Home |
Help |
Advanced search
2025-12-17 06:13:27, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001244190 5801 bp mRNA linear PRI 18-APR-2013
DEFINITION Homo sapiens KIAA0586 (KIAA0586), transcript variant 2, mRNA.
ACCESSION NM_001244190
VERSION NM_001244190.1 GI:346644662
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 5801)
AUTHORS Yin,Y., Bangs,F., Paton,I.R., Prescott,A., James,J., Davey,M.G.,
Whitley,P., Genikhovich,G., Technau,U., Burt,D.W. and Tickle,C.
TITLE The Talpid3 gene (KIAA0586) encodes a centrosomal protein that is
essential for primary cilia formation
JOURNAL Development 136 (4), 655-664 (2009)
PUBMED 19144723
REFERENCE 2 (bases 1 to 5801)
AUTHORS Davey,M.G., Paton,I.R., Yin,Y., Schmidt,M., Bangs,F.K.,
Morrice,D.R., Smith,T.G., Buxton,P., Stamataki,D., Tanaka,M.,
Munsterberg,A.E., Briscoe,J., Tickle,C. and Burt,D.W.
TITLE The chicken talpid3 gene encodes a novel protein essential for
Hedgehog signaling
JOURNAL Genes Dev. 20 (10), 1365-1377 (2006)
PUBMED 16702409
REMARK GeneRIF: The chicken ortholog functions in regulation of the Gli
repressor and activator proteins in the Hedgehog signaling pathway.
REFERENCE 3 (bases 1 to 5801)
AUTHORS Wood,R., Chumbler,F. and Wiegand,R.
TITLE Incorporation of dietary cis and trans isomers of octadecenoate in
lipid classes of liver and hepatoma
JOURNAL J. Biol. Chem. 252 (6), 1965-1970 (1977)
PUBMED 191447
REMARK GeneRIF: The chicken ortholog encodes a centrosomal protein
containing a highly conserved region necessary for ciliogenesis,
neural tube patterning, and Hedgehog signaling.
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AK302836.1, AB011158.1, AY359881.1, AL139021.6, AI378482.1 and
CN281643.1.
Transcript Variant: This variant (2) lacks an alternate segment in
the 5' coding region, uses a downstream start codon, and lacks
several alternate in-frame exons, compared to variant 1. This
results in a shorter protein (isoform 2), compared to isoform 1.
##Evidence-Data-START##
Transcript exon combination :: AB011158.1 [ECO:0000332]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-17 AK302836.1 1-17
18-1364 AB011158.1 1-1347
1365-2773 AY359881.1 1245-2653
2774-2774 AL139021.6 134344-134344
2775-3412 AY359881.1 2655-3292
3413-5081 AB011158.1 3396-5064
5082-5328 AI378482.1 1-247 c
5329-5801 CN281643.1 1-473 c
FEATURES Location/Qualifiers
source 1..5801
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="14"
/map="14q23.1"
gene 1..5801
/gene="KIAA0586"
/gene_synonym="Talpid3"
/note="KIAA0586"
/db_xref="GeneID:9786"
/db_xref="HGNC:19960"
/db_xref="MIM:610178"
exon 1..253
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 10..11
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace=""
/replace="t"
/db_xref="dbSNP:370910907"
variation 24..25
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace=""
/replace="ga"
/db_xref="dbSNP:370158049"
variation 30
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/db_xref="dbSNP:118123619"
misc_feature 160..162
/gene="KIAA0586"
/gene_synonym="Talpid3"
/note="upstream in-frame stop codon"
exon 254..445
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 261
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/db_xref="dbSNP:199554737"
variation 282
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:372215354"
CDS 292..4893
/gene="KIAA0586"
/gene_synonym="Talpid3"
/note="isoform 2 is encoded by transcript variant 2;
ortholog of chicken talpid{3}; protein TALPID3"
/codon_start=1
/product="protein TALPID3 isoform 2"
/protein_id="NP_001231119.1"
/db_xref="GI:346644663"
/db_xref="CCDS:CCDS58321.1"
/db_xref="GeneID:9786"
/db_xref="HGNC:19960"
/db_xref="MIM:610178"
/translation="
MPVKRLREVVSQNHGDHLVLLKDELPCVPPALSANKRLPVGTGTSLNGTSRGSSDLTSARNCYQPLLENPMVSESDFSKDVAVQVLPLDKIEENNKQKANDIFISQYTMGQKDALRTVLKQKAQSMPVFKEVKVHLLEDAGIEKDAVTQETRISPSGIDSATTVAAATAAAIATAAPLIKVQSDLEAKVNSVTELLSKLQETDKHLQRVTEQQTSIQRKQEKLHCHDHEKQMNVFMEQHIRHLEKLQQQQIDIQTHFISAALKTSSFQPVSMPSSRAVEKYSVKPEHPNLGSCNPSLYNTFASKQAPLKEVEDTSFDKQKSPLETPAPRRFAPVPVSRDDELSKRENLLEEKENMEVSCHRGNVRLLEQILNNNDSLTRKSESSNTTSLTRSKIGWTPEKTNRFPSCEELETTKVTMQKSDDVLHDLGQKEKETNSMVQPKESLSMLKLPDLPQNSVKLQTTNTTRSVLKDAEKILRGVQNNKKVLEENLEAIIRAKDGAAMYSLINALSTNREMSEKIRIRKTVDEWIKTISAEIQDELSRTDYEQKRFDQKNQRTKKGQNMTKDIRTNTQDKTVNKSVIPRKHSQKQIEEHFRNLPMRGMPASSLQKERKEGLLKATTVIQDEDYMLQVYGKPVYQGHRSTLKKGPYLRFNSPSPKSRPQRPKVIERVKGTKVKSIRTQTDFYATKPKKMDSKMKHSVPVLPHGDQQYLFSPSREMPTFSGTLEGHLIPMAILLGQTQSNSDTMPPAGVIVSKPHPVTVTTSIPPSSRKVETGVKKPNIAIVEMKSEKKDPPQLTVQVLPSVDIDSISNSSADVLSPLSSPKEASLPPVQTWIKTPEIMKVDEEEVKFPGTNFDEIIDVIQEEEKCDEIPDSEPILEFNRSVKADSTKYNGPPFPPVASTFQPTADILDKVIERKETLENSLIQWVEQEIMSRIISGLFPVQQQIAPSISVSVSETSEPLTSDIVEGTSSGALQLFVDAGVPVNSNVIKHFVNEALAETIAVMLGDREAKKQGPVATGVSGDASTNETYLPARVCTPLPTPQPTPPCSPSSPAKECVLVKTPDSSPCDSDHDMAFPVKEICAEKGDDMPAIMLVNTPTVTPTTTPPPAAAVFTPTLSDISIDKLKVSSPELPKPWGDGDLPLEEENPNSPQEELHPRAIVMSVAKDEEPESMDFPAQPPPPEPVPFMPFPAGTKAPSPSQMPGSDSSTLESTLSVTVTETETLDKPISEGEILFSCGQKLAPKILEDIGLYLTNLNDSLSSTLHDAVEMEDDPPSEGQVIRMSHKKFHADAILSFAKQNQESAVSQQAVYHSEDLENSVGELSEGQRPQLTAAAENILMGHSLYMQPPVTNTQSLDQQCDPKPLSRQFDTVSGSIYEDSCASHGPMSLGELELEPNSKLVLPTTLLTAQENDVNLPVAAEDFSQYQLKQNQDVKQVEHKPSQSYLRVRNKSDIAPSQQQVSPGDMDRTQIELNPYLTCVFSGGKAVPLSASQMPPAKMSVMLPSVNLEDCSQSLSLSTMQEDMESSGADTF
"
misc_feature 1690..1953
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9BVV6.4);
Region: Required for centrosomal localization (By
similarity)"
variation 310
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:202124602"
variation 346
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="g"
/replace="t"
/db_xref="dbSNP:186659284"
variation 363
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:190089844"
variation 413
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:201315284"
variation 417
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:372659413"
variation 428
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:183168709"
exon 446..516
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 448
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="t"
/db_xref="dbSNP:147119902"
variation 461
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:201393625"
variation 483
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:370677508"
variation 503
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:74055693"
exon 517..586
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 532
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:189943424"
variation 557
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:376005040"
variation 575
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:373836349"
exon 587..656
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 593
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:376113173"
variation 609
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="g"
/replace="t"
/db_xref="dbSNP:368352741"
variation 613
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="t"
/db_xref="dbSNP:183240083"
variation 641
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/db_xref="dbSNP:200627657"
exon 657..831
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 668
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:61735931"
variation 728
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:11622776"
variation 778
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:374972438"
variation 822
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:369143869"
exon 832..1053
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 838
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:375374719"
variation 846
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:61738360"
variation 866
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:199837404"
variation 889
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:201097695"
variation 944
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:193056942"
variation 969
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:373333959"
variation 976
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/db_xref="dbSNP:376338487"
variation 1029
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:370332963"
variation 1031
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:376289224"
exon 1054..1207
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 1058
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:368574051"
variation 1096
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:371179268"
variation 1115
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/db_xref="dbSNP:186378072"
variation 1184
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:191232589"
exon 1208..1375
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 1220
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="t"
/db_xref="dbSNP:144456198"
variation 1302
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:148006211"
variation 1314
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:376048205"
variation 1323
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:199623501"
variation 1326
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/db_xref="dbSNP:200094677"
variation 1330
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="t"
/db_xref="dbSNP:371365932"
variation 1343
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="t"
/db_xref="dbSNP:59248588"
variation 1355
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:369845308"
variation 1365
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:1748971"
exon 1376..1499
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 1389
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:370408761"
variation 1476
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:10135645"
variation 1483
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:377325998"
variation 1486
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:147844088"
exon 1500..1608
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 1505
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:187783779"
variation 1515
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:190675549"
variation 1582
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:371477725"
exon 1609..1829
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 1639
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:376681702"
variation 1653
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="g"
/replace="t"
/db_xref="dbSNP:200446131"
variation 1669
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:78468862"
variation 1685
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:61745119"
variation 1690
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:375472516"
variation 1691
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:369211190"
variation 1768
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:61745095"
variation 1816
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="t"
/db_xref="dbSNP:61742715"
exon 1830..1902
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 1899
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:374601841"
exon 1903..2130
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 2031
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="t"
/db_xref="dbSNP:371990780"
variation 2125
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:191704222"
exon 2131..2305
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 2149
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:375173927"
variation 2163
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="g"
/replace="t"
/db_xref="dbSNP:376649351"
variation 2208
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:199777168"
variation 2233
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:370560098"
variation 2236
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:202025419"
variation 2256
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:185266107"
variation 2278
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:190081177"
exon 2306..2500
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 2323
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:200735064"
variation 2338
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="g"
/replace="t"
/db_xref="dbSNP:371583234"
variation 2369
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:373601253"
variation 2391
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="t"
/db_xref="dbSNP:78009437"
variation 2409
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:368904420"
variation 2447
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/db_xref="dbSNP:372160214"
variation 2473
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:192490416"
exon 2501..2688
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 2504
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:369552863"
variation 2541
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:200937470"
variation 2600
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:372212501"
variation 2615
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="g"
/replace="t"
/db_xref="dbSNP:376797336"
variation 2618
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="t"
/db_xref="dbSNP:78460691"
variation 2632
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:369070060"
variation 2642
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:369850927"
variation 2671
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:201629494"
variation 2683
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:373130060"
exon 2689..2799
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 2695
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/db_xref="dbSNP:370111393"
variation 2732
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:200219991"
variation 2749
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/db_xref="dbSNP:113040775"
variation 2757
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:377409718"
variation 2774
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:1748986"
variation 2777
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:200490147"
variation 2779
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:377023593"
exon 2800..2880
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 2803
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:367573993"
variation 2804
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:45478500"
variation 2830
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:372915104"
variation 2835
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:374585380"
variation 2841
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="g"
/replace="t"
/db_xref="dbSNP:368361783"
variation 2876
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:377015806"
variation 2877
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:367998141"
exon 2881..3071
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 2981
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:139493302"
variation 2982
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:368984896"
variation 2984
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:202051871"
variation 3052
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:61974537"
exon 3072..3190
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 3077
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="t"
/db_xref="dbSNP:181400417"
variation 3078
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:373201020"
variation 3090
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:374762003"
variation 3130
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="t"
/db_xref="dbSNP:376119494"
variation 3154
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:368808852"
variation 3158
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:3783696"
variation 3189
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="g"
/replace="t"
/db_xref="dbSNP:370778483"
exon 3191..3390
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 3230
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:368583200"
variation 3249
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:199537542"
variation 3284
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:375690080"
variation 3288
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:368251704"
variation 3292
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:141771152"
variation 3293
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:372259984"
variation 3299
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:182274649"
variation 3306
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="g"
/replace="t"
/db_xref="dbSNP:201263653"
variation 3350
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:77860620"
variation 3356
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/db_xref="dbSNP:367811307"
variation 3375
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:371456681"
variation 3381
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:374691292"
variation 3389
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:369859399"
exon 3391..3550
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 3412
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/db_xref="dbSNP:1617510"
variation 3429
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:369590767"
variation 3493
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:373431045"
variation 3512
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:187091758"
variation 3523
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:77810875"
variation 3529
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:140565291"
variation 3538
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:374459469"
exon 3551..3773
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 3614
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:377332917"
variation 3620
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:201898983"
variation 3653
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:200148591"
variation 3693..3694
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace=""
/replace="a"
/db_xref="dbSNP:368765650"
variation 3696
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/db_xref="dbSNP:199517530"
variation 3710
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:3929708"
variation 3713
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:200085678"
exon 3774..4027
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 3799
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:200722491"
variation 3802
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:368136238"
variation 3810
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:371957302"
variation 3826
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:373763986"
variation 3847
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/db_xref="dbSNP:376675866"
variation 3850
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:199743989"
variation 3870
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/db_xref="dbSNP:367676896"
variation 3890
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:201709033"
variation 3891
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:375360391"
variation 3909
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="g"
/replace="t"
/db_xref="dbSNP:201202020"
variation 3934
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:143158234"
variation 3944
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/db_xref="dbSNP:201702546"
variation 3959
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="t"
/db_xref="dbSNP:369318614"
variation 3961
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:201889432"
variation 3965
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:190271845"
variation 3975
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:377467641"
variation 4020
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/db_xref="dbSNP:199982600"
exon 4028..4104
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 4032
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:374590484"
variation 4051
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:377000129"
variation 4087
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:371424977"
variation 4095
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:113191202"
variation 4096
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:374292446"
variation 4102
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:377275619"
exon 4105..4236
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 4107
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:188676684"
variation 4108
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:181413894"
variation 4137..4138
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace=""
/replace="a"
/db_xref="dbSNP:35666852"
variation 4166
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:3783697"
variation 4171
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:376234883"
variation 4226
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:201929144"
variation 4234
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:373649439"
exon 4237..4414
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 4293
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:61729923"
variation 4359
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:200906427"
variation 4371
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:148016417"
variation 4380
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="g"
/replace="t"
/db_xref="dbSNP:369759253"
variation 4383
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:372138430"
variation 4406
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:376795880"
variation 4408
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:369067010"
variation 4412
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:373357386"
exon 4415..4569
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 4444
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/db_xref="dbSNP:140874828"
variation 4452
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="c"
/db_xref="dbSNP:369935221"
variation 4457
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:192561585"
variation 4551
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:144692893"
variation 4552
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:202235093"
variation 4561
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="g"
/replace="t"
/db_xref="dbSNP:200405048"
exon 4570..4675
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 4571
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:200127338"
variation 4572
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:139175231"
exon 4676..4741
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
variation 4682
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/db_xref="dbSNP:374096160"
variation 4707
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:11611"
variation 4718
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:370303493"
exon 4742..5792
/gene="KIAA0586"
/gene_synonym="Talpid3"
/inference="alignment:Splign:1.39.8"
STS 4756..5045
/gene="KIAA0586"
/gene_synonym="Talpid3"
/standard_name="WI-20905"
/db_xref="UniSTS:31105"
variation 4765
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:140026883"
variation 4799
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:377020452"
variation 4806
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:45568037"
variation 4818
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:371910625"
variation 4819
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:375085808"
STS 4829..4961
/gene="KIAA0586"
/gene_synonym="Talpid3"
/standard_name="RH15628"
/db_xref="UniSTS:59832"
STS 4845..4969
/gene="KIAA0586"
/gene_synonym="Talpid3"
/standard_name="D14S696E"
/db_xref="UniSTS:151575"
variation 4869
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:188723128"
variation 4873..4877
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace=""
/replace="tcggg"
/db_xref="dbSNP:199504537"
variation 4875
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:61745066"
variation 4890
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="g"
/db_xref="dbSNP:373503925"
variation 4895
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:376691503"
variation 4970
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:375948139"
variation 4998
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:74607305"
variation 5120
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:370422091"
variation 5172
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:369997201"
variation 5236
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:139596781"
variation 5242
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:374397560"
variation 5243
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:149751065"
STS 5296..5434
/gene="KIAA0586"
/gene_synonym="Talpid3"
/standard_name="G30978"
/db_xref="UniSTS:64038"
variation 5321
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:145442381"
variation 5335
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="c"
/replace="t"
/db_xref="dbSNP:11545286"
variation 5338
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:139072701"
variation 5384
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="t"
/db_xref="dbSNP:181452208"
variation 5413
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:185323978"
variation 5553
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="g"
/replace="t"
/db_xref="dbSNP:74058013"
variation 5589
/gene="KIAA0586"
/gene_synonym="Talpid3"
/replace="a"
/replace="g"
/db_xref="dbSNP:144014186"
ORIGIN
aatttacctaatcccacgtccctaacggtcttcggaagcgaagcagtgtcaacagtccctggtaaacacaagtagtattacaagtcgggagctcttcaagtcttggatgagactgtagagcggtcttgtgcggcaatgtgctaccttaaaataaataaataaataaacccctgttatgtccggagtttgtttccacccggagaggaatggaagagcaccagagagcgcttagctttctggttggatgttttgggctctgaggtcagcttggagaagaaaaaaaagattaagatgccagtgaagagacttcgtgaggtagtttctcaaaatcatggagatcatttggttttgctgaaagatgagttgccctgtgttcctccggcattgtctgcaaataaacgtcttcctgttggaacggggactagtttgaatggaacatcacgtggttcatcagacttaacttctgctagaaattgttaccagcctctattagaaaatcccatggtgtcagaaagtgatttttctaaagacgttgcagtgcaagtgttgcctttggataaaatagaagagaacaacaagcaaaaagcaaatgacatcttcatttctcagtatacaatgggacagaaagatgctctaagaacagttttaaagcaaaaagctcaaagcatgcctgtttttaaggaagtaaaggtacatctgttagaagatgcaggcatagagaaggatgctgttactcaggagactagaatttcacccagtggaattgattcagctacaaccgtggctgcagcaactgctgctgccattgcaaccgcagctccgttgataaaggtgcagagtgatttggaagcaaaagtcaattctgttacagaattacttagtaaattacaggagactgataaacacctgcaacgtgttacagagcagcaaacaagcattcagaggaaacaagagaaattacattgtcatgatcacgaaaagcaaatgaatgtgtttatggagcagcacataaggcatcttgaaaagttacaacaacaacaaatagatattcagactcattttattagtgctgcactcaagactagtagttttcagcctgttagtatgccctcctccagagcagtggaaaagtattccgtaaaaccagaacaccctaatcttggtagctgtaatccatctttatataacacatttgcttccaaacaagcacctttaaaagaagttgaagatacgagttttgataaacagaaatctcctttggagacaccagcacctcgcagatttgctcctgtacctgtttcaagggatgatgaactatcaaagagggaaaatcttttggaagaaaaagaaaatatggaagtgtcgtgtcacagaggaaatgtaagactattggaacaaattttgaataataatgattctttgacaagaaaaagtgaatcatcaaacaccacctcactaactaggtcaaaaataggatggactcctgagaaaacaaacagatttccttcctgtgaagagctagaaacaactaaagtgactatgcagaagtctgatgatgttcttcatgaccttggccaaaaagagaaagaaacaaatagcatggtccagccaaaagaatctctgagtatgttgaagcttccagatcttccacagaattctgttaagcttcaaacaaccaatacaacaagatctgtattgaaagatgctgagaagattttgagaggagtacaaaacaataaaaaagtacttgaagaaaacctggaagctattattcgtgcaaaagatggagctgccatgtattcgcttatcaatgctttatctaccaacagagagatgtcagagaaaattaggatcagaaagacagtggatgaatggattaaaactatttctgcagaaattcaggatgaactgtcaagaacagattatgaacaaaaaagatttgatcagaagaatcagagaaccaagaaaggtcagaatatgactaaagatattagaaccaacacacaagataaaactgtcaacaaatctgtaattccaagaaaacattctcaaaagcaaatagaagagcattttagaaatctacctatgaggggcatgcctgcttcaagtttacagaaagagagaaaggaagggcttttgaaagcaaccacagtaatacaagatgaagattatatgttacaagtctatggaaagccagtttatcagggccatcgaagcactcttaaaaaaggaccatatctcagatttaattctccatctcctaagtccagaccacagagaccaaaagtaatagaacgagttaaaggcactaaggtaaagtcaataagaacacagactgacttctatgcaacaaaacctaagaagatggattctaaaatgaaacattctgttcctgtgttacctcatggcgatcagcaatatttgttcagcccaagtagagaaatgcctactttttcaggtacattggaaggtcatctgattcctatggcaattcttttaggacaaacccaaagtaatagtgataccatgccacctgctggagtgattgtcagcaagccacaccctgtaactgtgactacttctattcctccatcatctcgaaaagtagaaactggagtaaagaaacctaacatagccattgtagaaatgaagtcagaaaaaaaggatcctcctcagcttactgtgcaggtattacccagtgtagatattgacagcatttcaaatagtagtgctgatgtcctttcacctctgtctagccccaaagaagcatctcttcctcctgtgcaaacttggataaagactccagaaattatgaaggtagatgaagaagaggtgaagtttccaggaactaactttgatgaaataatcgatgtcatacaggaagaagaaaaatgtgatgaaattccagactctgaaccaattctggagtttaacagaagtgttaaagctgattctacaaaatataatggtcctccatttccgccagttgcttctacttttcagcccactgctgatattctggataaagtaattgagagaaaagaaacactggaaaatagcttaattcaatgggtagagcaagaaataatgtcaagaattatctctgggctctttccagtccagcaacagattgcacctagtatcagtgtttcagtcagtgagacaagtgaaccactgacttctgacattgtggaaggaacaagcagtggcgccctccagctttttgttgatgctggtgttcctgtgaactcaaatgtgattaaacattttgttaacgaagctcttgctgagaccattgctgtcatgctgggtgacagagaagcaaagaagcaaggtcctgttgctacaggtgtttctggggatgcttcaacaaatgaaacatatttgccggcaagagtgtgcaccccactgcctaccccacagcctacgcctccttgctcaccttcatcacctgctaaggagtgtgttttggtaaagactccagattcttctccctgtgattcggatcatgatatggcttttcctgtgaaagaaatatgtgctgaaaaaggagatgatatgcctgccatcatgcttgttaatactccaacagttacccctactactacacctcctccagcggcggcagtttttaccccaactttgtcagatatttccattgataaattgaaggtatcaagcccagagcttcccaagccatggggtgatggagacctgccactggaagaagagaaccctaactcacctcaagaagaacttcatccaagagctattgtaatgtctgtggctaaggatgaagaaccagagagtatggatttccctgctcagcctccacctccagagccagttccctttatgccatttcctgccggcaccaaggccccttccccctcacagatgccaggttctgattcatcaacactggagagcacattgagtgttactgtcactgaaactgaaactttagataaacccatctctgaaggagagattttatttagctgtggtcaaaaattggcccccaagattttagaagatataggactgtacctgacaaaccttaatgatagcttatccagcactctgcatgatgccgttgaaatggaggatgatcctcctagtgaagggcaagtgattaggatgtcccataaaaaatttcatgcagatgcaattctttcttttgctaaacaaaaccaggagtcagcagtttcccagcaagcagtctatcattcagaggacttggaaaacagtgtgggtgaacttagtgaaggacaaagaccccagctaacagcggcagcagagaacatcttaatgggacattctctctatatgcagccacctgtcactaatacacagtctttggatcaacaatgtgatcctaaaccattatctcggcaatttgacacagtttcaggtagtatttatgaagattcatgtgctagtcatggtccaatgagtttgggagaattggagttggagccaaattctaagctggttcttcccacaacacttctgacagcacaagaaaatgatgttaatttaccagtagccgctgaagatttttcccagtaccaactaaagcaaaatcaggatgttaagcaagttgaacacaaaccatcacaaagttacctacgtgttagaaataaatctgatattgcaccttcacagcaacaagtttcaccaggtgatatggatcggacacaaattgagcttaatccgtacctcacatgtgtattttcaggtgggaaagcagtgccactctccgcttcacagatgccccctgccaagatgtcagtgatgctgccgtcagtgaacctcgaggactgctctcagtctctgagtctcagcacaatgcaggaggacatggagtcttcgggggcagataccttctgaacgggaagagacagccagcacagtgtttatgccactggttttaaagtcattttaccttggcttaaaaccctctctcagactgtttggtttttgagcatattctgaaaaaaaaattccaatattttaaaataaaacaaaaagcataatttgggtatttaaagtttttaaataaaataagtataagtcattataagtctgattgtgagttgtttcttagaatcctgagatagcatagagtagtgaaagggcatggcttttgacatctaggcatttaatctataggtgtaattatctgtatgtatttataaaattatgtagctcaaggttattcattctaacatttttataacagcaaatagaaaaaatcaaatgtctatcaataatagactggttttaaagtgatggtacatcagtacaatggaatactatgtattacaaaaaaaaatttaaaaagtttattgatatggaataatctttgagatgcactgttaaagtgaaaaaagccatgtgcaaaatagtgtgtgaactatgcagttgttgaaattatttaaaatggggtggggaggaattcaaatgtatggtatgtcacatattcttacatgtatttgcttgtaaatatattatataaacaagaaactgctaagtttgtctccagggagtagaattgttggctgggtgataggagaggctaagtgataggaatcaaggataatcgtggttactatgtatttgaacttcagttgtgatagaaaaaaatcatcagtgagattaatttttatatgccttatgtataccatataaacctttataaacctgtgaaacatgtaactctattaccttttgcaacataaatacataaaattaaaggaaaataaaaagcattgcttcgtaatcagataaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:9786 -> Biological process: GO:0007224 [smoothened signaling pathway] evidence: ISS
GeneID:9786 -> Biological process: GO:0060271 [cilium morphogenesis] evidence: ISS
GeneID:9786 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
GeneID:9786 -> Cellular component: GO:0005813 [centrosome] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.