Ramirez,A. and Smith,S. TITLE GDP-mannose-4,6-dehydratase is a cytosolic partner of tankyrase 1 that inhibits its poly(ADP-ribose) polymerase activity JOURNAL Mol. Cell. Biol. 32 (15), 3044-3053 (2012) PUBMED 22645305 REMARK GeneRIF: GMD inhibits tankyrase 1 poly(ADP-ribose) polymerase activity in vitro, dependent on the GMD tankyrase 1 binding motif. In vivo, depletion of GMD led to degradation of tankyrase 1, dependent on the catalytic PARP activity of tankyrase 1. REFERENCE 4 (bases 1 to 9599) AUTHORS Inouye,M., Ripatti,S., Kettunen,J., Lyytikainen,L.P., Oksala,N., Laurila,P.P., Kangas,A.J., Soininen,P., Savolainen,M.J., Viikari,J., Kahonen,M., Perola,M., Salomaa,V., Raitakari,O., Lehtimaki,T., Taskinen,M.R., Jarvelin,M.R., Ala-Korpela,M., Palotie,A. and de Bakker,P.I. TITLE Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis JOURNAL PLoS Genet. 8 (8), E1002907 (2012) PUBMED 22916037 REFERENCE 5 (bases 1 to 9599) AUTHORS Gunaydin,H., Gu,Y. and Huang,X. TITLE Novel binding mode of a potent and selective tankyrase inhibitor JOURNAL PLoS ONE 7 (3), E33740 (2012) PUBMED 22438990 REMARK GeneRIF: crystal structure of the catalytic domain of TNKS1 in complex with IWR2, which reveals a novel binding site for tankyrase inhibitors REFERENCE 6 (bases 1 to 9599) AUTHORS Lyons,R.J., Deane,R., Lynch,D.K., Ye,Z.S., Sanderson,G.M., Eyre,H.J., Sutherland,G.R. and Daly,R.J. TITLE Identification of a novel human tankyrase through its interaction with the adaptor protein Grb14 JOURNAL J. Biol. Chem. 276 (20), 17172-17180 (2001) PUBMED 11278563 REFERENCE 7 (bases 1 to 9599) AUTHORS Chi,N.W. and Lodish,H.F. TITLE Tankyrase is a golgi-associated mitogen-activated protein kinase substrate that interacts with IRAP in GLUT4 vesicles JOURNAL J. Biol. Chem. 275 (49), 38437-38444 (2000) PUBMED 10988299 REFERENCE 8 (bases 1 to 9599) AUTHORS Smith,S. and de Lange,T. TITLE Cell cycle dependent localization of the telomeric PARP, tankyrase, to nuclear pore complexes and centrosomes JOURNAL J. Cell. Sci. 112 (PT 21), 3649-3656 (1999) PUBMED 10523501 REFERENCE 9 (bases 1 to 9599) AUTHORS Zhu,L., Smith,S., de Lange,T. and Seldin,M.F. TITLE Chromosomal mapping of the tankyrase gene in human and mouse JOURNAL Genomics 57 (2), 320-321 (1999) PUBMED 10198177 REFERENCE 10 (bases 1 to 9599) AUTHORS Smith,S., Giriat,I., Schmitt,A. and de Lange,T. TITLE Tankyrase, a poly(ADP-ribose) polymerase at human telomeres JOURNAL Science 282 (5393), 1484-1487 (1998) PUBMED 9822378 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AF082556.1, AL706619.1, BC098394.1 and AC104052.9. On Feb 14, 2006 this sequence version replaced gi:4507612. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF082556.1, BC098394.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025082, ERS025084 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1390 AF082556.1 1-1390 1391-1446 AL706619.1 475-530 1447-2409 AF082556.1 1447-2409 2410-3006 BC098394.1 2433-3029 3007-4134 AF082556.1 3007-4134 4135-9599 AC104052.9 10710-16174 c FEATURES Location/Qualifiers source 1..9599 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="8" /map="8p23.1" gene 1..9599 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /note="tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase" /db_xref="GeneID:8658" /db_xref="HGNC:11941" /db_xref="MIM:603303" exon 1..678 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 2 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:375949097" CDS 6..3989 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /EC_number="2.4.2.30" /note="TANK1; TNKS-1; tankyrase I; poly [ADP-ribose] polymerase 5A; TRF1-interacting ankyrin-related ADP-ribose polymerase; ADP-ribosyltransferase diphtheria toxin-like 5" /codon_start=1 /product="tankyrase-1" /protein_id="NP_003738.2" /db_xref="GI:87239981" /db_xref="CCDS:CCDS5974.1" /db_xref="GeneID:8658" /db_xref="HGNC:11941" /db_xref="MIM:603303" /translation="
MAASRRSQHHHHHHQQQLQPAPGASAPPPPPPPPLSPGLAPGTTPASPTASGLAPFASPRHGLALPEGDGSRDPPDRPRSPDPVDGTSCCSTTSTICTVAAAPVVPAVSTSSAAGVAPNPAGSGSNNSPSSSSSPTSSSSSSPSSPGSSLAESPEAAGVSSTAPLGPGAAGPGTGVPAVSGALRELLEACRNGDVSRVKRLVDAANVNAKDMAGRKSSPLHFAAGFGRKDVVEHLLQMGANVHARDDGGLIPLHNACSFGHAEVVSLLLCQGADPNARDNWNYTPLHEAAIKGKIDVCIVLLQHGADPNIRNTDGKSALDLADPSAKAVLTGEYKKDELLEAARSGNEEKLMALLTPLNVNCHASDGRKSTPLHLAAGYNRVRIVQLLLQHGADVHAKDKGGLVPLHNACSYGHYEVTELLLKHGACVNAMDLWQFTPLHEAASKNRVEVCSLLLSHGADPTLVNCHGKSAVDMAPTPELRERLTYEFKGHSLLQAAREADLAKVKKTLALEIINFKQPQSHETALHCAVASLHPKRKQVTELLLRKGANVNEKNKDFMTPLHVAAERAHNDVMEVLHKHGAKMNALDTLGQTALHRAALAGHLQTCRLLLSYGSDPSIISLQGFTAAQMGNEAVQQILSESTPIRTSDVDYRLLEASKAGDLETVKQLCSSQNVNCRDLEGRHSTPLHFAAGYNRVSVVEYLLHHGADVHAKDKGGLVPLHNACSYGHYEVAELLVRHGASVNVADLWKFTPLHEAAAKGKYEICKLLLKHGADPTKKNRDGNTPLDLVKEGDTDIQDLLRGDAALLDAAKKGCLARVQKLCTPENINCRDTQGRNSTPLHLAAGYNNLEVAEYLLEHGADVNAQDKGGLIPLHNAASYGHVDIAALLIKYNTCVNATDKWAFTPLHEAAQKGRTQLCALLLAHGADPTMKNQEGQTPLDLATADDIRALLIDAMPPEALPTCFKPQATVVSASLISPASTPSCLSAASSIDNLTGPLAELAVGGASNAGDGAAGTERKEGEVAGLDMNISQFLKSLGLEHLRDIFETEQITLDVLADMGHEELKEIGINAYGHRHKLIKGVERLLGGQQGTNPYLTFHCVNQGTILLDLAPEDKEYQSVEEEMQSTIREHRDGGNAGGIFNRYNVIRIQKVVNKKLRERFCHRQKEVSEENHNHHNERMLFHGSPFINAIIHKGFDERHAYIGGMFGAGIYFAENSSKSNQYVYGIGGGTGCPTHKDRSCYICHRQMLFCRVTLGKSFLQFSTMKMAHAPPGHHSVIGRPSVNGLAYAEYVIYRGEQAYPEYLITYQIMKPEAPSQTATAAEQKT
" misc_feature 627..971 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /note="ankyrin repeats; ankyrin repeats mediate protein-protein interactions in very diverse families of proteins. The number of ANK repeats in a protein can range from 2 to over 20 (ankyrins, for example). ANK repeats may occur in combinations with other...; Region: ANK; cd00204" /db_xref="CDD:29261" misc_feature 648..746 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O95271.2); Region: ANK 1" misc_feature 663..941 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:205076" misc_feature 747..845 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O95271.2); Region: ANK 2" misc_feature 846..944 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O95271.2); Region: ANK 3" misc_feature 1020..1172 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /note="Ankyrin repeats (many copies); Region: Ank_4; pfam13637" /db_xref="CDD:205814" misc_feature 1095..1430 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /note="ankyrin repeats; ankyrin repeats mediate protein-protein interactions in very diverse families of proteins. The number of ANK repeats in a protein can range from 2 to over 20 (ankyrins, for example). ANK repeats may occur in combinations with other...; Region: ANK; cd00204" /db_xref="CDD:29261" misc_feature 1098..1100 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (O95271.2); phosphorylation site" misc_feature 1107..1205 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O95271.2); Region: ANK 4" misc_feature 1122..1400 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:205076" misc_feature 1206..1304 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O95271.2); Region: ANK 5" misc_feature 1305..1403 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O95271.2); Region: ANK 6" misc_feature 1566..1673 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O95271.2); Region: ANK 7" misc_feature 1572..1922 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /note="ankyrin repeats; ankyrin repeats mediate protein-protein interactions in very diverse families of proteins. The number of ANK repeats in a protein can range from 2 to over 20 (ankyrins, for example). ANK repeats may occur in combinations with other...; Region: ANK; cd00204" /db_xref="CDD:29261" misc_feature 1581..1862 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:205076" misc_feature 1674..1772 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O95271.2); Region: ANK 8" misc_feature 1773..1871 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O95271.2); Region: ANK 9" misc_feature 2031..2396 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /note="ankyrin repeats; ankyrin repeats mediate protein-protein interactions in very diverse families of proteins. The number of ANK repeats in a protein can range from 2 to over 20 (ankyrins, for example). ANK repeats may occur in combinations with other...; Region: ANK; cd00204" /db_xref="CDD:29261" misc_feature 2052..2150 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O95271.2); Region: ANK 10" misc_feature 2067..2345 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:205076" misc_feature 2151..2249 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O95271.2); Region: ANK 11" misc_feature 2250..2348 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O95271.2); Region: ANK 12" misc_feature 2490..2840 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /note="ankyrin repeats; ankyrin repeats mediate protein-protein interactions in very diverse families of proteins. The number of ANK repeats in a protein can range from 2 to over 20 (ankyrins, for example). ANK repeats may occur in combinations with other...; Region: ANK; cd00204" /db_xref="CDD:29261" misc_feature 2511..2609 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O95271.2); Region: ANK 13" misc_feature 2526..2804 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:205076" misc_feature 2610..2708 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O95271.2); Region: ANK 14" misc_feature 2709..2807 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O95271.2); Region: ANK 15" misc_feature 3075..3272 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /note="SAM domain of tankyrase1,2 subfamily; Region: SAM_tankyrase1,2; cd09524" /db_xref="CDD:188923" misc_feature 3093..3266 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /note="SAM domain (Sterile alpha motif); Region: SAM_2; pfam07647" /db_xref="CDD:203706" misc_feature 3276..3944 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /note="Tankyrases interact with the telomere reverse transcriptase complex (TERT). Tankyrase 1 poly-ADP-ribosylates Telomere Repeat Binding Factor 1 (TRF1) while Tankyrase 2 can poly-ADP-ribosylate itself or TRF1. The tankyrases also contain multiple ankyrin...; Region: tankyrase_like; cd01438" /db_xref="CDD:30069" variation 32 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:200583768" variation 39 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:367708021" variation 50 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:112547145" variation 106 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:371322654" variation 135 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:201138981" variation 150 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:201993870" variation 159 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:368167994" variation 177 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:199903761" variation 220 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:372032670" variation 236 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:202025565" variation 244 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:146118607" variation 248 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:369426205" variation 279 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:373323688" variation 290 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:139926450" variation 295 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:149797804" variation 301 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:376761478" variation 304 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:200323172" variation 314 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:145737152" variation 338 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:148957874" variation 352 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:370818016" variation 379 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:374540073" variation 398 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:200824093" variation 407 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:377697995" variation 431 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:33985989" variation 432 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:147674490" variation 438 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:200230198" variation 439 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:199699778" variation 447 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:201402361" variation 449 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:35433754" variation 463 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:370539656" variation 464 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:147020772" variation 499 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:373923504" variation 525 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:34534956" variation 527 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:34464799" variation 549 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:374560573" variation 563 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:201469839" variation 566 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:140803272" variation 569 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:376233355" variation 584 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:371825172" variation 594..595 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="" /replace="c" /db_xref="dbSNP:35934562" variation 605 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:33945943" variation 610 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:138423475" variation 626 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:373769442" variation 644 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:367692888" variation 647 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:149276600" exon 679..903 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 695 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:372777869" variation 707 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:375073918" variation 711 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:201885608" variation 715 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:146176881" variation 726 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:200260123" variation 734 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:369007371" variation 776 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:137902255" variation 863 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:79117686" variation 890 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:34046308" variation 903 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:146167904" exon 904..999 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 918 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:201384024" variation 923 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:376192042" variation 943 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:199953003" variation 957 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:370316105" variation 959 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:373207143" exon 1000..1036 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 1029 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:201842298" exon 1037..1112 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 1039 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:201078116" variation 1052 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:61756245" variation 1077 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:373714842" variation 1099 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:142382274" exon 1113..1207 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 1135 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:373493403" variation 1177 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:377442646" exon 1208..1274 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 1268 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:374691135" exon 1275..1461 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 1276 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:376222441" variation 1297 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:139294552" variation 1325 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:374645879" variation 1373 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:34433162" variation 1391 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:7006985" variation 1394 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:368930379" variation 1395 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:201741994" variation 1438 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:140760765" variation 1439 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:33944167" variation 1455 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:147630037" exon 1462..1583 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 1476 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:372566002" variation 1480 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:79587922" variation 1520 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:56411177" variation 1536 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:375493489" variation 1559..1560 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="" /replace="c" /db_xref="dbSNP:34305756" variation 1561 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:188830245" variation 1562 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:370231803" variation 1566 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:373414511" variation 1581 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:375713264" exon 1584..1675 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 1590 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:370457489" variation 1592 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:368779508" variation 1663 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="" /replace="a" /db_xref="dbSNP:200458028" exon 1676..1754 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 1722 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:201355239" variation 1724 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:35052906" variation 1726 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:371506761" variation 1734 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:145392682" variation 1753 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:374807144" exon 1755..1926 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 1755 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:201404312" variation 1766 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:137883371" variation 1771 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:371434338" variation 1811 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:6601360" variation 1861 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:112075502" variation 1877 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:201559821" variation 1884 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:201334888" variation 1920 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:372624223" exon 1927..2006 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 1941 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:144610024" variation 1949 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:138926774" variation 1961 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:184946820" variation 1971 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:13280377" variation 1978 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:149437110" variation 1988 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:374285604" variation 2006 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:368780658" exon 2007..2152 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 2034 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:144777175" variation 2066 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:372527063" variation 2093 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:376984415" variation 2132 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:202202187" exon 2153..2318 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 2159 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:77413407" variation 2225 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:375885858" variation 2249 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:75390657" variation 2261 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:373431532" variation 2307 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:34016764" exon 2319..2538 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 2330 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:148570227" variation 2336 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:61752022" variation 2359 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:371535394" variation 2360 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:61995863" variation 2366 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:374665141" variation 2479 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:147259455" variation 2526 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:374523549" exon 2539..2648 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 2552 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:192449459" variation 2559 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:34915856" variation 2590 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:140823807" variation 2627 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:144582410" exon 2649..2837 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 2664 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:372645546" variation 2687 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:377210789" variation 2714 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:35491087" variation 2772 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:199759393" variation 2776 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:369068511" variation 2787 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:61756339" variation 2795 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:141384914" variation 2817 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:373055237" variation 2819 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:376610791" exon 2838..3075 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 2843 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:139610385" variation 2879 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:200640807" variation 2892 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:201930134" variation 2915 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:201271096" variation 2931 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:200533930" variation 2940 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:199621641" variation 2952 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:200672279" variation 2953 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:149754939" variation 2954 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:114570088" variation 2956 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:374610047" variation 2957 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:377463447" variation 2966 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:140368048" variation 2984 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:145459826" variation 3001 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:201811206" variation 3014 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:201607807" variation 3015 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:370349163" variation 3033 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:377231324" variation 3047 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:146441688" variation 3050 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:13265931" exon 3076..3158 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 3082 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:199978883" variation 3128 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:144586907" variation 3144 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:375751229" exon 3159..3279 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 3209 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:370745031" exon 3280..3377 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 3288 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:200255841" variation 3293 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:148202494" variation 3300 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:377707958" variation 3314 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:141570530" variation 3322 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:150495385" variation 3323 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:138329640" variation 3336 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:143946846" exon 3378..3452 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 3420 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:370453521" variation 3442 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:147302623" variation 3451 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:139110221" exon 3453..3558 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 3475 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:143138820" variation 3490 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:144670622" variation 3529 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:113046137" variation 3539 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:142219846" exon 3559..3745 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 3587 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:202149533" variation 3635 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:373127636" variation 3689 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:377301270" variation 3716 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:149009997" exon 3746..3902 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 3755 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:373913930" variation 3788 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:150786363" variation 3811 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:371350983" variation 3815 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:370028506" variation 3845 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:139420287" variation 3851 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:144079466" variation 3854 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:146492803" variation 3869 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:200026893" exon 3903..9599 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /inference="alignment:Splign:1.39.8" variation 3960..3961 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="" /replace="c" /db_xref="dbSNP:372693113" variation 3963 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:376965971" variation 3966 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:149703298" variation 3971 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:370002383" variation 3972 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:145459182" variation 3983 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:372614885" variation 3997 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:377213900" variation 4007 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:189437709" variation 4025 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:369239352" variation 4026 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:202229629" variation 4033 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:142076288" variation 4044 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:151161822" variation 4059..4061 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="" /replace="aac" /db_xref="dbSNP:373486675" variation 4159 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:192033466" variation 4170 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:375292112" variation 4203 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:140211601" variation 4218 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:79488099" variation 4310 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:185036568" variation 4336 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:145188514" variation 4382 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:147614367" variation 4425 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:142210048" variation 4438 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:200707417" variation 4449 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:201771712" variation 4451 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:190327205" variation 4516 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:181099465" variation 4520 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:186591383" variation 4523 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:146119290" variation 4526 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:188245939" variation 4561 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:367669222" variation 4613 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:138665265" variation 4617 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:7010154" variation 4629 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:376181083" variation 4645 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:181059216" variation 4687 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:74384847" variation 4702 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:148922406" variation 4729 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:143665670" variation 4740 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:372531683" variation 4747..4748 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="" /replace="caaagc" /db_xref="dbSNP:376591741" variation 4754 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:148103295" variation 4790 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:73533242" variation 4804 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:375522885" variation 4826 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:369449584" variation 4833 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:1567834" variation 4912 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:112157776" variation 4932 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:115349468" variation 4969 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:377704913" variation 4985 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:191159802" variation 5068 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:184102996" variation 5089 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:114345287" STS 5168..5297 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /standard_name="RH11883" /db_xref="UniSTS:25352" variation 5169 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:114598301" variation 5177 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:186560907" variation 5340 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:142854171" variation 5342 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:375054902" variation 5396 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:147639006" variation 5397 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:149707211" variation 5398 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="" /replace="a" /db_xref="dbSNP:10707070" variation 5398 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:200532914" variation 5406..5407 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="" /replace="at" /db_xref="dbSNP:199585800" variation 5437 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:114567832" variation 5457 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:191925720" variation 5465 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:145079359" variation 5512 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:182967083" variation 5513 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:17734024" variation 5536 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:187190402" variation 5552 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:116112276" variation 5634 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:370500949" variation 5655 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:191197688" variation 5665 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:182316977" variation 5780 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:138956270" variation 5840..5841 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="" /replace="c" /db_xref="dbSNP:35365922" variation 5868 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:142177304" STS 5880..6045 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /standard_name="RH103385" /db_xref="UniSTS:97711" variation 5916 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:186711208" variation 5929..5930 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="" /replace="t" /db_xref="dbSNP:146236868" STS 5936..6129 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /standard_name="SHGC-132382" /db_xref="UniSTS:184694" STS 5949..6057 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /standard_name="SHGC-24414" /db_xref="UniSTS:81158" variation 5970 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:116235840" variation 6028 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:150898783" variation 6095 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:376757023" variation 6108 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:79605882" variation 6127 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:28522162" variation 6269 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:139421787" variation 6290 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:116048270" variation 6292 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:118140142" variation 6353 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:78792275" variation 6370 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:115608999" variation 6376 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:116763133" variation 6387 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:3195872" variation 6445 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:192388392" variation 6520 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:149235665" variation 6526 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:114815446" variation 6570..6571 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="" /replace="c" /db_xref="dbSNP:34471182" variation 6570 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:185697954" variation 6594 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:116634913" variation 6703 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:377525495" variation 6704 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:370596511" variation 6722 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:114357368" variation 6772 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:114593480" variation 6783 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:144446176" variation 6784 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:188214336" variation 6947 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:148415547" variation 6999 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:193193470" variation 7018 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:368531355" variation 7021 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:184746023" variation 7061 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:17150469" variation 7079 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:2409596" variation 7132 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:145121823" variation 7142 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:147597841" variation 7167 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:140483356" variation 7256 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:188779270" variation 7300 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:144437591" variation 7308 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="" /replace="c" /db_xref="dbSNP:112322359" variation 7358 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:180799507" variation 7425 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:183652924" variation 7618 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:188361580" variation 7619 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:181956215" variation 7642 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:187655543" variation 7654 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:201104900" STS 7679..7832 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /standard_name="RH18302" /db_xref="UniSTS:28435" variation 7719 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:151213611" variation 7814 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:140399431" variation 7822 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:4841214" variation 7837 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:371423115" variation 7891 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:75341924" variation 7895 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:191574548" variation 7913 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:58961347" variation 7932 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:370798146" variation 7963 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:78542077" variation 8000 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:150390777" variation 8033 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:368148633" variation 8043 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:111263638" variation 8050 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:111986298" variation 8051 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:4841215" variation 8111 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:182099738" variation 8165 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:185411653" variation 8352 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:189978989" variation 8408 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:141256018" variation 8423 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:182608419" variation 8432 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:76060156" variation 8555 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:114524248" variation 8597 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:115264421" variation 8750 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:186472689" variation 8793 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:191063611" variation 8827 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:183827189" variation 8899 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="" /replace="a" /db_xref="dbSNP:34235298" variation 8918 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="g" /replace="t" /db_xref="dbSNP:189242183" variation 8930 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:116015687" variation 8947 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:192856043" variation 9059 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:1055328" variation 9097 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:7840300" variation 9113 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:12548832" variation 9165 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:377297433" variation 9172 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:1133783" variation 9263 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="t" /db_xref="dbSNP:187553060" variation 9265 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:10191" variation 9287 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:145044629" variation 9288 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:138890559" STS 9335..9539 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /standard_name="HSC2QE062" /db_xref="UniSTS:13182" variation 9363 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:142113862" variation 9368 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:143771738" variation 9372 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="t" /db_xref="dbSNP:148155663" STS 9373..9561 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /standard_name="A005X23" /db_xref="UniSTS:4933" STS 9373..9561 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /standard_name="G20573" /db_xref="UniSTS:4932" variation 9398 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="c" /replace="g" /db_xref="dbSNP:116326675" variation 9439 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="c" /db_xref="dbSNP:191674330" variation 9453 /gene="TNKS" /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1; TINF1; TNKS1" /replace="a" /replace="g" /db_xref="dbSNP:371823423" ORIGIN
cgaagatggcggcgtcgcgtcgctctcagcatcatcaccaccatcatcaacaacagctccagcccgccccaggggcttcagcgccgccgccgccacctcctcccccactcagccctggcctggccccggggaccaccccagcctctcccacggccagcggcctggcccccttcgcctccccgcggcacggcctagcgctgccggagggggatggcagtcgggatccgcccgacaggccccgatccccggacccggttgacggtaccagctgttgcagtaccaccagcacaatctgtaccgtcgccgccgctcccgtggtcccagcggtttctacttcatctgccgctggggtcgctcccaacccagccggcagtggcagtaacaattcaccgtcgtcctcttcttccccgacttcttcctcatcttcctctccatcctcccctggatcgagcttggcggagagccccgaggcggccggagttagcagcacagcaccactggggcctggggcagcaggacctgggacaggggtcccagcagtgagcggggccctacgggaactgctggaggcctgtcgcaatggggacgtgtcccgggtaaagaggctggtggacgcggcaaacgtaaatgcaaaggacatggccggccggaagtcttctcccctgcacttcgctgcaggttttggaaggaaggatgttgtagaacacttactacagatgggtgctaatgtccacgctcgtgatgatggaggtctcatcccgcttcataatgcctgttcttttggccatgctgaggttgtgagtctgttattgtgccaaggagctgatccaaatgccagggataactggaactatacacctctgcatgaagctgctattaaagggaagatcgatgtgtgcattgtgctgctgcagcacggagctgacccaaacattcggaacactgatgggaaatcagccctggacctggcagatccttcagcaaaagctgtccttacaggtgaatacaagaaagacgaactcctagaagctgctaggagtggtaatgaagaaaaactaatggctttactgactcctctaaatgtgaattgccatgcaagtgatgggcgaaagtcgactcctttacatctagcagcgggctacaacagagttcgaatagttcagcttcttcttcagcatggtgctgatgttcatgcaaaagacaaaggtggacttgtgcctcttcataatgcatgttcatatggacattatgaagtcacagaactgctactaaagcatggagcttgtgttaatgccatggatctctggcagtttactccactgcacgaggctgcttccaagaaccgtgtagaagtctgctctttgttacttagccatggcgctgatcctacattagtcaactgccatggcaaaagtgctgtggatatggctccaactccggagcttagggagagattgacttatgaatttaaaggtcattctttactacaagcagccagagaagcagacttagctaaagttaaaaaaacactcgctctggaaatcattaatttcaaacaaccgcagtctcatgaaacagcactgcactgtgctgtggcctctctgcatcccaaacgtaaacaagtgacagaattgttacttagaaaaggagcaaatgttaatgaaaaaaataaagatttcatgactcccctgcatgttgcagccgaaagagcccataatgatgtcatggaagttctgcataagcatggcgccaagatgaatgcactggacacccttggtcagactgctttgcatagagccgccctagcaggccacctgcagacctgccgcctcctgctgagttacggctctgacccctccatcatctccttacaaggcttcacagcagcacagatgggcaatgaagcagtgcagcagattctgagtgagagtacacctatacgtacttctgatgttgattatcgactcttagaggcatctaaagctggagacttggaaactgtgaagcaactttgcagctctcaaaatgtgaattgtagagacttagagggccggcattccacgcccttacacttcgcagcaggctacaaccgcgtgtctgttgtagagtacctgctacaccacggtgccgatgtccatgccaaagacaagggtggcttggtgccccttcataatgcctgttcatatggacactatgaggtggctgagcttttagtaaggcatggggcttctgtcaatgtggcggacttatggaaatttacccctctccatgaagcagcagctaaaggaaagtatgaaatctgcaagctccttttaaaacatggagcagatccaactaaaaagaacagagatggaaatacacctttggatttggtaaaggaaggagacacagatattcaggacttactgagaggggatgctgctttgttggatgctgccaagaagggctgcctggcaagagtgcagaagctctgtaccccagagaatatcaactgcagagacacccagggcagaaattcaacccctctgcacctggcagcaggctataataacctggaagtagctgaatatcttctagagcatggagctgatgttaatgcccaggacaagggtggtttaattcctcttcataatgcggcatcttatgggcatgttgacatagcggctttattgataaaatacaacacgtgtgtaaatgcaacagataagtgggcgtttactcccctccatgaagcagcccagaaaggaaggacgcagctgtgcgccctcctcctagcgcatggtgcagaccccaccatgaagaaccaggaaggccagacgcctctggatctggcaacagctgacgatatcagagctttgctgatagatgccatgcccccagaggccttacctacctgttttaaacctcaggctactgtagtgagtgcctctctgatctcaccagcatccaccccctcctgcctctcggctgccagcagcatagacaacctcactggccctttagcagagttggccgtaggaggagcctccaatgcaggggatggcgccgcgggaacagaaaggaaggaaggagaagttgctggtcttgacatgaatatcagccaatttctaaaaagccttggccttgaacaccttcgggatatctttgaaacagaacagattacactagatgtgttggctgatatgggtcatgaagagttgaaagaaataggcatcaatgcatatgggcaccgccacaaattaatcaaaggagtagaaagactcttaggtggacaacaaggcaccaatccttatttgacttttcactgtgttaatcagggaacgattttgctggatcttgctccagaagataaagaatatcagtcagtggaagaagagatgcaaagtactattcgagaacacagagatggtggtaatgctggcggcatcttcaacagatacaatgtcattcgaattcaaaaagttgtcaacaagaagttgagggagcggttctgccaccgacagaaggaagtgtctgaggagaatcacaaccatcacaatgagcgcatgttgtttcatggttctcctttcattaatgccattattcataaagggtttgatgagcgacatgcatacataggaggaatgtttggggccgggatttattttgctgaaaactcctcaaaaagcaaccaatatgtttatggaattggaggaggaacaggctgccctacacacaaggacaggtcatgctatatatgtcacagacaaatgctcttctgtagagtgacccttgggaaatcctttctgcagtttagcaccatgaaaatggcccacgcgcctccagggcaccactcagtcattggtagaccgagcgtcaatgggctggcatatgctgaatatgtcatctacagaggagaacaggcatacccagagtatcttatcacttaccagatcatgaagccagaagccccttcccagaccgcaacagccgcagagcagaagacctagtgaatgcctgctggtgaaggccagatcagatttcaacctgggactggattacagaggattgtttctaataacaacatcaatattctagaagtccctgacagcctagaaataagctgtttgtcttctataaagcattgctatagtgatgaatagtatgagtaactgatacatactcaactgctactgttccctttgaggaaatgtttacaggggcggccttttaacatatctcaggctcattttcattgcaattatccatttctaaaacaagattgcttcgatctagacttggaaatggaaaataagaaaaccaatgctttttcaaatgttcacaattcacacactacatttgttttgttatgcatgacgtgtctataacaaatatacacatacgacaggcaacaagcttgtttttgatttgccagacatgcatcattggctattgtttgtttgttttttgtttttttgtgttttttgggttactttgaaaatgagccagagccttcttgaggatattttgcacaaagtcacgctgacaaaatcattagcagtgcaacccaagcttctggctgagcaagattcagtttccactttttaaaatttttttattttgctctgtagctgcacttctcgttatcataaattgagatgaaaaggaaaaaacatcaagttttagtacctttttatgaattggcctatcttacaagagaagggcacaaacaccaacctgacttaggaacgcctaaattcagagaagtcaaagccggtgaaggccacttgctctttccaacacaagcctgccacagaggtcttcgggacagtactggagatgcaggttgacacgggcttgagttccaaggtgaaaaaactggggaggctgtgaaggaagagctgcattaaggagggtgaggagcgtgtggttctgtatcatggcagccccaatggatccaggggatgcctccaaaaaatacatgcttcccttcccttaatctgtactgttgggattgttacccctccaaattagctgccttatttcaaaagtcagtgaaattactgcacttgatgagggtcacaaaaataccacttgattgtttctttagttgagaatgctgggattcagactcgaatagtggatagatacacacaaatgcaaggacttttttgtttactccagatttggggtttattttgagtggcatgcttcaaatagttcataaagatccttgcattaaatttctgaaccatttcttcaaacttcttagtgtgtttagacaaggagaacaaaaattgaaaccaaagccctttctgttattttttcaatgaaggtgagaaagaaataccatacaattttctttgtgaaattactgtttattttcatcaacatttaccaagtgccattgacatttataaaaaaaaatgatcctttatagttcttacacttgcccttttcaccttaactgaatatgaattgagtgcactaacttatttacttgatatactgtgcatctactctgctttgaagcgaaagaaatataaacacgaggaggaataggaaagacagtgtgacacaaacttgccattgcaattcaaagccctgaaaacgatgggtttaatgcaaggtgattaagctgtgacctcctttaatctcctgaagcaaaataaaatggttacatgcaaaacttctagaaatagactcttaaaatatatacattttgctttgattttggcttcaacccagtgctggaactaggcatccagactagtttgaatgtttgtagctgaatttttatgggtcctcaaaattaaatcgagaattagcctcagttgttgcttcttttgaagtttcagtgacccaagctgggtgtttgtgtcttggctacttgtttaatagcactagaattccaggtgaagctttgagagttgatattcattaagagggctttttttccccttctttccttctcttttgctgtaacaaagggttgaagaaattgccatctgtgtagttttcagtagctgtcaagtgtgtcttacttaccttcccccagacgtagtttaaaatggtaaacacagctgtgatttttagttaagtaaaagagttaatatgatatagatatggaaagctttatggcttcattaaaaagataaaccactacctaactgtggttgtatgttgtttccatcatactaactagatgaatggatgcgccagttttcatcttggtccttacacttgagaagttaaactgtggttcagtatttaaactgccagtgttatacgtctcatgctctgtgtgccaggtgaaggtactgtgtaaggaagacatttgcggtgcttcttgtcctataatgattcaagtatatagtagttcttgaaagagtgtgcatatattactcatctgcttaagagagtgggttaatggatatatcagaggagccaaatacatttttttcagaacttgaaaaccaaaggtcatcatgagtgcactcaaaagttaggacaagtttattacatttgggattttcatctgtagccgtatgaagaaccctttccaatataaaagcatggcattaaattaggctgaagtcttttattttttgtatatgtactatatagaaatactagcaagttaggatcatccaatatggcctaccccgaaatggcccctctgtttccctaaccacatggaagaaagaatctgaacgtctccaccggctctacccgagttccaaaactaaagggcttctccagacctgatggttccagtttacctgctgttggcctgctggatacttgactcaggcataaattaagtgccctggtcccgaactttctccctgtatttgacctccttccctctttcctaaattactagtctggaattaaaattagctccagcaatgacctttgactccattcattttctcctcatcttgggtcttaaaaaaggagaccagatacctcctagcttttgtatcacaaccaggaatgggtattaggcctcatgcgctttgctcagaacactgccgctttgttaacaaatgacagcatggaacccagagttttgattcgatgcaaaataacagcagtgcaaccaggattcttgttttccttttccttcttggagtttggaatttctagcttttcaagcagcataagtagaatcaacattaggatgttttcatgaaatagcatccttatacttctttgagcttgatgttagtggctagactgatttccctttgctctcaaaatacaaagtgcattgaagtatacagagaaatgcctgaatatggcaagcaaataatgtagattaacattctattattgtatccgttttacaaaaaataaaattttgatatatgccggagaacggcattagaatgcaataagttgtctaggtttttctgtttcagtgtctctcccaatggcacgaagggttattgggcattgtccccacccccgcctttttaacatgtgcactatctggattcctgtaaatggccttgcaaacagaagtggtgtgtattttcaagcacctttcccccattgtatccgaatccctcttgtgtgatatctgtgacaaatagccttcttcttgtgttttctgttggactaattgtctcacgtaaagctatagaccttactaatttggcaggtattcaaaactgccattaagataggatttcatgtcagatacgtatttaaagagtaaagtcaaatttgtttaatgtcagatcagtgacagaagtgaaaagaaagtaattgtgaaagtgatgtttgagctattgtacacatctagcatatggaaagcaaatgcactcgaaaactactattctagaacatgaggcttcttcagcaacttgtgcactctgccattaataaattaaatttttcccctctagaaagccttaactatggcggaaactttttaaccttttatattttaataaataaaacattgtagtcccatttcttagtgtttgaaaggtgtgtcagtgagtcggccatgtctccatgtgtttcagacctgttcatcttattttatgatggtatatttcataagtaatattcccttacatgcaatggagctgattaaaattaatccatttcaatttctccatattggaacttcctcagctaccagatttctggtttggagaagtgctggaaagatttcaaagcctattcagttgtgtatgtggggatacgacagcaactgtgataccttgtagaatatgagtgatatgcaagctgtgttttttaattgttttaaaatgtaaattatggttatgctaaagtgaaaacctagaggaagctaatgattttatatactttgcacgaccaaatatggtcgtagtatgacgagttttatacattgccagagagttctgcctcctctgaaataacattcgcactgtagattgcatttcggcttttcctcctttcacattcttttttgctttacacttcacgtcttcgcacctgccctacctcccatcctttcaaagaggtttctttcacgttccagaattcagattgttctgtgatttcttttacatcagtctacccatttctgcaggcagccctgaaagcccttgtgttgattcagagtgtttgcagagaaatgcagttgaaccctggtagtggggtgtccctcacacacccgcgcacccctcccaaagttcaggatgaaaggctagaaaacccattcaaagttaggaaagaacacagatctttgaggccgatagcctagacctagaagatgaccttgagtatgtaaacattgtctccgtgacacaaaacactgaaactcttcatgtgcatataacacctgcttctgctcccattgtttcaagctcatcttatctttgtagtagtaatgtttgtctttgatacctacaaactaaaaaggtacttttatcaaggtttctcaaaacatttacaaaaccagctttgagaaaatgttatgttgcctggcaacagcactcggagtagtaattgtgttttctcattgtgatgttggtctgtgtgagcaaccagtgtagtgactctttggttcattattcgtgttgtttttatttttagtctctgtgtgacccaacagtggcaggggttacaaccccctctcctttcttttttgtatttatctatttgtaggattgtcagatcaagtacaagatgcccagttaagtttgaatttcagagaaacaatttcacgttaagaatgtttcatgcaatatttggcatatatttacagtaaaagcattcattatttgtctgaaattcaaatttaactgagcatgctggtttttctcattgtttggtttttctaaatctggcaatcctacagctgtggtcatgggaaatcacctacagcatgttaaagtcctctagtcatcatctcgtcacctgaaatggaagtcctttttccctcaccctccacttctttccaaaggagggcatcaaggaacttaacctgcctgcctggtgggtttctatttaagacatctttgtgattatatttaacctgcaattgtgctttggcttaatgtctagctcactgtacttgtaaatgattaatattcaataaaaccatttttaaagta
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:8658 -> Molecular function: GO:0003950 [NAD+ ADP-ribosyltransferase activity] evidence: IDA GeneID:8658 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:8658 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IDA GeneID:8658 -> Biological process: GO:0000209 [protein polyubiquitination] evidence: IDA GeneID:8658 -> Biological process: GO:0006471 [protein ADP-ribosylation] evidence: IDA GeneID:8658 -> Biological process: GO:0007052 [mitotic spindle organization] evidence: TAS GeneID:8658 -> Biological process: GO:0007067 [mitosis] evidence: IEA GeneID:8658 -> Biological process: GO:0015031 [protein transport] evidence: IEA GeneID:8658 -> Biological process: GO:0016055 [Wnt receptor signaling pathway] evidence: IEA GeneID:8658 -> Biological process: GO:0018105 [peptidyl-serine phosphorylation] evidence: IDA GeneID:8658 -> Biological process: GO:0018107 [peptidyl-threonine phosphorylation] evidence: IDA GeneID:8658 -> Biological process: GO:0032210 [regulation of telomere maintenance via telomerase] evidence: IC GeneID:8658 -> Biological process: GO:0032212 [positive regulation of telomere maintenance via telomerase] evidence: IDA GeneID:8658 -> Biological process: GO:0032212 [positive regulation of telomere maintenance via telomerase] evidence: IMP GeneID:8658 -> Biological process: GO:0043392 [negative regulation of DNA binding] evidence: IDA GeneID:8658 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IDA GeneID:8658 -> Biological process: GO:0051028 [mRNA transport] evidence: IEA GeneID:8658 -> Biological process: GO:0051225 [spindle assembly] evidence: TAS GeneID:8658 -> Biological process: GO:0051301 [cell division] evidence: IEA GeneID:8658 -> Biological process: GO:0070198 [protein localization to chromosome, telomeric region] evidence: IMP GeneID:8658 -> Biological process: GO:0070212 [protein poly-ADP-ribosylation] evidence: IDA GeneID:8658 -> Biological process: GO:0070213 [protein auto-ADP-ribosylation] evidence: IDA GeneID:8658 -> Biological process: GO:0090263 [positive regulation of canonical Wnt receptor signaling pathway] evidence: IMP GeneID:8658 -> Cellular component: GO:0000139 [Golgi membrane] evidence: IEA GeneID:8658 -> Cellular component: GO:0000242 [pericentriolar material] evidence: TAS GeneID:8658 -> Cellular component: GO:0000775 [chromosome, centromeric region] evidence: IEA GeneID:8658 -> Cellular component: GO:0000781 [chromosome, telomeric region] evidence: IDA GeneID:8658 -> Cellular component: GO:0000784 [nuclear chromosome, telomeric region] evidence: IDA GeneID:8658 -> Cellular component: GO:0000922 [spindle pole] evidence: IEA GeneID:8658 -> Cellular component: GO:0005643 [nuclear pore] evidence: TAS GeneID:8658 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IDA GeneID:8658 -> Cellular component: GO:0031965 [nuclear membrane] evidence: TAS ANNOTATIONS from NCBI Entrez Gene (20130726): NP_003738 -> EC 2.4.2.30
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.