Home |
Help |
Advanced search
2025-05-09 17:16:34, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001165946 4480 bp mRNA linear PRI 15-JUL-2013
DEFINITION Homo sapiens insulin-degrading enzyme (IDE), transcript variant 2,
mRNA.
ACCESSION NM_001165946
VERSION NM_001165946.1 GI:260099675
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 4480)
AUTHORS Leal,M.C., Magnani,N., Villordo,S., Buslje,C.M., Evelson,P.,
Castano,E.M. and Morelli,L.
TITLE Transcriptional regulation of insulin-degrading enzyme modulates
mitochondrial amyloid beta (Abeta) peptide catabolism and
functionality
JOURNAL J. Biol. Chem. 288 (18), 12920-12931 (2013)
PUBMED 23525105
REMARK GeneRIF: IDE-Met(1) links the mitochondrial biogenesis pathway with
mitAbeta levels and organelle functionality.
REFERENCE 2 (bases 1 to 4480)
AUTHORS Wilk,J.B., Shrine,N.R., Loehr,L.R., Zhao,J.H., Manichaikul,A.,
Lopez,L.M., Smith,A.V., Heckbert,S.R., Smolonska,J., Tang,W.,
Loth,D.W., Curjuric,I., Hui,J., Cho,M.H., Latourelle,J.C.,
Henry,A.P., Aldrich,M., Bakke,P., Beaty,T.H., Bentley,A.R.,
Borecki,I.B., Brusselle,G.G., Burkart,K.M., Chen,T.H., Couper,D.,
Crapo,J.D., Davies,G., Dupuis,J., Franceschini,N., Gulsvik,A.,
Hancock,D.B., Harris,T.B., Hofman,A., Imboden,M., James,A.L.,
Khaw,K.T., Lahousse,L., Launer,L.J., Litonjua,A., Liu,Y.,
Lohman,K.K., Lomas,D.A., Lumley,T., Marciante,K.D., McArdle,W.L.,
Meibohm,B., Morrison,A.C., Musk,A.W., Myers,R.H., North,K.E.,
Postma,D.S., Psaty,B.M., Rich,S.S., Rivadeneira,F., Rochat,T.,
Rotter,J.I., Artigas,M.S., Starr,J.M., Uitterlinden,A.G.,
Wareham,N.J., Wijmenga,C., Zanen,P., Province,M.A., Silverman,E.K.,
Deary,I.J., Palmer,L.J., Cassano,P.A., Gudnason,V., Barr,R.G.,
Loos,R.J., Strachan,D.P., London,S.J., Boezen,H.M.,
Probst-Hensch,N., Gharib,S.A., Hall,I.P., O'Connor,G.T., Tobin,M.D.
and Stricker,B.H.
TITLE Genome-wide association studies identify CHRNA5/3 and HTR4 in the
development of airflow obstruction
JOURNAL Am. J. Respir. Crit. Care Med. 186 (7), 622-632 (2012)
PUBMED 22837378
REFERENCE 3 (bases 1 to 4480)
AUTHORS Cui,P.J., Cao,L., Wang,Y., Deng,Y.L., Xu,W., Wang,G., Zhang,Y.,
Zheng,L., Fei,Q.Z., Zhang,T. and Chen,S.D.
TITLE The association between two single nucleotide polymorphisms within
the insulin-degrading enzyme gene and Alzheimer's disease in a
Chinese Han population
JOURNAL J Clin Neurosci 19 (5), 745-749 (2012)
PUBMED 22502914
REMARK GeneRIF: In the context of APOEepsilon4-negative status,
insulin-degrading enzyme variants are significantly associated with
Alzheimer disease in some genetic models.
REFERENCE 4 (bases 1 to 4480)
AUTHORS Kumar,S., Singh,S., Hinze,D., Josten,M., Sahl,H.G., Siepmann,M. and
Walter,J.
TITLE Phosphorylation of amyloid-beta peptide at serine 8 attenuates its
clearance via insulin-degrading and angiotensin-converting enzymes
JOURNAL J. Biol. Chem. 287 (11), 8641-8651 (2012)
PUBMED 22267728
REMARK GeneRIF: Phosphorylation of amyloid-beta peptide at serine 8
attenuates its clearance via insulin-degrading and
angiotensin-converting enzymes.
REFERENCE 5 (bases 1 to 4480)
AUTHORS Bartl,J., Scholz,C.J., Hinterberger,M., Jungwirth,S., Wichart,I.,
Rainer,M.K., Kneitz,S., Danielczyk,W., Tragl,K.H., Fischer,P.,
Riederer,P. and Grunblatt,E.
TITLE Disorder-specific effects of polymorphisms at opposing ends of the
Insulin Degrading Enzyme gene
JOURNAL BMC Med. Genet. 12, 151 (2011)
PUBMED 22107728
REMARK GeneRIF: The upstream polymorphism IDE2 was found to influence AD
risk and to trigger the Abeta42 plasma level, whereas the
downstream polymorphism IDE7 modified the T2DM risk; no
associations were found for the intronic variant IDE9.
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 4480)
AUTHORS Farris,W., Leissring,M.A., Hemming,M.L., Chang,A.Y. and Selkoe,D.J.
TITLE Alternative splicing of human insulin-degrading enzyme yields a
novel isoform with a decreased ability to degrade insulin and
amyloid beta-protein
JOURNAL Biochemistry 44 (17), 6513-6525 (2005)
PUBMED 15850385
REMARK GeneRIF: This study systematically characterizes IDE mRNAs,
identifies a novel, catalytically inefficient splice form and
compares its subcellular distribution, kinetic properties and
ability to degrade amyloid beta protein to the known isoform.
REFERENCE 7 (bases 1 to 4480)
AUTHORS Wroblewski,V.J., Masnyk,M., Khambatta,S.S. and Becker,G.W.
TITLE Mechanisms involved in degradation of human insulin by cytosolic
fractions of human, monkey, and rat liver
JOURNAL Diabetes 41 (4), 539-547 (1992)
PUBMED 1607078
REFERENCE 8 (bases 1 to 4480)
AUTHORS Ding,L., Becker,A.B., Suzuki,A. and Roth,R.A.
TITLE Comparison of the enzymatic and biochemical properties of human
insulin-degrading enzyme and Escherichia coli protease III
JOURNAL J. Biol. Chem. 267 (4), 2414-2420 (1992)
PUBMED 1733942
REFERENCE 9 (bases 1 to 4480)
AUTHORS Espinosa,R. III, Lemons,R.S., Perlman,R.K., Kuo,W.L., Rosner,M.R.
and Le Beau,M.M.
TITLE Localization of the gene encoding insulin-degrading enzyme to human
chromosome 10, bands q23----q25
JOURNAL Cytogenet. Cell Genet. 57 (4), 184-186 (1991)
PUBMED 1743072
REFERENCE 10 (bases 1 to 4480)
AUTHORS Whitsett,J.A. and Lessard,J.L.
TITLE Characteristics of the microvillus brush border of human placenta:
insulin receptor localization in brush border membranes
JOURNAL Endocrinology 103 (4), 1458-1468 (1978)
PUBMED 758022
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DB445060.1, AK316407.1,
BX648462.1, CK824565.1, DA879845.1 and CF780766.1.
Summary: This gene encodes a zinc metallopeptidase that degrades
intracellular insulin, and thereby terminates insulins activity, as
well as participating in intercellular peptide signalling by
degrading diverse peptides such as glucagon, amylin, bradykinin,
and kallidin. The preferential affinity of this enzyme for insulin
results in insulin-mediated inhibition of the degradation of other
peptides such as beta-amyloid. Deficiencies in this protein's
function are associated with Alzheimer's disease and type 2
diabetes mellitus but mutations in this gene have not been shown to
be causitive for these diseases. This protein localizes primarily
to the cytoplasm but in some cell types localizes to the
extracellular space, cell membrane, peroxisome, and mitochondrion.
Alternative splicing results in multiple transcript variants
encoding distinct isoforms. Additional transcript variants have
been described but have not been experimentally verified.[provided
by RefSeq, Sep 2009].
Transcript Variant: This variant (2) lacks multiple exons that are
present in the 5' end of variant 1. Variant 2 contains a novel exon
at its 5' end and begins translation from a downstream in-frame
start codon, compared to variant 1. The encoded protein (isoform 2)
lacks 555 amino acids from the N-terminus of isoform 1 but is
identical to its C-terminal 464 amino acids. Compared to isoform 1,
isoform 2 lacks two of three M16 peptidase domains and the
N-terminal catalytic domain. The C-terminus of isoform 2 retains
the oligomerization domain and peroxisomal targeting sequence
present in isoform 1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK302578.1, AK316407.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025088 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-28 DB445060.1 1-28
29-1778 AK316407.1 1-1750
1779-3557 BX648462.1 3360-5138
3558-3950 CK824565.1 174-566
3951-4324 DA879845.1 122-495
4325-4480 CF780766.1 284-439
FEATURES Location/Qualifiers
source 1..4480
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="10"
/map="10q23-q25"
gene 1..4480
/gene="IDE"
/gene_synonym="INSULYSIN"
/note="insulin-degrading enzyme"
/db_xref="GeneID:3416"
/db_xref="HGNC:5381"
/db_xref="MIM:146680"
exon 1..90
/gene="IDE"
/gene_synonym="INSULYSIN"
/inference="alignment:Splign:1.39.8"
misc_feature 50..52
/gene="IDE"
/gene_synonym="INSULYSIN"
/note="upstream in-frame stop codon"
exon 91..193
/gene="IDE"
/gene_synonym="INSULYSIN"
/inference="alignment:Splign:1.39.8"
exon 194..316
/gene="IDE"
/gene_synonym="INSULYSIN"
/inference="alignment:Splign:1.39.8"
variation 277
/gene="IDE"
/gene_synonym="INSULYSIN"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:35426658"
variation 307
/gene="IDE"
/gene_synonym="INSULYSIN"
/replace="c"
/replace="t"
/db_xref="dbSNP:79491549"
exon 317..399
/gene="IDE"
/gene_synonym="INSULYSIN"
/inference="alignment:Splign:1.39.8"
CDS 326..1720
/gene="IDE"
/gene_synonym="INSULYSIN"
/EC_number="3.4.24.56"
/note="isoform 2 is encoded by transcript variant 2;
insulinase; insulin protease; Abeta-degrading protease"
/codon_start=1
/product="insulin-degrading enzyme isoform 2"
/protein_id="NP_001159418.1"
/db_xref="GI:260099676"
/db_xref="CCDS:CCDS53554.1"
/db_xref="GeneID:3416"
/db_xref="HGNC:5381"
/db_xref="MIM:146680"
/translation="
MSKLWFKQDDKFFLPKACLNFEFFSPFAYVDPLHCNMAYLYLELLKDSLNEYAYAAELAGLSYDLQNTIYGMYLSVKGYNDKQPILLKKIIEKMATFEIDEKRFEIIKEAYMRSLNNFRAEQPHQHAMYYLRLLMTEVAWTKDELKEALDDVTLPRLKAFIPQLLSRLHIEALLHGNITKQAALGIMQMVEDTLIEHAHTKPLLPSQLVRYREVQLPDRGWFVYQQRNEVHNNCGIEIYYQTDMQSTSENMFLELFCQIISEPCFNTLRTKEQLGYIVFSGPRRANGIQGLRFIIQSEKPPHYLESRVEAFLITMEKSIEDMTEEAFQKHIQALAIRRLDKPKKLSAECAKYWGEIISQQYNFDRDNTEVAYLKTLTKEDIIKFYKEMLAVDAPRRHKVSVHVLAREMDSCPVVGEFPCQNDINLSQAPALPQPEVIQNMTEFKRGLPLFPLVKPHINFMAAKL
"
misc_feature 776..1327
/gene="IDE"
/gene_synonym="INSULYSIN"
/note="Peptidase M16 inactive domain; Region:
Peptidase_M16_C; pfam05193"
/db_xref="CDD:218490"
exon 400..544
/gene="IDE"
/gene_synonym="INSULYSIN"
/inference="alignment:Splign:1.39.8"
variation 406
/gene="IDE"
/gene_synonym="INSULYSIN"
/replace="g"
/replace="t"
/db_xref="dbSNP:5030982"
exon 545..655
/gene="IDE"
/gene_synonym="INSULYSIN"
/inference="alignment:Splign:1.39.8"
variation 559
/gene="IDE"
/gene_synonym="INSULYSIN"
/replace="g"
/replace="t"
/db_xref="dbSNP:2229709"
exon 656..776
/gene="IDE"
/gene_synonym="INSULYSIN"
/inference="alignment:Splign:1.39.8"
STS 728..1634
/gene="IDE"
/gene_synonym="INSULYSIN"
/standard_name="Ide"
/db_xref="UniSTS:506987"
exon 777..868
/gene="IDE"
/gene_synonym="INSULYSIN"
/inference="alignment:Splign:1.39.8"
variation 824
/gene="IDE"
/gene_synonym="INSULYSIN"
/replace="c"
/replace="t"
/db_xref="dbSNP:76587725"
exon 869..980
/gene="IDE"
/gene_synonym="INSULYSIN"
/inference="alignment:Splign:1.39.8"
exon 981..1148
/gene="IDE"
/gene_synonym="INSULYSIN"
/inference="alignment:Splign:1.39.8"
variation 1033
/gene="IDE"
/gene_synonym="INSULYSIN"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:35640611"
exon 1149..1421
/gene="IDE"
/gene_synonym="INSULYSIN"
/inference="alignment:Splign:1.39.8"
variation 1193
/gene="IDE"
/gene_synonym="INSULYSIN"
/replace="a"
/replace="g"
/db_xref="dbSNP:1042444"
exon 1422..1483
/gene="IDE"
/gene_synonym="INSULYSIN"
/inference="alignment:Splign:1.39.8"
exon 1484..1556
/gene="IDE"
/gene_synonym="INSULYSIN"
/inference="alignment:Splign:1.39.8"
exon 1557..1624
/gene="IDE"
/gene_synonym="INSULYSIN"
/inference="alignment:Splign:1.39.8"
exon 1625..4480
/gene="IDE"
/gene_synonym="INSULYSIN"
/inference="alignment:Splign:1.39.8"
STS 1755..1854
/gene="IDE"
/gene_synonym="INSULYSIN"
/standard_name="GDB:193867"
/db_xref="UniSTS:155775"
STS 1756..1853
/gene="IDE"
/gene_synonym="INSULYSIN"
/standard_name="D10S2141"
/db_xref="UniSTS:20873"
STS 3687..3870
/gene="IDE"
/gene_synonym="INSULYSIN"
/standard_name="STS-D29519"
/db_xref="UniSTS:28873"
STS 3747..3896
/gene="IDE"
/gene_synonym="INSULYSIN"
/standard_name="WI-17525"
/db_xref="UniSTS:60139"
polyA_signal 3898..3903
/gene="IDE"
/gene_synonym="INSULYSIN"
polyA_site 3917
/gene="IDE"
/gene_synonym="INSULYSIN"
ORIGIN
agttgtaactgtagtaggtcagtgatacatggtgcaaaacagcctgggataatattgccagctgccagaccagactagggtggctcaaggggttgccatagtttctaaatcttttgaaggaaaaactgatcgcacagaagagtggtatggaacccagtacaaacaagaagctataccggatgaagtcatcaagaaatggcaaaatgctgacctgaatgggaaatttaaacttcctacaaagaatgaatttattcctacgaattttgagattttaccgttagaaaaagaggcgacaccataccctgctcttattaaggatacagctatgagcaaactttggttcaaacaagatgataagttttttttgccgaaggcttgtctcaactttgaatttttcagcccatttgcttatgtggaccccttgcactgtaacatggcctatttgtaccttgagctcctcaaagactcactcaacgagtatgcatatgcagcagagctagcaggcttgagctatgatctccaaaataccatctatgggatgtatctttcagtgaaaggttacaatgacaagcagccaattttactaaagaagattattgagaaaatggctacctttgagattgatgaaaaaagatttgaaattatcaaagaagcatatatgcgatctcttaacaatttccgggctgaacagcctcaccagcatgccatgtactacctccgcttgctgatgactgaagtggcctggactaaagatgagttaaaagaagctctggatgatgtaacccttcctcgccttaaggccttcatacctcagctcctgtcacggctgcacattgaagcccttctccatggaaacataacaaagcaggctgcattaggaattatgcagatggttgaagacaccctcattgaacatgctcataccaaacctctccttccaagtcagctggttcggtatagagaagttcagctccctgacagaggatggtttgtttatcagcagagaaatgaagttcacaataactgtggcatcgagatatactaccaaacagacatgcaaagcacctcagagaatatgtttctggagctcttctgtcagattatctcggaaccttgcttcaacaccctgcgcaccaaggagcagttgggctatatcgtcttcagcgggccacgtcgagctaatggcatacagggcttgagattcatcatccagtcagaaaagccacctcactacctagaaagcagagtggaagctttcttaattaccatggaaaagtccatagaggacatgacagaagaggccttccaaaaacacattcaggcattagcaattcgtcgactagacaaaccaaagaagctatctgctgagtgtgctaaatactggggagaaatcatctcccagcaatataattttgacagagataacactgaggttgcatatttaaagacacttaccaaggaagatatcatcaaattctacaaggaaatgttggcagtagatgctccaaggagacataaggtatccgtccatgttcttgccagggaaatggattcttgtcctgttgttggagagttcccatgtcaaaatgacataaatttgtcacaagcaccagccttgccacaacctgaagtgattcagaacatgaccgaattcaagcgtggtctgccactgtttccccttgtgaaaccacatattaacttcatggctgcaaaactctgaagattccccatgcatgggaaagtgcaagtggatgcattcctgagtcttccagagcctaagaaaatcatcttggccactttaatagtttctgattcactattagagaaacaaacaaaaaattgtcaaatgtcattatgtagaaatattataaatccaaagtaaattacaaaatcttatagatgtagaatattttttaaatacatgcctcttaaatattttaaaatttttcttttgattactgagagaaatttccccaatataacaatgcttaaaatgaatgatattcctatagaatcttccttccctattctgtaaaatagtcacttgtccgaagaaagttaaaagttagctcttttctaaaagcctcctagcttgacatagaaggcttcacaacatttagaaaggtaataactttttaaaaattgatcctcaaatttgctttctacttgatggtttcatgtaaatcagtggaaaacattacatttggcagatgataaagcaatgtcatcttttattagtgaaatgctggttatataaggcatggttttaatctttttataaaatttgaacatgttttttatgccaactcgtaaaatgctagaaaaccctacttatttacaatgctagaaatacagacttaccttacatcaattttgtcctaaaccgaatttctcaggattactgtggtttctttcattctgattgaattatattgacctacttcttcatagttggtttgcagtgttccatgagttttacttttcctcatcaacatattgctttaacacaacatatttatttaacacgtacaaatagggtcaacttcagatcctactgagtgtgtgacatgcttttccaacatcagctttttgtaaccacctgtataactttttattacagtgaaattgcagtcagtatgtgaaccaaaatatcttgcccctttatgaatttaaaaggcagccaatacaaagccacctttttggaaatataaaaagtaaagccttgcattcttatatagcaggtcttcataaaactctaaaatcccttgttgctaccagtctaatcttgccttaaatgttaagttattttttgaatatataaatataaacatataaacacagatgatgactggagtagacttttaaaaaaatatttttttcatgagatactattttaggtgaaattgttactgtagatttaacagctgttttgaaatatttactgttattaaaacttgcttcaagagaaattgtgaatatatttccatatacaagcactagtaacagtaagtggccctgtcatccactaactcaggcaaagtaaagaatggcatttttgaaggacattttacctccccatatgatttgattggctaggactttcttctgtaaagtcataccttttcacatcttaagtttttacatttgccattttccaaatctcaattttgggcaagaacgatatagtcacaactatggggctgctttcaaaagcggggctccatttctactgtcagatcaatgtggtgctgtaaccatctttttatccctaccttcaagaacctccttatatgaagcctgtctttatccatcagaaggtgtgtgaaatcatcacttccttctggttttatgtatttgtagactatgcagcttttcattaaactgcaagtatatacaagacagatctgaaattaggcctgagtgttccgatccaccactgtactagtaaataaaaatccacctaccttttatgtggaaaattatgtgctattgagtaacttttagctcttttttaaaaaatgggtgaaatttaagtgtcttttttatgagaatgacacatgaagagatctgagagcaatctcatgtagtcttccatgaacctgcaattgtttggtatgcgtcagcattttccaatttccaggttggatctagagctgctgttgatcactcaggcatactaatggattcatttagatgggtccaagctgcagtccatgagcaataacagactaccccagatactgcagtttacgcagtgcttagtaaatgagatttgtggaactaagttattagttacctgaggcttcttaagaaagtcttcttttttgaccagttgatgtgaaagagggagcatgtgacacagccagtatggtggagtgctagggttatcctgtttacaataaatcgcctgaatttcacctctggagtctgcatttgtattatttttccagttttagtgaaatagtacagtggccagtcctcagcctacctctcaacatcccagtttgaccagatttcttgctttcattgttcataatgcagaaagcagtgaattatattaacattttaaaagtgtttctgggtaacaatgatttttgtcaaatagaagactcaatttcacaaccttaagaatagatcacttttgtaaaacaagaatctcagtatttgatgttggactccttgctgtgagtattgtcactgactccaaacccagaaagatttgttcctgcccttacagggatgaaaataaaaaggatagaaaaaatatttctctcctctacaatgagtccttacatcttcttgccacatctccagctgcagtttaggcagatatcttgttcaatctctgtcttcttgatccctgtcaaaataatttttctactcatatagtggccagttggctcaggcaggcatttcaagaggaatctgcttgttcctcacttttccagcataggacagtggtccagcccgcacagtcagc
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:3416 -> Molecular function: GO:0001540 [beta-amyloid binding] evidence: IEA
GeneID:3416 -> Molecular function: GO:0001948 [glycoprotein binding] evidence: IPI
GeneID:3416 -> Molecular function: GO:0004222 [metalloendopeptidase activity] evidence: IDA
GeneID:3416 -> Molecular function: GO:0005102 [receptor binding] evidence: IPI
GeneID:3416 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:3416 -> Molecular function: GO:0005524 [ATP binding] evidence: IDA
GeneID:3416 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IDA
GeneID:3416 -> Molecular function: GO:0016887 [ATPase activity] evidence: IEA
GeneID:3416 -> Molecular function: GO:0031626 [beta-endorphin binding] evidence: IEA
GeneID:3416 -> Molecular function: GO:0042277 [peptide binding] evidence: IPI
GeneID:3416 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IPI
GeneID:3416 -> Molecular function: GO:0043130 [ubiquitin binding] evidence: IPI
GeneID:3416 -> Molecular function: GO:0043559 [insulin binding] evidence: IDA
GeneID:3416 -> Molecular function: GO:0043559 [insulin binding] evidence: IPI
GeneID:3416 -> Biological process: GO:0006508 [proteolysis] evidence: IDA
GeneID:3416 -> Biological process: GO:0008286 [insulin receptor signaling pathway] evidence: NAS
GeneID:3416 -> Biological process: GO:0008340 [determination of adult lifespan] evidence: IDA
GeneID:3416 -> Biological process: GO:0010815 [bradykinin catabolic process] evidence: IDA
GeneID:3416 -> Biological process: GO:0010992 [ubiquitin homeostasis] evidence: IDA
GeneID:3416 -> Biological process: GO:0019048 [modulation by virus of host morphology or physiology] evidence: IEA
GeneID:3416 -> Biological process: GO:0032461 [positive regulation of protein oligomerization] evidence: IDA
GeneID:3416 -> Biological process: GO:0042447 [hormone catabolic process] evidence: IEA
GeneID:3416 -> Biological process: GO:0045861 [negative regulation of proteolysis] evidence: IEA
GeneID:3416 -> Biological process: GO:0050435 [beta-amyloid metabolic process] evidence: IDA
GeneID:3416 -> Biological process: GO:0051260 [protein homooligomerization] evidence: IDA
GeneID:3416 -> Biological process: GO:0051289 [protein homotetramerization] evidence: IEA
GeneID:3416 -> Biological process: GO:0051291 [protein heterooligomerization] evidence: IEA
GeneID:3416 -> Biological process: GO:0051603 [proteolysis involved in cellular protein catabolic process] evidence: IDA
GeneID:3416 -> Biological process: GO:1901142 [insulin metabolic process] evidence: IDA
GeneID:3416 -> Biological process: GO:1901143 [insulin catabolic process] evidence: IDA
GeneID:3416 -> Cellular component: GO:0005615 [extracellular space] evidence: IDA
GeneID:3416 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:3416 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:3416 -> Cellular component: GO:0005739 [mitochondrion] evidence: IDA
GeneID:3416 -> Cellular component: GO:0005777 [peroxisome] evidence: IDA
GeneID:3416 -> Cellular component: GO:0005782 [peroxisomal matrix] evidence: IEA
GeneID:3416 -> Cellular component: GO:0005829 [cytosol] evidence: IDA
GeneID:3416 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
GeneID:3416 -> Cellular component: GO:0009986 [cell surface] evidence: IDA
GeneID:3416 -> Cellular component: GO:0031597 [cytosolic proteasome complex] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_001159418 -> EC 3.4.24.56
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.