Home |
Help |
Advanced search
2025-05-09 17:21:57, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001127384 3174 bp mRNA linear PRI 24-JUN-2013
DEFINITION Homo sapiens catenin (cadherin-associated protein), alpha 3
(CTNNA3), transcript variant 2, mRNA.
ACCESSION NM_001127384
VERSION NM_001127384.1 GI:188497717
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3174)
AUTHORS Borglum,A.D., Demontis,D., Grove,J., Pallesen,J., Hollegaard,M.V.,
Pedersen,C.B., Hedemand,A., Mattheisen,M., Uitterlinden,A.,
Nyegaard,M., Orntoft,T., Wiuf,C., Didriksen,M., Nordentoft,M.,
Nothen,M.M., Rietschel,M., Ophoff,R.A., Cichon,S., Yolken,R.H.,
Hougaard,D.M., Mortensen,P.B. and Mors,O.
CONSRTM GROUP investigators
TITLE Genome-wide study of association and interaction with maternal
cytomegalovirus infection suggests new schizophrenia loci
JOURNAL Mol. Psychiatry (2013) In press
PUBMED 23358160
REMARK Publication Status: Available-Online prior to print
REFERENCE 2 (bases 1 to 3174)
AUTHORS van Hengel,J., Calore,M., Bauce,B., Dazzo,E., Mazzotti,E., De
Bortoli,M., Lorenzon,A., Li Mura,I.E., Beffagna,G., Rigato,I.,
Vleeschouwers,M., Tyberghein,K., Hulpiau,P., van Hamme,E.,
Zaglia,T., Corrado,D., Basso,C., Thiene,G., Daliento,L., Nava,A.,
van Roy,F. and Rampazzo,A.
TITLE Mutations in the area composita protein alphaT-catenin are
associated with arrhythmogenic right ventricular cardiomyopathy
JOURNAL Eur. Heart J. 34 (3), 201-210 (2013)
PUBMED 23136403
REMARK GeneRIF: Results suggest a causal relationship between CTNNA3
mutations and arrhythmogenic right ventricular cardiomyopathy
REFERENCE 3 (bases 1 to 3174)
AUTHORS Shaffer,J.R., Feingold,E., Wang,X., Lee,M., Tcuenco,K., Weeks,D.E.,
Weyant,R.J., Crout,R., McNeil,D.W. and Marazita,M.L.
TITLE GWAS of dental caries patterns in the permanent dentition
JOURNAL J. Dent. Res. 92 (1), 38-44 (2013)
PUBMED 23064961
REFERENCE 4 (bases 1 to 3174)
AUTHORS Bernstein,D.I., Kashon,M., Lummus,Z.L., Johnson,V.J., Fluharty,K.,
Gautrin,D., Malo,J.L., Cartier,A., Boulet,L.P., Sastre,J.,
Quirce,S., Germolec,D., Tarlo,S.M., Cruz,M.J., Munoz,X.,
Luster,M.I. and Yucesoy,B.
TITLE CTNNA3 (alpha-catenin) gene variants are associated with
diisocyanate asthma: a replication study in a Caucasian worker
population
JOURNAL Toxicol. Sci. 131 (1), 242-246 (2013)
PUBMED 22977168
REMARK GeneRIF: GWAS study of diisocyanate asthma demonstrates an
association between two closely linked CTNNA3 gene SNPs and
diisocyanate asthma.
REFERENCE 5 (bases 1 to 3174)
AUTHORS Comuzzie,A.G., Cole,S.A., Laston,S.L., Voruganti,V.S., Haack,K.,
Gibbs,R.A. and Butte,N.F.
TITLE Novel genetic loci identified for the pathophysiology of childhood
obesity in the Hispanic population
JOURNAL PLoS ONE 7 (12), E51954 (2012)
PUBMED 23251661
REFERENCE 6 (bases 1 to 3174)
AUTHORS Deloukas,P., Earthrowl,M.E., Grafham,D.V., Rubenfield,M.,
French,L., Steward,C.A., Sims,S.K., Jones,M.C., Searle,S.,
Scott,C., Howe,K., Hunt,S.E., Andrews,T.D., Gilbert,J.G.,
Swarbreck,D., Ashurst,J.L., Taylor,A., Battles,J., Bird,C.P.,
Ainscough,R., Almeida,J.P., Ashwell,R.I., Ambrose,K.D.,
Babbage,A.K., Bagguley,C.L., Bailey,J., Banerjee,R., Bates,K.,
Beasley,H., Bray-Allen,S., Brown,A.J., Brown,J.Y., Burford,D.C.,
Burrill,W., Burton,J., Cahill,P., Camire,D., Carter,N.P.,
Chapman,J.C., Clark,S.Y., Clarke,G., Clee,C.M., Clegg,S., Corby,N.,
Coulson,A., Dhami,P., Dutta,I., Dunn,M., Faulkner,L., Frankish,A.,
Frankland,J.A., Garner,P., Garnett,J., Gribble,S., Griffiths,C.,
Grocock,R., Gustafson,E., Hammond,S., Harley,J.L., Hart,E.,
Heath,P.D., Ho,T.P., Hopkins,B., Horne,J., Howden,P.J., Huckle,E.,
Hynds,C., Johnson,C., Johnson,D., Kana,A., Kay,M., Kimberley,A.M.,
Kershaw,J.K., Kokkinaki,M., Laird,G.K., Lawlor,S., Lee,H.M.,
Leongamornlert,D.A., Laird,G., Lloyd,C., Lloyd,D.M., Loveland,J.,
Lovell,J., McLaren,S., McLay,K.E., McMurray,A.,
Mashreghi-Mohammadi,M., Matthews,L., Milne,S., Nickerson,T.,
Nguyen,M., Overton-Larty,E., Palmer,S.A., Pearce,A.V., Peck,A.I.,
Pelan,S., Phillimore,B., Porter,K., Rice,C.M., Rogosin,A.,
Ross,M.T., Sarafidou,T., Sehra,H.K., Shownkeen,R., Skuce,C.D.,
Smith,M., Standring,L., Sycamore,N., Tester,J., Thorpe,A.,
Torcasso,W., Tracey,A., Tromans,A., Tsolas,J., Wall,M., Walsh,J.,
Wang,H., Weinstock,K., West,A.P., Willey,D.L., Whitehead,S.L.,
Wilming,L., Wray,P.W., Young,L., Chen,Y., Lovering,R.C.,
Moschonas,N.K., Siebert,R., Fechtel,K., Bentley,D., Durbin,R.,
Hubbard,T., Doucette-Stamm,L., Beck,S., Smith,D.R. and Rogers,J.
TITLE The DNA sequence and comparative analysis of human chromosome 10
JOURNAL Nature 429 (6990), 375-381 (2004)
PUBMED 15164054
REFERENCE 7 (bases 1 to 3174)
AUTHORS Busby,V., Goossens,S., Nowotny,P., Hamilton,G., Smemo,S.,
Harold,D., Turic,D., Jehu,L., Myers,A., Womick,M., Woo,D.,
Compton,D., Doil,L.M., Tacey,K.M., Lau,K.F., Al-Saraj,S.,
Killick,R., Pickering-Brown,S., Moore,P., Hollingworth,P.,
Archer,N., Foy,C., Walter,S., Lendon,C., Iwatsubo,T., Morris,J.C.,
Norton,J., Mann,D., Janssens,B., Hardy,J., O'Donovan,M., Jones,L.,
Williams,J., Holmans,P., Owen,M.J., Grupe,A., Powell,J., van
Hengel,J., Goate,A., Van Roy,F. and Lovestone,S.
TITLE Alpha-T-catenin is expressed in human brain and interacts with the
Wnt signaling pathway but is not responsible for linkage to
chromosome 10 in Alzheimer's disease
JOURNAL Neuromolecular Med. 5 (2), 133-146 (2004)
PUBMED 15075440
REMARK GeneRIF: We found no association between CTNNA3 and Alzheimer
disease in subjects showing linkage to chromosome 10, nor were
these SNPs associated with Abeta deposition in brain. CTNNA3 is
unlikely to account for the susceptibility locus on chromosome 10
REFERENCE 8 (bases 1 to 3174)
AUTHORS Ertekin-Taner,N., Ronald,J., Asahara,H., Younkin,L., Hella,M.,
Jain,S., Gnida,E., Younkin,S., Fadale,D., Ohyagi,Y., Singleton,A.,
Scanlin,L., de Andrade,M., Petersen,R., Graff-Radford,N., Hutton,M.
and Younkin,S.
TITLE Fine mapping of the alpha-T catenin gene to a quantitative trait
locus on chromosome 10 in late-onset Alzheimer's disease pedigrees
JOURNAL Hum. Mol. Genet. 12 (23), 3133-3143 (2003)
PUBMED 14559775
REMARK GeneRIF: Alpha-T catenin gene has variants which influence Abeta42
and contribute to the previously reported linkage for plasma
Abeta42 in late-onset Alzheimer's disease families.
REFERENCE 9 (bases 1 to 3174)
AUTHORS Janssens,B., Mohapatra,B., Vatta,M., Goossens,S., Vanpoucke,G.,
Kools,P., Montoye,T., van Hengel,J., Bowles,N.E., van Roy,F. and
Towbin,J.A.
TITLE Assessment of the CTNNA3 gene encoding human alpha T-catenin
regarding its involvement in dilated cardiomyopathy
JOURNAL Hum. Genet. 112 (3), 227-236 (2003)
PUBMED 12596047
REMARK GeneRIF: gene localized on chromosome 10q21 and is 1,776 kb in
length; mutation screening of all 18 exons of the CTNNA3 gene in a
family showing dilated cardiomyopathy (DCM)linkage to the 10q21-q23
locus, however, has not detected any DCM-linked CTNNA3 mutations
REFERENCE 10 (bases 1 to 3174)
AUTHORS Janssens,B., Goossens,S., Staes,K., Gilbert,B., van Hengel,J.,
Colpaert,C., Bruyneel,E., Mareel,M. and van Roy,F.
TITLE alphaT-catenin: a novel tissue-specific beta-catenin-binding
protein mediating strong cell-cell adhesion
JOURNAL J. Cell. Sci. 114 (PT 17), 3177-3188 (2001)
PUBMED 11590244
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
BP362015.1, AK289756.1 and AF091606.1.
Transcript Variant: This variant (2) utilizes an alternate first
exon resulting in a distinct 5'UTR. Transcript variants 1 and 2
encode the same protein isoform.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK289756.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025082, ERS025083 [ECO:0000350]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-37 BP362015.1 1-37
38-1909 AK289756.1 1-1872
1910-2968 AF091606.1 1962-3020
2969-3174 AK289756.1 2932-3137
FEATURES Location/Qualifiers
source 1..3174
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="10"
/map="10q22.2"
gene 1..3174
/gene="CTNNA3"
/gene_synonym="VR22"
/note="catenin (cadherin-associated protein), alpha 3"
/db_xref="GeneID:29119"
/db_xref="HGNC:2511"
/db_xref="MIM:607667"
exon 1..118
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(32)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:374617915"
exon 119..222
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
CDS 124..2811
/gene="CTNNA3"
/gene_synonym="VR22"
/note="alpha-catenin-like protein; alpha-T-catenin; alpha
T-catenin; cadherin-associated protein"
/codon_start=1
/product="catenin alpha-3"
/protein_id="NP_001120856.1"
/db_xref="GI:188497718"
/db_xref="CCDS:CCDS7269.1"
/db_xref="GeneID:29119"
/db_xref="HGNC:2511"
/db_xref="MIM:607667"
/translation="
MSAETPITLNIDPQDLQVQTFTVEKLLEPLIIQVTTLVNCPQNPSSRKKGRSKRASVLLASVEEATWNLLDKGEKIAQEATVLKDELTASLEEVRKESEALKVSAERFTDDPCFLPKREAVVQAARALLAAVTRLLILADMIDVMCLLQHVSAFQRTFESLKNVANKSDLQKTYQKLGKELENLDYLAFKRQQDLKSPNQRDEIAGARASLKENSPLLHSICSACLEHSDVASLKASKDTVCEEIQNALNVISNASQGIQNMTTPPEPQAATLGSALDELENLIVLNPLTVTEEEIRPSLEKRLEAIISGAALLADSSCTRDLHRERIIAECNAIRQALQDLLSEYMNNAGKKERSNTLNIALDNMCKKTRDLRRQLRKAIIDHVSDSFLDTTVPLLVLIEAAKNGREKEIKEYAAIFHEHTSRLVEVANLACSMSTNEDGIKIVKIAANHLETLCPQIINAALALAARPKSQAVKNTMEMYKRTWENHIHVLTEAVDDITSIDDFLAVSESHILEDVNKCIIALRDQDADNLDRAAGAIRGRAARVAHIVTGEMDSYEPGAYTEGVMRNVNFLTSTVIPEFVTQVNVALEALSKSSLNVLDDNQFVDISKKIYDTIHDIRCSVMMIRTPEELEDVSDLEEEHEVRSHTSIQTEGKTDRAKMTQLPEAEKEKIAEQVADFKKVKSKLDAEIEIWDDTSNDIIVLAKNMCMIMMEMTDFTRGKGPLKHTTDVIYAAKMISESGSRMDVLARQIANQCPDPSCKQDLLAYLEQIKFYSHQLKICSQVKAEIQNLGGELIMSALDSVTSLIQAAKNLMNAVVQTVKMSYIASTKIIRIQSPAGPRHPVVMWRMKAPAKKPLIKREKPEETCAAVRRGSAKKKIHPLQVMSEFRGRQIY
"
misc_feature 175..2691
/gene="CTNNA3"
/gene_synonym="VR22"
/note="Vinculin family; Region: Vinculin; pfam01044"
/db_xref="CDD:110072"
misc_feature 2032..2034
/gene="CTNNA3"
/gene_synonym="VR22"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UI47.2); phosphorylation site"
variation complement(141)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:138580439"
variation complement(156)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:61735044"
variation complement(183)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:374611639"
variation complement(196)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:375607074"
exon 223..415
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(275)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:143725018"
variation complement(278)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:139105272"
variation complement(279)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:61759502"
variation complement(283)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:200409596"
variation complement(284)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:377158111"
variation complement(288)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:141527898"
variation complement(309)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:369638097"
variation complement(312)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:375304070"
variation complement(334)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:10997754"
variation complement(337)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:371997421"
variation complement(341)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:141436901"
variation complement(355)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:201306690"
exon 416..582
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(435)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:201480758"
variation complement(471)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:61749224"
variation complement(499)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:373661106"
variation complement(510)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:143943926"
variation complement(516)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:80182543"
variation complement(522)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:150376558"
variation complement(552)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:111880127"
variation complement(571)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:368622093"
variation complement(580)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:147116577"
exon 583..702
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(583)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:374067925"
variation complement(601)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:61749223"
variation complement(606)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:74142830"
variation complement(701)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:373233387"
exon 703..966
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(725)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:372957321"
variation complement(728)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:138821753"
variation complement(746)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:369420715"
variation complement(759)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:200809148"
variation complement(767)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:146441824"
variation complement(772)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:374834298"
variation complement(777)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:371330302"
variation complement(841)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:367570454"
variation complement(865)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:192093851"
variation complement(869)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:146048212"
variation complement(872)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:372717475"
variation complement(883)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:368470427"
variation complement(891)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:140926333"
variation complement(902)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:190073606"
variation complement(917)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:151069922"
variation complement(919)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:199985402"
variation complement(931)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:368027975"
variation complement(942)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:146622691"
variation complement(955)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:143693772"
exon 967..1170
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(989)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:375250429"
variation complement(990)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:149090594"
variation complement(993)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:369449859"
variation complement(1003)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:146475470"
variation complement(1013)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:201596778"
variation complement(1053)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:144152750"
variation complement(1068)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:375992799"
variation complement(1082)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:139460414"
variation complement(1090)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:113836576"
variation complement(1096)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:369024617"
variation complement(1105)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:374713975"
variation complement(1109)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:181929603"
variation complement(1110)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:372427902"
variation complement(1122)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:146754105"
variation complement(1126)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:370088870"
variation complement(1129)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:375721994"
variation complement(1130)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:372482202"
variation complement(1158)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:368211074"
variation complement(1159)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:143203517"
variation complement(1170)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:60262757"
exon 1171..1251
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(1178)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:141978685"
variation complement(1187)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:375610128"
variation complement(1220)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:201966934"
variation complement(1243)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:370981751"
exon 1252..1404
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(1255)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:187752783"
variation complement(1256)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:143682596"
variation complement(1277)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:149348606"
variation complement(1298)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:146777494"
variation complement(1299)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:138898184"
variation complement(1309)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:376091500"
variation complement(1315)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:145043626"
variation complement(1318)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:115276158"
variation complement(1321)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:374015031"
variation complement(1322)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:201896157"
variation complement(1342)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:138643733"
variation complement(1343)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:369880246"
variation complement(1354)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:372808360"
variation complement(1359)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:150167695"
variation complement(1386)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:140907744"
variation complement(1401)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:143981286"
exon 1405..1497
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(1426)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:377404952"
variation complement(1427)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:369650832"
exon 1498..1654
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(1513)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:367599520"
variation complement(1525)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:151007312"
variation complement(1544)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:201810511"
variation complement(1545)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:372258059"
variation complement(1569)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:76737066"
variation complement(1571)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:200282168"
variation complement(1573)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:200182913"
variation complement(1576)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:140913916"
variation complement(1595)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:201173778"
variation complement(1599)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:182681928"
variation complement(1612)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:368067642"
variation complement(1614)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:141098613"
variation complement(1630)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:147802834"
variation complement(1632)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:375080368"
exon 1655..1855
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(1662)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:377413642"
variation complement(1672)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:373151978"
variation complement(1681)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:144269113"
variation complement(1697)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:369650158"
variation complement(1710)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:74141466"
variation complement(1711)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:74141465"
variation complement(1726)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:41274090"
variation complement(1727)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:139378888"
variation complement(1734)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:146900023"
variation complement(1750)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:372758887"
variation complement(1751)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:369033938"
variation complement(1753)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:376250417"
variation complement(1763)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:374703865"
variation complement(1778)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:61737718"
variation complement(1780)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:371983729"
variation complement(1796)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:141429762"
variation complement(1798)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:367823042"
variation complement(1805)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:374844431"
variation complement(1812)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:370247825"
variation complement(1815)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:138798862"
variation complement(1823)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:146096912"
variation complement(1826)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:376984969"
variation complement(1844)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:375428912"
variation complement(1846)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:199940048"
exon 1856..2007
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(1858)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:375734372"
variation complement(1862)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:368000502"
variation complement(1910)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:4548513"
variation complement(1915)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:187527391"
variation complement(1923)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:137910578"
variation complement(1936)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:139661235"
variation complement(1946)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:138314889"
variation complement(1971)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:182490263"
variation complement(1973)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:190239785"
variation complement(1976)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:184992188"
variation complement(1988)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:367616357"
variation complement(1995)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:10997034"
variation complement(2005)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:149081490"
exon 2008..2100
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(2023)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:77165728"
variation complement(2050)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:141141746"
variation complement(2052)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:147760277"
variation complement(2056)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:370600208"
variation complement(2059)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:111425421"
variation complement(2060)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:370269225"
variation complement(2062)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:376927818"
variation complement(2091)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:200764970"
exon 2101..2282
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(2129)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:377166040"
variation complement(2164)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:142116698"
variation complement(2176)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:199697536"
variation complement(2189)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:150734357"
variation complement(2194)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:374172412"
variation complement(2220)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:142942346"
variation complement(2245)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:148554495"
variation complement(2265)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:115972723"
variation complement(2281)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:143867269"
exon 2283..2388
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(2295)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:116662854"
variation complement(2334)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:192848934"
variation complement(2364)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:113397208"
variation complement(2371)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:149211186"
variation complement(2372)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:367848292"
variation complement(2383)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:142752710"
exon 2389..2523
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(2392)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:373175781"
variation complement(2394)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:372746141"
variation complement(2406)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:372435356"
variation complement(2425)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:368637046"
variation complement(2445)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:374450104"
variation complement(2501)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:188248522"
variation complement(2503)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:145119798"
exon 2524..3174
/gene="CTNNA3"
/gene_synonym="VR22"
/inference="alignment:Splign:1.39.8"
variation complement(2533)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:370688983"
variation complement(2537)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:200392000"
STS 2582..3088
/gene="CTNNA3"
/gene_synonym="VR22"
/standard_name="CTNNA3_4652"
/db_xref="UniSTS:462847"
variation complement(2617)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="t"
/db_xref="dbSNP:376310020"
variation complement(2623)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:202196166"
variation complement(2624)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:373081692"
variation complement(2647)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:199852825"
variation complement(2673)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:138237676"
variation complement(2676)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:115814032"
variation complement(2696)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="t"
/db_xref="dbSNP:41313840"
variation complement(2751)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:377740786"
variation complement(2752)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:374368635"
variation complement(2779)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:376134614"
variation complement(2819)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:190581449"
variation complement(2826)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="c"
/db_xref="dbSNP:369681914"
variation complement(2910)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="c"
/replace="g"
/db_xref="dbSNP:371283856"
variation complement(3054)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:77424782"
variation complement(3066)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:185258162"
variation complement(3073)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="a"
/replace="g"
/db_xref="dbSNP:74442277"
variation complement(3119)
/gene="CTNNA3"
/gene_synonym="VR22"
/replace="g"
/replace="t"
/db_xref="dbSNP:192926725"
ORIGIN
agatgcatcataagccaaattgtgagccatgatagtggcactgaatttctaaatacaagaaattgcttagacaattggtttagtatctgtatatgggcaatactctgtcctgcagtaggcagcatgtcagctgaaacaccaatcacattgaatatcgatcctcaggatctgcaggtccaaacattcaccgtggagaagctactggagcctctcataatccaggttaccacacttgtaaactgtccccagaacccttccagcaggaaaaaaggacgttcgaaaagagccagtgtccttctagcttctgtggaggaagcaacttggaatttattagacaagggagagaagattgcccaggaagctacagttttaaaggatgagcttacggcttcacttgaggaagttcgcaaagaaagtgaagctctgaaagtatcagctgagagatttacagatgacccctgttttctcccaaaaagggaggctgtggttcaagctgcccgtgccttgctggctgcggtgacgagactccttatccttgcggacatgattgatgtcatgtgcctcttgcaacatgtgtcagcttttcaaaggacatttgagtctctcaaaaatgttgccaacaaatctgacctccagaaaacctaccagaagcttgggaaggagctggaaaatttggattatttagccttcaaacgtcagcaggacttaaaatctccaaatcagagagatgaaattgcaggagcccgagcttcactgaaggagaactctcccctcttgcattcaatttgttcagcttgtttggagcattctgatgttgcttccctcaaagcaagcaaggacacagtttgtgaagaaattcagaatgctctcaatgtaatttcaaatgcttcacaagggatccagaatatgacaaccccaccagaacctcaggcagcaaccctgggaagtgcccttgatgagctggagaatttaattgtcctgaatccactcacagtaactgaggaggaaatacgaccatcactagagaaacgccttgaagccattatcagtggggctgctctgctggcggattcttcatgtacgagggacttacaccgagagcggattatcgcagaatgcaacgccattcgccaggctcttcaggatctgctttcagagtacatgaacaacgctggaaaaaaagaaaggagtaataccctgaatattgctttagacaacatgtgtaagaagacaagagaccttcgcagacagctccgcaaggctattatagatcatgtgtcagactctttcctggatacgacagtccctcttttggttctcattgaagctgctaagaatggccgggaaaaggaaataaaagaatatgctgcgatatttcatgaacacaccagcaggcttgtagaggtggcaaatcttgcttgttccatgtcaacaaatgaagatggaattaaaattgtcaaaattgcagccaatcatttggaaaccttgtgtccacagattattaatgctgcacttgctttggctgcaagacccaaaagtcaagcggtcaaaaacaccatggaaatgtacaagcgtacatgggagaatcatatacatgtcctcactgaagccgtagatgacattacaagcattgatgacttccttgctgtatctgaaagccatatcttggaagatgtcaacaagtgtatcatagccttaagagaccaggatgctgataatttagaccgtgctgcgggtgctatcagaggccgggcagcaagagttgctcacatcgtcacgggtgaaatggacagttacgagccaggggcttacacggaaggtgtaatgagaaatgttaacttccttacaagtactgtaattcctgaatttgtaacacaagtgaatgttgccttggaagccttaagcaaaagctcattgaatgtgttggatgataatcaatttgtggacatctcaaagaagatctatgatacaattcatgatatcagatgttcagtcatgatgattcggaccccagaggaactggaggatgtttctgaccttgaagaggaacacgaggtccgcagtcacaccagcattcagaccgaagggaaaactgatagggctaagatgactcaactgcctgaggcagaaaaagaaaagattgctgagcaagttgctgatttcaagaaagtaaagagtaagctggatgctgagattgagatatgggatgatacaagcaacgacatcattgttctggccaagaacatgtgtatgatcatgatggagatgacagacttcactaggggcaaaggaccactaaagcatacaactgatgtgatctatgcagcgaaaatgatatcagaatcaggatcaaggatggatgtccttgctcggcagattgctaatcagtgcccagatccatcttgtaaacaggacttgttggcctacctggaacagattaagttctactcccaccaactgaaaatctgcagtcaagttaaagctgagatccagaacctgggaggagagctcatcatgtcagctttggacagtgtcacatccctgatccaagcagccaaaaatttaatgaatgctgtagtgcaaacagtgaaaatgtcttacattgcctcaaccaagatcatccgaatccagagtcctgctgggccccggcacccagttgtgatgtggagaatgaaggctcctgcaaaaaaacccttgattaaaagagagaagccagaggaaacgtgtgcagctgtcagacgaggctcagcaaagaaaaaaatccatccattgcaagtcatgagtgaatttagaggaagacaaatctactgaaaccactattctacatatagtgcctatatgacaaaatcctgcctaaccacactgctttattttacacttaagaagttctgtaatttcactaagttttggtgtttaactcacaaataacataaaatattgggcgctaaatcaacaaaagcaatatatatttgggatcatatcactgtcatttctgtatggtcagcacctaatagttaaggaatatttgcttgttgaatgaatgaaattatcacgtgtcattcagcgtttcccatcatagagattatctactattcgttaccaaataaacacaggagaggccagagagtcctgtttatctgtaatacttcatgtacacttatcatccttatcttg
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:29119 -> Molecular function: GO:0005198 [structural molecule activity] evidence: IEA
GeneID:29119 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:29119 -> Molecular function: GO:0045296 [cadherin binding] evidence: TAS
GeneID:29119 -> Biological process: GO:0016337 [cell-cell adhesion] evidence: IPI
GeneID:29119 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
GeneID:29119 -> Cellular component: GO:0005916 [fascia adherens] evidence: IDA
GeneID:29119 -> Cellular component: GO:0015629 [actin cytoskeleton] evidence: IEA
GeneID:29119 -> Cellular component: GO:0030027 [lamellipodium] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.