Home |
Help |
Advanced search
2025-05-09 17:31:26, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001172335 3246 bp mRNA linear PRI 01-JUL-2013
DEFINITION Homo sapiens plastin 3 (PLS3), transcript variant 3, mRNA.
ACCESSION NM_001172335
VERSION NM_001172335.1 GI:288915538
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3246)
AUTHORS Yokobori,T., Iinuma,H., Shimamura,T., Imoto,S., Sugimachi,K.,
Ishii,H., Iwatsuki,M., Ota,D., Ohkuma,M., Iwaya,T., Nishida,N.,
Kogo,R., Sudo,T., Tanaka,F., Shibata,K., Toh,H., Sato,T.,
Barnard,G.F., Fukagawa,T., Yamamoto,S., Nakanishi,H., Sasaki,S.,
Miyano,S., Watanabe,T., Kuwano,H., Mimori,K., Pantel,K. and Mori,M.
TITLE Plastin3 is a novel marker for circulating tumor cells undergoing
the epithelial-mesenchymal transition and is associated with
colorectal cancer prognosis
JOURNAL Cancer Res. 73 (7), 2059-2069 (2013)
PUBMED 23378342
REMARK GeneRIF: Overexpression of PLS3 is associated with
epithelial-mesenchymal transition and is associated with metastasis
in colorectal cancer
REFERENCE 2 (bases 1 to 3246)
AUTHORS Michel,L., Jean-Louis,F., Begue,E., Bensussan,A. and Bagot,M.
TITLE Use of PLS3, Twist, CD158k/KIR3DL2, and NKp46 gene expression
combination for reliable Sezary syndrome diagnosis
JOURNAL Blood 121 (8), 1477-1478 (2013)
PUBMED 23429988
REMARK GeneRIF: PLS3, Twist, KIR3DL2 and NKp46 gene expression can model
efficient molecular Sezary syndrome diagnosis.
REFERENCE 3 (bases 1 to 3246)
AUTHORS Su,H., Zhu,J., Cai,C., Pei,W., Wang,J., Dong,H. and Ren,H.
TITLE FIMBRIN1 is involved in lily pollen tube growth by stabilizing the
actin fringe
JOURNAL Plant Cell 24 (11), 4539-4554 (2012)
PUBMED 23150633
REFERENCE 4 (bases 1 to 3246)
AUTHORS Jones,C.L., Ferreira,S., McKenzie,R.C., Tosi,I., Caesar,J.A.,
Bagot,M., Whittaker,S.J. and Mitchell,T.J.
TITLE Regulation of T-plastin expression by promoter hypomethylation in
primary cutaneous T-cell lymphoma
JOURNAL J. Invest. Dermatol. 132 (8), 2042-2049 (2012)
PUBMED 22495182
REMARK GeneRIF: PLS3 is expressed in the majority of SS patients and
provide insight into the molecular regulation of PLS3 expression in
CTCL
REFERENCE 5 (bases 1 to 3246)
AUTHORS Begue,E., Jean-Louis,F., Bagot,M., Jauliac,S., Cayuela,J.M.,
Laroche,L., Parquet,N., Bachelez,H., Bensussan,A., Courtois,G. and
Michel,L.
TITLE Inducible expression and pathophysiologic functions of T-plastin in
cutaneous T-cell lymphoma
JOURNAL Blood 120 (1), 143-154 (2012)
PUBMED 22627769
REMARK GeneRIF: T-plastin is a marker restricted to malignant lymphocytes
from Sezary syndrome patients and plays a role for cell survival
and migration.
REFERENCE 6 (bases 1 to 3246)
AUTHORS Arpin,M., Friederich,E., Algrain,M., Vernel,F. and Louvard,D.
TITLE Functional differences between L- and T-plastin isoforms
JOURNAL J. Cell Biol. 127 (6 PT 2), 1995-2008 (1994)
PUBMED 7806577
REFERENCE 7 (bases 1 to 3246)
AUTHORS Lin,C.S., Park,T., Chen,Z.P. and Leavitt,J.
TITLE Human plastin genes. Comparative gene structure, chromosome
location, and differential expression in normal and neoplastic
cells
JOURNAL J. Biol. Chem. 268 (4), 2781-2792 (1993)
PUBMED 8428952
REFERENCE 8 (bases 1 to 3246)
AUTHORS Lin,C.S., Aebersold,R.H. and Leavitt,J.
TITLE Correction of the N-terminal sequences of the human plastin
isoforms by using anchored polymerase chain reaction:
identification of a potential calcium-binding domain
JOURNAL Mol. Cell. Biol. 10 (4), 1818-1821 (1990)
PUBMED 2378651
REFERENCE 9 (bases 1 to 3246)
AUTHORS Lin,C.S., Aebersold,R.H., Kent,S.B., Varma,M. and Leavitt,J.
TITLE Molecular cloning and characterization of plastin, a human
leukocyte protein expressed in transformed human fibroblasts
JOURNAL Mol. Cell. Biol. 8 (11), 4659-4668 (1988)
PUBMED 3211125
REFERENCE 10 (bases 1 to 3246)
AUTHORS Goldstein,D., Djeu,J., Latter,G., Burbeck,S. and Leavitt,J.
TITLE Abundant synthesis of the transformation-induced protein of
neoplastic human fibroblasts, plastin, in normal lymphocytes
JOURNAL Cancer Res. 45 (11 PT 2), 5643-5647 (1985)
PUBMED 4053036
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DC357886.1, AK298530.1,
AL589842.5 and AC005000.2.
Summary: Plastins are a family of actin-binding proteins that are
conserved throughout eukaryote evolution and expressed in most
tissues of higher eukaryotes. In humans, two ubiquitous plastin
isoforms (L and T) have been identified. Plastin 1 (otherwise known
as Fimbrin) is a third distinct plastin isoform which is
specifically expressed at high levels in the small intestine. The L
isoform is expressed only in hemopoietic cell lineages, while the T
isoform has been found in all other normal cells of solid tissues
that have replicative potential (fibroblasts, endothelial cells,
epithelial cells, melanocytes, etc.). The C-terminal 570 amino
acids of the T-plastin and L-plastin proteins are 83% identical. It
contains a potential calcium-binding site near the N terminus.
Alternate splicing results in multiple transcript
variants.[provided by RefSeq, Feb 2010].
Transcript Variant: This variant (3) differs in the 5' UTR and uses
an alternate in-frame splice site in the coding region, compared to
variant 1. The encoded isoform (2) is shorter than isoform 1.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK298530.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025083 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-12 DC357886.1 1-12
13-373 AK298530.1 1-361
374-374 AL589842.5 32282-32282
375-2300 AK298530.1 363-2288
2301-3246 AC005000.2 18281-19226
FEATURES Location/Qualifiers
source 1..3246
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="X"
/map="Xq23"
gene 1..3246
/gene="PLS3"
/gene_synonym="T-plastin"
/note="plastin 3"
/db_xref="GeneID:5358"
/db_xref="HGNC:9091"
/db_xref="MIM:300131"
exon 1..126
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 9
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:12847396"
variation 92
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:370675011"
exon 127..207
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
misc_feature 132..134
/gene="PLS3"
/gene_synonym="T-plastin"
/note="upstream in-frame stop codon"
CDS 135..1946
/gene="PLS3"
/gene_synonym="T-plastin"
/note="isoform 2 is encoded by transcript variant 3; T
fimbrin; plastin-3; T plastin"
/codon_start=1
/product="plastin-3 isoform 2"
/protein_id="NP_001165806.1"
/db_xref="GI:288915539"
/db_xref="GeneID:5358"
/db_xref="HGNC:9091"
/db_xref="MIM:300131"
/translation="
MDEMATTQISKDELDELKEAFAKVDLNSNGFICDYELHELFKEANMPLPGYKIFQEVKSSDIAKTFRKAINRKEGICALGGTSELSSEGTQHSYSEEEKYAFVNWINKALENDPDCRHVIPMNPNTDDLFKAVGDGIVLCKMINLSVPDTIDERAINKKKLTPFIIQENLNLALNSASAIGCHVVNIGAEDLRAGKPHLVLGLLWQIIKIGLFADIELSRNEALAALLRDGETLEELMKLSPEELLLRWANFHLENSGWQKINNFSADIKDSKAYFHLLNQIAPKGQKEGEPRIDINMSGFNETDDLKRAESMLQQADKLGCRQFVTPADVVSGNPKLNLAFVANLFNKYPALTKPENQDIDWTLLEGETREERTFRNWMNSLGVNPHVNHLYADLQDALVILQLYERIKVPVDWSKVNKPPYPKLGANMKKLENCNYAVELGKHPAKFSLVGIGGQDLNDGNQTLTLALVWQLMRRYTLNVLEDLGDGQKANDDIIVNWVNRTLSEAGKSTSIQSFKDKTISSSLAVVDLIDAIQPGCINYDLVKSGNLTEDDKHNNAKYAVSMARRIGARVYALPEDLVEVKPKMVMTVFACLMGRGMKRV
"
misc_feature 423..770
/gene="PLS3"
/gene_synonym="T-plastin"
/note="Calponin homology domain; actin-binding domain
which may be present as a single copy or in tandem repeats
(which increases binding affinity). The CH domain is found
in cytoskeletal and signal transduction proteins,
including actin-binding proteins like...; Region: CH;
cd00014"
/db_xref="CDD:28898"
misc_feature order(423..428,432..440,447..449,456..458,654..659,
666..668,675..677,681..683,726..731,738..743,747..752,
759..764)
/gene="PLS3"
/gene_synonym="T-plastin"
/note="putative actin binding surface [polypeptide
binding]; other site"
/db_xref="CDD:28898"
misc_feature 855..1187
/gene="PLS3"
/gene_synonym="T-plastin"
/note="Calponin homology domain; actin-binding domain
which may be present as a single copy or in tandem repeats
(which increases binding affinity). The CH domain is found
in cytoskeletal and signal transduction proteins,
including actin-binding proteins like...; Region: CH;
cd00014"
/db_xref="CDD:28898"
misc_feature order(855..860,864..872,879..881,888..890,1074..1079,
1086..1088,1095..1097,1101..1103,1143..1148,1155..1160,
1164..1169,1176..1181)
/gene="PLS3"
/gene_synonym="T-plastin"
/note="putative actin binding surface [polypeptide
binding]; other site"
/db_xref="CDD:28898"
misc_feature 1260..1568
/gene="PLS3"
/gene_synonym="T-plastin"
/note="Calponin homology domain; actin-binding domain
which may be present as a single copy or in tandem repeats
(which increases binding affinity). The CH domain is found
in cytoskeletal and signal transduction proteins,
including actin-binding proteins like...; Region: CH;
cd00014"
/db_xref="CDD:28898"
misc_feature order(1260..1262,1269..1271,1278..1280,1452..1457,
1464..1466,1476..1478,1482..1484,1527..1532,1539..1544,
1548..1553,1560..1565)
/gene="PLS3"
/gene_synonym="T-plastin"
/note="putative actin binding surface [polypeptide
binding]; other site"
/db_xref="CDD:28898"
misc_feature 1614..1931
/gene="PLS3"
/gene_synonym="T-plastin"
/note="Calponin homology domain; actin-binding domain
which may be present as a single copy or in tandem repeats
(which increases binding affinity). The CH domain is found
in cytoskeletal and signal transduction proteins,
including actin-binding proteins like...; Region: CH;
cd00014"
/db_xref="CDD:28898"
misc_feature order(1617..1625,1632..1634,1641..1643,1821..1826,
1833..1835,1842..1844,1848..1850,1890..1895,1902..1907,
1911..1916,1923..1928)
/gene="PLS3"
/gene_synonym="T-plastin"
/note="putative actin binding surface [polypeptide
binding]; other site"
/db_xref="CDD:28898"
exon 208..290
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 209
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:150018375"
variation 220
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:145235506"
exon 291..420
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 374
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="t"
/db_xref="dbSNP:140121121"
variation 377
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:144784703"
variation 416
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:147957783"
exon 421..553
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 489
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:141907957"
variation 521
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="g"
/db_xref="dbSNP:143815252"
variation 524
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:151153004"
exon 554..635
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
exon 636..801
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 693
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:367830488"
variation 704
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:112589137"
variation 741
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:371332791"
variation 775
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:375187925"
exon 802..944
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 803
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="g"
/db_xref="dbSNP:376568367"
variation 929
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:373249162"
variation 930
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:369914417"
exon 945..1040
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 945
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:202076515"
variation 978
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:140968059"
variation 1011
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:137917062"
variation 1027
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:142569974"
exon 1041..1236
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1103
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:113204501"
variation 1154
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:1859671"
exon 1237..1315
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1245
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:377411857"
variation 1247
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:138662773"
variation 1263
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:201842598"
variation 1295
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:2108099"
variation 1298
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:144592792"
variation 1315
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:370999829"
exon 1316..1430
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1328
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:148514983"
variation 1347
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:871774"
exon 1431..1564
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1433
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:75219193"
variation 1472
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:140768895"
variation 1529
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="g"
/db_xref="dbSNP:35211005"
exon 1565..1688
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1571
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="g"
/replace="t"
/db_xref="dbSNP:35525703"
variation 1598
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:140069545"
variation 1599
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:199893556"
variation 1649
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:372389185"
variation 1651
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:377191528"
variation 1668
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:150069454"
variation 1681
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:191246889"
exon 1689..1813
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1714
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="c"
/db_xref="dbSNP:181782110"
variation 1785
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:149142111"
variation 1793
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:145393426"
exon 1814..3246
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1945
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:369448909"
variation 1986
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:373177061"
variation 1997
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:376407795"
variation 2162
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="g"
/db_xref="dbSNP:184318952"
variation 2330
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:144589761"
variation 2590
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:11551495"
variation 2662
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:370865892"
variation 2838
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:373978498"
polyA_signal 3036..3041
/gene="PLS3"
/gene_synonym="T-plastin"
polyA_site 3057
/gene="PLS3"
/gene_synonym="T-plastin"
variation 3088
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:376902216"
variation 3168
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:148073444"
ORIGIN
gacttgctctctaaagttgcaattgtaagaagaatgttgggtttccagattgctcttctgggcgtgggagaaggttctgtctatcagtgctgcgagaaaggaaagaaacaagtttgctctcagcggatctttaaatggatgagatggctaccactcagatttccaaagatgagcttgatgaactcaaagaggcctttgcaaaagttgatctcaacagcaacggattcatttgtgactatgaacttcatgagctcttcaaggaagctaatatgccattaccaggatataaaatttttcaagaggtaaaaagtagtgatattgccaagaccttccgcaaagcaatcaacaggaaagaaggtatttgtgctctgggtggaacttcagagttgtccagcgaaggaacacagcattcttactcagaggaagaaaaatatgcttttgttaactggataaacaaagctttggaaaatgatcctgattgtagacatgttataccaatgaaccctaacaccgatgacctgttcaaagctgttggtgatggaattgtgctttgtaaaatgattaacctttcagttcctgataccattgatgaaagagcaatcaacaagaagaaacttacacccttcatcattcaggaaaacttgaacttggcactgaactctgcttctgccattgggtgtcatgttgtgaacattggtgcagaagatttgagggctgggaaacctcatctggttttgggactgctttggcagatcattaagatcggtttgttcgctgacattgaattaagcaggaatgaagccttggctgctttactccgagatggtgagactttggaggaacttatgaaattgtctccagaagagcttctgcttagatgggcaaactttcatttggaaaactcgggctggcaaaaaattaacaactttagtgctgacatcaaggattccaaagcctatttccatcttctcaatcaaatcgcaccaaaaggacaaaaggaaggtgaaccacggatagatattaacatgtcaggtttcaatgaaacagatgatttgaagagagctgagagtatgcttcaacaagcagataaattaggttgcagacagtttgttacccctgctgatgttgtcagtggaaaccccaaactcaacttagctttcgtggctaacctgtttaataaatacccagcactaactaagccagagaaccaggatattgactggactctattagaaggagaaactcgtgaagaaagaaccttccgtaactggatgaactctcttggtgtcaatcctcacgtaaaccatctctatgctgacctgcaagatgccctggtaatcttacagttatatgaacgaattaaagttcctgttgactggagtaaggttaataaacctccatacccgaaactgggagccaacatgaaaaagctagaaaactgcaactatgctgttgaattagggaagcatcctgctaaattctccctggttggcattggagggcaagacctgaatgatgggaaccaaaccctgactttagctttagtctggcagctgatgagaagatataccctcaatgtcctggaagatcttggagatggtcagaaagccaatgacgacatcattgtgaactgggtgaacagaacgttgagtgaagctggaaaatcaacttccattcagagttttaaggacaagacgatcagctccagtttggcagttgtggatttaattgatgccatccagccaggctgtataaactatgaccttgtgaagagtggcaatctaacagaagatgacaagcacaataatgccaagtatgcagtgtcaatggctagaagaatcggagccagagtgtatgctctccctgaagaccttgtggaagtaaagcccaagatggtcatgactgtgtttgcatgtttgatgggcaggggaatgaagagagtgtaaaataaccaatctgaataaaacagccatgctcccaggtgcatgattcgcaggtcagctatttccaggtgaagtgcttatggcttaaggaactcttggccattcaaaggacttttcattttgattaacaggactagcttatcatgagagccctcaggggaaagggtttaagaaaaacaactcctctttcccatagtcagagttgaatttgtcaggcacgcctgaaatgtgctcatagccaaaacattttactctctcctcctagaatgctgcccttgacatttcccattgctgtatgttatttcttgctctgttatcttttgccctcttagaatgtccctctcttgggacttgcttagatgatgggatatgaatattattagacagtaattttgctttccatccagtatgctagttcttattcgagaactatggtcagagcgtatttggatatgagtatcctttgcttatctttgtagtactgaaaatttgccgaagtaactggctgtgcagaatgtaatagaagcttttcttattcttttattcttaagatcagtatctttttacagtattctttctacatgatccttttttgtacatttaagaatattttgattatattaaacaagactgctgattttgctactttttttaaggggtcttcaagtaagtaaaacatacatcgtagctagaagaaaaatgtaccttaaatttgcatcttccctctcatacccaagctgtaaacaattgaaatattttgtcttaaatcacttggttcaatacatgcttatttgttttaaaacctgtatcatcaaactctctctctaaatttaaaatgctgttgaatatgatacttttgaggagagagtgtgctcagaacttagacgggatttggtaggccaagtatgctaagtgtacaatatattttttaattttacacctgaaacaaagaaatgtggtcactaaaaataaaagtatatatgtaggaattaatgtactcttgctttgtcaagctgtttgctatagtttccaaggtattatgttactctaactctgaaaagtgatgtaatctggtagcaatgtagtagttcaaataaaggcatttacataataattagtctgttcttcatgcttttgtctcttaggaagtatgccaatgtttgtcaggatttttttctttttgtttttctgatgtattctgtaaaatggtgtttgttaaatttgagttttgggagctgaattagaggtactgaattaaggacagtacaaatgaagtaaaaaggttttctccaatttaccaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:5358 -> Molecular function: GO:0003779 [actin binding] evidence: IEA
GeneID:5358 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
GeneID:5358 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.